Cancer Research Meeting Calendar Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mijal, R. S.
Right arrow Articles by Peterson, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mijal, R. S.
Right arrow Articles by Peterson, L. A.
[Cancer Research 66, 4968-4974, May 1, 2006]
© 2006 American Association for Cancer Research

Epidemiology and Prevention

DNA Sequence Context Affects Repair of the Tobacco-Specific Adduct O6-[4-Oxo-4-(3-pyridyl)butyl]guanine by Human O6-Alkylguanine-DNA Alkyltransferases

Renée S. Mijal1,2, Sreenivas Kanugula3, Choua C. Vu2, Qingming Fang3, Anthony E. Pegg3 and Lisa A. Peterson1,2

1 Division of Environmental Health Sciences and 2 The Cancer Center, University of Minnesota, Minneapolis, Minnesota and 3 Department of Cellular and Molecular Physiology, Milton S. Hershey Medical Center, Pennsylvania State University College of Medicine, Hershey, Pennsylvania

Requests for reprints: Lisa A. Peterson, The Cancer Center, University of Minnesota, Mayo Mail Code 806, 420 Delaware Street Southeast, Minneapolis, MN 55455. Phone: 612-626-0164; Fax: 612-626-5135; E-mail: peter431{at}umn.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The repair protein O6-alkylguanine-DNA alkyltransferase (AGT) protects cells from the mutagenic and carcinogenic effects of alkylating agents by removing O6-alkylguanine adducts from DNA. Recently, we established that AGT protects against the mutagenic effects of pyridyloxobutylation resulting from the metabolic activation of the tobacco-specific nitrosamines (TSNA) 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone and N-nitrosonornicotine by repairing O6-[4-oxo-4-(3-pyridyl)butyl]guanine (O6-pobG). There have been several epidemiologic studies examining the association between the I143V/K178R AGT genotype and lung cancer risk. Two studies have found positive associations, suggesting that AGT proteins differ in their repair of DNA damage caused by TSNA. However, it is not known how this genotype alters the biochemical activity of AGT. We proposed that AGT proteins may differ in their ability to remove large O6-alkylguanine adducts, such as O6-pobG, from DNA. Therefore, we examined the repair of O6-pobG by wild-type (WT) human, I143V/K178R, and L84F AGT proteins when contained in multiple sequence contexts, including the twelfth codon of H-ras, a mutational hotspot within this oncogene. The AGT-mediated repair of O6-pobG was more profoundly influenced by sequence context than that of O6-methylguanine. These differences are not the result of secondary structure (hairpin) formation in DNA. In addition, the I143V/K178R variant seems less sensitive to the effects of sequence context than the WT or L84F proteins. These studies indicate that the sequence dependence of O6-pobG repair by human AGT (hAGT) varies with subtle changes in protein structure. These data establish a novel functional difference between the I143V/K178R protein and other hAGTs in the repair of a toxicologically relevant substrate, O6-pobG. (Cancer Res 2006; 66(9): 4968-74)


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The tobacco-specific nitrosamines 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and N-nitrosonornicotine (NNN) are potent carcinogens in animal models and are likely involved in the development of tobacco-related cancers in humans (1). Both NNK and NNN are activated via {alpha}-hydroxylation to form DNA-reactive intermediates. NNK can form both methylating and pyridyloxobutylating agents, whereas NNN forms a pyridyloxobutylating agent (Fig. 1 ; ref. 1). The alkylation pathways contribute to the toxicologic activity of these compounds in animal models, in large part due to the formation of mutagenic DNA adducts (1–4).


Figure 1
View larger version (12K):
[in this window]
[in a new window]
  		Figure 1. Proposed metabolic activation pathways for NNK and structures of O6-methylguanine (O6-meG) and O6-pobG.

 
Although DNA alkylation produces a variety of modified DNA bases (5, 6), O6-alkylguanine adducts are important contributors to the mutagenic properties of nitrosamines (7–9). The mutagenicity of methylating agents is directly related to levels of O6-methylguanine formed (7). Recently, our group established that O6-[4-oxo-4-(3-pyridyl)butyl]guanine (O6-pobG) plays a major role in the mutagenic activity of pyridyloxobutylating compounds (10).

Both O6-methylguanine and O6-pobG are substrates for the DNA repair protein O6-alkylguanine-DNA alkyltransferase (AGT; refs. 11, 12). During the repair reaction, the alkyl group is directly transferred from the modified guanine to a cysteine residue at the protein active site, resulting in a change in protein conformation that signals for its degradation (11, 13). Thus, DNA repair by AGT is stoichiometric and can be depleted. Repair of O6-methylguanine and O6-pobG by AGT shields cells from the mutagenic effects of methylating (14, 15) and pyridyloxobutylating agents (10), respectively. In addition, AGT protects against carcinogenesis in animals exposed to alkylating agents (11, 15).

Exposure, genotype, and their interaction influence cancer susceptibility (16). Several epidemiologic studies have examined the hypothesis that AGT genotype modifies susceptibility to cancers linked to tobacco exposure. A positive association between the common I143V/K178R genotype and increased lung cancer risk was observed in two independent inquiries (17, 18). However, others have failed to replicate these findings (19, 20). When considering the combined exposure to tobacco and alcohol, I143V/K178R and another frequent variant, L84F, were associated with decreased risk of head and neck cancer (21). Although interpretation of these studies is complicated by the fact that they considered different exposure combinations, they imply that genetic variations in AGT may translate into phenotypic differences when individuals are exposed to tobacco products.

Several laboratory-based investigations have explored the phenotypic differences between these variant proteins. I143V/K178R and L84F proteins have comparable stability as the wild-type (WT) protein (21–23). In addition, there is no significant difference in the ability of these proteins to repair O6-methylguanine (23). However, human lymphocytes expressing I143V or L84F proteins exhibited a higher number of chromosomal aberrations resulting from exposure to NNK than lymphocytes expressing the WT protein (24). In addition, I143V/K178R was slightly more resistant to the pseudosubstrate O6-(4-bromothenyl)guanine than the WT protein (23). These studies are consistent with the hypothesis that I143V/K178R and/or L84F differ from the WT protein in their interaction with large O6-alkylguanine substrates, such as O6-pobG. Repair of O6-pobG is influenced by chemical and physical factors that are distinct from those that affect the removal of O6-methylguanine (25). Therefore, it is plausible that human variant proteins could vary in their ability to repair O6-pobG while repairing O6-methylguanine with similar efficiency.

In preliminary studies, the I143V/K178R and WT proteins reacted equally well with O6-pobG in a defined sequence (25). To more fully characterize the potential functional differences between the human variant proteins, we extended these studies to explore O6-pobG repair in several DNA sequence contexts. The available data indicate that repair of O6-methylguanine by AGT proteins is affected by neighboring bases (26–29). There is also evidence that interactions between adduct size and the active site of protein may determine the extent of sequence selectivity. For example, the two bacterial proteins, Ogt and Ada, differ in their sequence-dependent repair of O6-methylguanine (26, 30). Consequently, we proposed that sequence context effects may have a greater effect on the repair of O6-pobG and that these effects may differ between the various AGT variant proteins. Repair of O6-pobG was measured relative to that of O6-methylguanine, which allowed us to determine if the removal of the pyridyloxobutyl group was more profoundly affected by sequence context. We found that sequence context was an important factor in the efficiency of this reaction and made the novel observation that human polymorphic variant proteins differ in their sensitivity to these effects.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents. Electrophoresis reagents were purchased from Bio-Rad (Hercules, CA). [32P]ATP and T4-polynucleotide kinase were obtained from Amersham Biosciences (Piscataway, NJ). All other reagents were purchased from Fisher Scientific (Fairlawn, NJ) or Sigma-Aldrich Chemical Co. (Milwaukee, WI) unless otherwise noted.

AGT proteins. Recombinant His-tagged AGT proteins from human, mouse, rat, and Escherichia coli (AdaC) and variant human AGT (hAGT) proteins G160R and I143V/K178R were prepared as described previously (25, 31). The L84F human variant was produced using the same system, including a plasmid derived from that described for the expression of recombinant WT AGT-His6 (31). The sequence was altered to encode the desired mutant with the QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA) and primers 5'-d(CCCGTGCCAGCGTTCCACCATCCCGTTTTC)-3' and 5'-d(GAAAACGGGATGGTGGAACGCTGGCACGGG)-3' (mutated sites are italicized). The entire sequence of the coding region in this plasmid was confirmed by DNA sequencing.

Oligonucleotide preparation. Oligonucleotide substrates were purchased from Oligos Etc. (Wilsonville, OR), Integrated DNA Technologies (Coralville, IA), or the University of Minnesota MicroChemical Facility (Minneapolis, MN). The sequences of the oligonucleotides containing O6-pobG, O6-methylguanine, and unmodified guanines are listed in Table 1 . Oligonucleotides containing O6-methylguanine were deprotected according to the phosphoramidite manufacturer's instructions (Glen Research, Sterling, VA). The O6-pobG-containing oligonucleotides were prepared as described previously (32). All oligonucleotides were purified by high-pressure liquid chromatography before use. To confirm structure, the mass of the oligonucleotides was determined using an Agilent MSD Trap (Palo Alto, CA). The mass of all oligonucleotides containing O6-pobG and O6-methylguanine showed agreement with expected values (within 0.35 a.m.u.).


View this table:
[in this window]
[in a new window]
  		Table 1. Oligonucleotides used to test the effect of sequence context on O6-pobG repair

 
Repair assay. The repair of O6-pobG was determined relative to O6-methylguanine using a slight modification of a previously described PAGE method (25). Mixtures containing equal amounts of 32P-end-labeled oligonucleotides containing O6-methylguanine and O6-pobG were annealed with a 1- or 15-fold excess of the complementary oligonucleotide by heating to 80°C and slowly cooling to room temperature. The oligonucleotides (0.5 pmol) were then reacted with increasing amounts of mouse, rat, AdaC, WT human, I143V/K178R, L84F, and G160R proteins (0-25 ng) for 2 hours at 37°C (total volume 15 µL). Negative control reactions were done with protein pretreated with the AGT depletor O6-benzylguanine. All reactions were quenched by the addition of formamide loading buffer (18 µL) before loading on 20% denaturing PAGE gels. The gels were run for 3 to 4.5 hours to resolve oligonucleotides containing O6-pobG, O6-methylguanine, and guanine (repaired strand). Gels were imaged using a phosphorimaging screen, and densitometry was done using Molecular Analyst software (Molecular Dynamics, Amersham Biosciences, Piscataway, NJ). The percentage of each oligonucleotide (O6-pobG, O6-methylguanine, and guanine) present was determined for each protein concentration tested. Linear regression was used to measure the change in the amount of each oligonucleotide (a measure of repair) as a function of increasing protein in reaction mixtures. Eight to 12 measurements per AGT protein were used to obtain each measure of repair (slope of the line). A ratio measure of the repair of O6-methylguanine versus O6-pobG was obtained by dividing the respective slopes. At least two measures of repair were obtained for each protein sequence combination.

Nondenaturing PAGE experiments. 32P-end-labeled single- and double-stranded oligonucleotides (annealed to complementary strand in 1:1 and 1:15 oligonucleotide to complementary strand ratios at 80°C) were used in nondenaturing PAGE experiments to assess the potential of the oligonucleotide to form secondary structures. Samples were mixed with glycerol buffer (30% glycerol, 0.25% bromphenol blue, and 0.25% xylene cyanol) and run at least 7.5 hours at 4 to 6 W constant power through a 20% nondenaturing gel [45 mmol/L Tris, 45 mmol/L boric acid, 1 mmol/L EDTA, 150 mmol/L KCl (pH 8.15); ref. 33]. Gels were exposed to a phosphorimaging screen and imaged using a Storm 8400 PhosphorImager (Amersham Biosciences) to visualize oligonucleotide bands.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Five different oligonucleotide sequences were used in these studies (Table 1). Our previous studies were done with sequence 1 (25). Sequences 2 and 3 represent codons 11 to 14 of the rat H-ras gene. Sequence 2 has the O6-alkylguanine adduct at the first guanine of the twelfth codon, whereas sequence 3 has the adduct at the second base of the twelfth codon. Earlier studies showed that O6-methylguanine is repaired by bacterial and hAGT proteins at least 10 times more slowly when in the second base compared with the first (28, 29). This difference in repair rate may explain, in part, why the H-ras gene is exclusively mutated at the second base of the twelfth codon in mammary and skin tumors induced by N-methyl-N-nitrosourea (34).

Because of the potential for sequences 2 and 3 to hairpin (28, 35), sequences 4 and 5 were also prepared. These sequences, which retained H-ras codons 11 to 13, are not expected to hairpin. This was confirmed by analyzing 32P-end-labeled oligonucleotides by nondenaturing PAGE. Although sequences 2 and 3 displayed low molecular weight bands consistent with the presence of DNA hairpins, sequences 4 and 5 lacked such bands (Fig. 2 ). Because the low molecular weight bands disappeared when annealed with 15-fold excess complementary strand (Fig. 2), repair reactions with sequences 2 and 3 were done under these conditions.


Figure 2
View larger version (27K):
[in this window]
[in a new window]
  		Figure 2. Sequences 2 and 3 oligonucleotides show potential secondary structures when analyzed by nondenaturing PAGE. M, oligonucleotide containing O6-methylguanine; P, oligonucleotide containing O6-pobG. 1x and 15x, ratio (1:1 and 1:15) of complement used to anneal adducted oligonucleotides.

 
The experiments were done with seven AGT proteins. Four human variant proteins were examined: WT, I143V/K178R, L84F, and G160R. Although G160R is a rare human variant (17), it was included because it was more resistant to reaction with O6-pobG in our previous study; it did not repair O6-pobG in the presence of O6-methylguanine (25). Because rodent models have been important to describing the mechanism of NNK carcinogenesis (1), we also included the rat and mouse AGTs. Previously, we observed that these two proteins reacted equally well with O6-methylguanine and O6-pobG (25). The bacterial AdaC protein was used as a negative control because this protein was unable to repair O6-pobG (25).

To investigate the influence of sequence context on O6-pobG repair, we measured the competitive reaction of O6-pobG versus O6-methylguanine with AGT in defined oligonucleotide sequences. These competitive repair reactions allowed us to normalize the activity of each protein. A change in the repair ratio (pmol O6-pobG removed/pmol O6-methylguanine removed) between sequences indicates that the AGT-mediated removal of these alkyl groups is differentially influenced by the surrounding nucleotide environment. Oligonucleotide mixtures were separated by denaturing PAGE, and densitometry was used to assess the extent of repair. Representative gels are displayed in Fig. 3 .


Figure 3
View larger version (44K):
[in this window]
[in a new window]
  		Figure 3. Denaturing PAGE gels showing that the repair of O6-pobG by hAGT is affected by the opposing base. A, repair of O6-pobG-C in sequence 5 oligonucleotides. Lanes, left to right, increasing amounts of AGT protein starting with 0 ng (AGT preincubated with the depletor O6-benzylguanine) and increasing in 1 ng increments. B, repair of O6-pobG-T in sequence 5 oligonucleotides.

 
The results of these competitive repair reactions in dsDNA are displayed in Table 2 . The common human variants (WT, I143V/K178R, and L84F) all displayed ~2-fold preference in their repair of O6-methylguanine relative to O6-pobG within sequences 1 and 4. In marked contrast, all proteins only removed the pyridyloxobutyl group from sequences 2 or 3 after all of the O6-methylguanine was gone. This remained true even under circumstances in which oligonucleotides were annealed to excess complement to convert them to a double-stranded form (Fig. 2). The rodent proteins were much slower at repairing O6-pobG in these two sequences than the human variants.


View this table:
[in this window]
[in a new window]
  		Table 2. Relative repair of O6-pobG contained in sequences 1 to 5 as duplex DNA

 
Interestingly, a phenotypic difference between the common human variant proteins was observed with double-stranded sequence 5 oligonucleotides. Although I143V/K178R displayed the same selectivity for O6-methylguanine as it did in sequences 1 and 4, WT and L84F only repaired O6-pobG in this sequence context after all the methyl groups have been removed. The rodent AGTs reacted with O6-methylguanine and O6-pobG equally well in this sequence context, similar to what was observed in sequences 1 and 4. To determine which of the two amino acid substitutions in I143V/K178R contributed to the phenotypic difference between human proteins, we examined the repair of O6-pobG by I143V protein. This protein yielded results indistinguishable from I143V/K178R for both sequence 4 and sequence 5.

The relative repair rates were also determined for sequences 1 to 5 as single-stranded substrates with WT, I143V/K178R, G160R, and rat proteins. With the exception of sequence 5, the relative rates of repair were similar to those obtained for these oligonucleotides when double stranded (data not shown; ref. 25). All proteins poorly repaired O6-pobG relative to O6-methylguanine when sequence 5 was single stranded. However, the degree to which they were resistant to repair varied; the WT and G160R proteins exhibited particularly poor repair of the O6-pobG [ratio of O6-methylguanine/O6-pobG repair (>>5)] compared with the I143V/K178R and rat proteins (≥5).

Because point mutations induced by O6-pobG in mammalian cells are mainly G:C to A:T transitions (36), we did a series of experiments with sequences 1 and 5 in which T was positioned across from the modified base. Although the relative repair rates in sequence 1 were unaffected by this change, there was a significant increase in repair of O6-pobG relative to O6-methylguanine in sequence 5 by WT and L84F proteins (Table 2; Fig. 3).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We evaluated AGT-mediated repair of O6-pobG relative to O6-methylguanine in multiple sequences to determine if it is affected by sequence context. From this set of preliminary experiments, we conclude that O6-pobG repair is more profoundly influenced by the surrounding nucleotide environment than O6-methylguanine repair. In addition, protein structure shapes the extent of these sequence context effects. Single amino acid changes altered the ratio of O6-methylguanine to O6-pobG repair within the same sequence context. This is a novel finding. Because DNA repair but not replication seems to play a larger role in determining mutational hotspots by O6-alkylguanine adducts (30, 37, 38), this intriguing observation may provide important insight into understanding interindividual differences in cancer risk associated with tobacco exposure.

Previous kinetic studies with O6-methylguanine indicated that AGT recognizes this adduct in different sequences equally but repairs them at different rates (29). The surrounding nucleotides affect the rate of either base flipping or alkyl group transfer. Our studies suggest that these effects are likely to be more pronounced for the larger pyridyloxobutyl group.

Conformational differences are likely to explain, in part, the sequence context effects on O6-pobG repair. Changes in adduct conformation as well as conformation of the DNA helix must be considered for their effects on repair. Variations in adduct and DNA conformation were invoked to explain the sequence-dependent difference in rate of AGT-mediated repair and antibody recognition of O6-methylguanine in sequences 2 and 3 (28). Similarly, differences in the repair of bulky O6-pobG in sequences 4 (adduct positioned at G1) and 5 (adduct positioned at G2) are likely due to sequence-dependent alterations in adduct conformation. This hypothesis is supported by several pieces of data presented in this article. First, marked differences in repair ratio are observed with the WT and L84F proteins in sequence 5 when the adduct is base paired with C versus T. Both proteins react slowly with O6-pobG when C is positioned opposite the adduct; however, this resistance is removed when T is base paired with the adduct. In addition, the marked improvement in the repair of O6-pobG in sequence 5 when presented as a double-stranded substrate implies that the conformation of the adduct is altered in a DNA duplex. Observations from the repair experiments are consistent with previous reports of the opposing base effecting the conformation of O6-pobG (39, 40). Nuclear magnetic resonance solution structures of this adduct contained in sequence 1 show that O6-pobG forms three hydrogen bonds with C through unusual base pairing with the ketone group of the adduct. In contrast, the adduct forms only a single hydrogen bond with T, with a significant increase in the distortion of the DNA backbone. The effect of the nucleotide neighbors on the conformation of O6-pobG and the ability of the adduct to hydrogen bond with the complementary strand are unexplored.

The markedly poor repair of O6-pobG in sequences 2 and 3 oligonucleotides is consistent with the presence of helical distortions or alternative DNA conformations that are known to influence repair (41–43). Although it is conceivable that these H-ras oligonucleotides could form secondary hairpin structures that inhibit repair (35), our studies with nondenaturing gels indicate that it is highly unlikely that DNA hairpin structures are stabilized by O6-pobG. They also suggest that the DNA substrates used in our study were double stranded (Fig. 2) despite the known destabilizing effect of this adduct on double stranded DNA (39). Instead, changes in DNA conformation are likely to account for the poor repair of O6-pobG by all proteins in this sequence. Oligonucleotides 2 and 3 are GC rich, which makes them more likely to adopt alternative conformations than sequences 4 and 5 (44). The poor repair of O6-pobG by all proteins in double-stranded sequences 2/3 compared with the generally efficient repair of double-stranded sequences 4/5 suggests that the DNA sequence beyond the nearest nucleotide neighbors can also influence repair. Further studies are needed to determine how O6-pobG affects DNA conformation of these sequences.

The most intriguing finding of our studies was the observation that small changes in AGT protein structure modified the effect of local DNA sequence on O6-pobG repair. The mouse and rat proteins were much less efficient at removing O6-pobG from sequences 2 and 3 than the human proteins. Rodent proteins differ from the human proteins in the amino acid composition of the binding pocket (25). Any of these alterations could account for differences in repair efficiency. Importantly, hAGT variants also vary in their sensitivity to sequence effects. The ability of the WT and L84F proteins to repair O6-pobG relative to O6-methylguanine was more strongly influenced by nucleotide environment than that of I143V/K178R. Because the results obtained with I143V were essentially identical to those obtained with I143V/K178R, the I143V substitution is responsible for the phenotypic difference between I143V/K178R and the other common variant proteins. The amino acid change occurs within the binding pocket in close proximity to the active site C145. We propose that the I143V substitution alters the geometry of the AGT-binding pocket to permit efficient repair of bulky O6-pobG even when it is in conformations that may be poorly repaired by other human variants.

These data establish a novel functional difference between the I143V/K178R protein and other hAGTs in the repair of a toxicologically relevant substrate, O6-pobG. Functional studies of polymorphic repair proteins have largely screened for differences in the overall level of repair (45). Our data suggest that repair phenotypes may be more nuanced. We hypothesize that AGT genotype will influence the pattern of adduct distribution across the genome in a way that reflects the sequence specificity of repair by the AGT variant. This sequence-specific phenotype has the potential to change the mutation spectra in cells, which in turn will influence the molecular and phenotypic characteristics of the resulting tumor. Clearly, additional studies are needed to determine how subtle differences in repair phenotype can modify the propensity for tumor development and affect tumor characteristics.

These findings, like previous reports, suggest that the I143V/K178R and WT hAGT proteins are indeed functionally different (23, 24). It has also been reported that WT and I143V/K178R AGT proteins differ in their interactions with the nucleobase pseudosubstrate O6-(4-bromothenyl)guanine (23). In this case, the WT protein reacts slightly better. The reactions between AGT and nucleobases differ substantially from those between AGT and O6-alkylguanine adducts in DNA (12, 46). Further study is required to determine if our studies are inconsistent with those of Hill et al. (24), who reported a higher frequency of chromosomal aberrations when cells were of the I143V/K178R genotype. Although their data suggest that the I143V/K178R protein repairs NNK-derived DNA damage less efficiently than the WT protein, they did not measure the repair of NNK-derived O6-alkylguanine adducts in these cells. Differences in sequence specificity of repair could alter the frequency of chromosomal aberrations because there are sequences of DNA that seem to be more susceptible to strand breakage (47). Detailed studies are needed to link our in vitro findings to toxicologic effects, such as mutation frequency, chromosomal aberrations, and cancer risk. Results from such experiments will be useful in the formulation of more rigorous mechanism-based hypotheses in molecular epidemiologic studies.

The contribution of AGT-mediated repair to the overall repair of mutagenic O6-pobG adduct requires further definition. Nucleotide excision repair is thought to play a role in the repair of bulky O6-alkylguanine adducts (11). It is not known if O6-pobG is a substrate for this repair pathway. Preliminary data indicate that AGT is a major pathway for repair as the adduct was more mutagenic in human cells pretreated with the AGT depletor O6-benzylguanine than in untreated cells; the cell lines used have functional nucleotide excision repair (36). It will be important to establish the relative involvement of all repair pathways to adequately assess the importance of our findings to cancer susceptibility in humans.

In conclusion, this work highlights the importance of sequence context in the repair of O6-alkylguanine adducts. First, we report that the effect of sequence context varies with the chemical nature of the DNA adduct; the removal of the bulky pyridyloxobutyl group is more strongly affected by its nucleotide neighbors than that of the smaller methyl group. In addition, we observed that interactions between the local DNA environment and protein structure significantly influence O6-pobG repair by AGT. Single amino acid changes in the protein-binding pocket can alter the sequence specificity of the repair reaction. This new observation suggests another mechanism by which small amino acid changes encoded by single nucleotide polymorphisms could alter repair phenotype and, ultimately, individual susceptibility to the toxicologic effects of environmental carcinogens. Careful examination of this hypothesis, particularly when considering exposure to chemical mixtures, is warranted.


   Acknowledgments
 
Grant support: NIH grants CA-59887 and CA-115309, Cancer Center grants CA-77598 (L.A. Peterson) and CA-18137 (A.E. Pegg), and NIH funded training grant ES-10956 (R. Mijal).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Brock Matter (The Cancer Center Mass Spectrometry Core, University of Minnesota) for the assistance with mass spectrometry.

Received 10/20/05. Revised 2/23/06. Accepted 3/ 1/06.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hecht SS. Biochemistry, biology, and carcinogenicity of tobacco-specific N-nitrosamines. Chem Res Toxicol 1998;11:560–603.
  2. Staretz ME, Foiles PG, Miglietta LM, Hecht SS. Evidence for an important role of DNA pyridyloxobutylation in rat lung carcinogenesis by 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone: effects of dose and phenethyl isothiocyanate. Cancer Res 1997;57:259–66.[Abstract/Free Full Text]
  3. Peterson LA, Hecht SS. O6-Methylguanine is a critical determinant of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone tumorigenesis in A/J mouse lung. Cancer Res 1991;51:5557–64.[Abstract/Free Full Text]
  4. Peterson LA, Thomson NM, Crankshaw DL, Donaldson EE, Kenney PJ. Interactions between methylating and pyridyloxobutylating agents in A/J mouse lungs: implications for 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone-induced lung tumorigenesis. Cancer Res 2001;61:5757–63.[Abstract/Free Full Text]
  5. Hecht SS, Villalta PW, Sturla SJ, et al. Identification of O2-substituted pyrimidine adducts formed in reactions of 4-(acetoxymethylnitrosamino)-1-(3-pyridyl)-1-butanone and 4-(acetoxymethylnitrosamino)-1-(3-pyridyl)-1-butanol with DNA. Chem Res Toxicol 2004;17:588–97.[CrossRef][Medline]
  6. Wang M, Cheng G, Sturla SJ, et al. Identification of adducts formed by pyridyloxobutylation of deoxyguanosine and DNA by 4-(acetoxymethylnitrosamino)-1-(3-pyridyl)-1-butanone, a chemically activated form of tobacco specific carcinogens. Chem Res Toxicol 2003;16:616–26.[Medline]
  7. Margison GP, Santibanez Koref MF, Povey AC. Mechanisms of carcinogenicity/chemotherapy by O6-methylguanine. Mutagenesis 2002;17:483–7.[Abstract/Free Full Text]
  8. Jansen JG, Vrieling H, van Teijlingen MM, Ohn GR, Tates AD, van Zeeland AA. Marked differences in the role of O6-alkylguanine in hprt mutagenesis in T-lymphocytes of rats exposed in vivo to ethylmethylsulfonate, N-(2-hydroxyethyl)-N-nitrosourea, or N-ethyl-N-nitrosourea. Cancer Res 1995;55:1875–82.[Abstract/Free Full Text]
  9. Ferrezuelo F, Prieto-Alamo MJ, Jurado J, Pueyo C. Role of DNA repair by (A)BC excinuclease and Ogt alkyltransferase in the final distribution of LacI–d mutations induced by N-butyl-N-nitrosourea in Escherichia coli. Mutagenesis 1998;13:507–14.[Abstract/Free Full Text]
  10. Mijal RS, Loktionova NA, Vu CC, Pegg AE, Peterson LA. O6-Pyridyloxobutylguanine adducts contribute to the mutagenic properties of pyridyloxobutylating agents. Chem Res Toxicol 2005;18:1619–25.[CrossRef][Medline]
  11. Pegg AE. Repair of O6-alkylguanine by alkyltransferase. Mutat Res 2000;462:83–100.[CrossRef][Medline]
  12. Wang L, Spratt TE, Liu XK, Hecht SS, Pegg AE, Peterson LA. Pyridyloxobutyl adduct O6-[4-oxo-4-(3-pyridyl)butyl]guanine is present in 4-(acetoxymethylnitrosamino)-1-(3-pyridyl)-1-butanone-treated DNA and is a substrate for O6-alkylguanine-DNA alkyltransferase. Chem Res Toxicol 1997;10:562–7.[CrossRef][Medline]
  13. Xu-Welliver M, Pegg AE. Degradation of the alkylated form of the DNA repair protein, O6-alkylguanine-DNA alkyltransferase. Carcinogenesis 2002;23:823–30.[Abstract/Free Full Text]
  14. von Hofe E, Fairbairn L, Margison GP. Relationship between O6-alkylguanine-DNA alkyltransferase activity and N-methyl-N'-nitro-N-nitrosoguanidine-induced mutation, transformation, and cytotoxicity in C3H/10T1/2 cells expressing exogenous alkyltransferase genes. Proc Natl Acad Sci U S A 1992;89:11199–203.[Abstract/Free Full Text]
  15. Ellison KS, Dogliotti E, Connors TD, Basu AK, Essigmann JM. Site-specific mutagenesis by O6-alkylguanines located in the chromosomes of mammalian cells: influence of the mammalian O6-alkylguanine-DNA alkyltransferase. Proc Natl Acad Sci U S A 1989;86:8620–4.[Abstract/Free Full Text]
  16. Shields PG, Harris CC. Cancer risk and low-penetrance susceptibility genes in gene-environment interactions. J Clin Oncol 2000;18:2309–15.[Abstract/Free Full Text]
  17. Kaur TB, Travaline JM, Gaughan JP, Richie JP, Jr., Stellman SD, Lazarus P. Role of polymorphisms in codons 143 and 160 of the O6-alkylguanine DNA alkyltransferase gene in lung cancer risk. Cancer Epidemiol Biomarkers Prev 2000;9:339–42.[Abstract/Free Full Text]
  18. Cohet C, Borel S, Nyberg F, et al. Exon 5 polymorphisms in the O6-alkylguanine DNA alkyltransferase gene and lung cancer risk in non-smokers exposed to second-hand smoke. Cancer Epidemiol Biomarkers Prev 2004;13:320–3.[Abstract/Free Full Text]
  19. Yang M, Coles BF, Caporaso NE, Choi Y, Lang NP, Kadlubar FF. Lack of association between Caucasian lung cancer risk and O6-methylguanine-DNA methyltransferase-codon 178 genetic polymorphism. Lung Cancer 2004;44:281–6.[CrossRef][Medline]
  20. Krzesniak M, Butkiewicz D, Samojedny A, Chorazy M, Rusin M. Polymorphisms in TDG and MGMT genes—epidemiological and functional study in lung cancer patients from Poland. Ann Hum Genet 2004;68:300–12.[CrossRef][Medline]
  21. Huang WY, Olshan AF, Schwartz SM, et al. Selected genetic polymorphisms in MGMT, XRCC1, XPD, and XRCC3 and risk of head and neck cancer: a pooled analysis. Cancer Epidemiol Biomarkers Prev 2005;14:1747–53.[Abstract/Free Full Text]
  22. Ma S, Egyhazi S, Ueno T, et al. O6-methylguanine-DNA-methyltransferase expression and gene polymorphisms in relation to chemotherapeutic response in metastatic melanoma. Br J Cancer 2003;89:1517–23.[CrossRef][Medline]
  23. Margison GP, Heighway J, Pearson S, et al. Quantitative trait locus analysis reveals two intragenic sites that influence O6-alkylguanine-DNA alkyltransferase activity in peripheral blood mononuclear cells. Carcinogenesis 2005;26:1473–80.[Abstract/Free Full Text]
  24. Hill CE, Wickliffe JK, Wolfe KJ, Kinslow CJ, Lopez MS, Abdel-Rahman SZ. The L84F and the I143V polymorphisms in the O6-methylguanine-DNA-methyltransferase (MGMT) gene increase human sensitivity to the genotoxic effects of the tobacco-specific nitrosamine carcinogen NNK. Pharmacogenet Genomics 2005;15:571–8.[Medline]
  25. Mijal RS, Thomson NM, Fleischer NL, et al. The repair of the tobacco-specific nitrosamine derived adduct O6-[4-oxo-4-(3-pyridyl)butyl]guanine by O6-alkylguanine-DNA alkyltransferase variants. Chem Res Toxicol 2004;17:424–34.[CrossRef][Medline]
  26. Topal MD, Eadie JS, Conrad M. O6-methylguanine mutation and repair is nonuniform. Selection for DNA most interactive with O6-methylguanine. J Biol Chem 1986;261:9879–85.[Abstract/Free Full Text]
  27. Dolan ME, Oplinger M, Pegg AE. Sequence specificity of guanine alkylation and repair. Carcinogenesis 1988;9:2139–43.[Abstract/Free Full Text]
  28. Georgiadis P, Smith CA, Swann PF. Nitrosamine-induced cancer: selective repair and conformational differences between O6-methylguanine residues in different positions in and around codon 12 of rat H-ras. Cancer Res 1991;51:5843–50.[Abstract/Free Full Text]
  29. Meyer AS, McCain MD, Fang Q, Pegg AE, Spratt TE. O6-alkylguanine-DNA alkyltransferases repair O6-methylguanine in DNA with Michaelis-Menten-like kinetics. Chem Res Toxicol 2003;16:1405–9.[CrossRef][Medline]
  30. Delaney JC, Essigmann JM. Effect of sequence context on O6-methylguanine repair and replication in vivo. Biochemistry 2001;40:14968–75.[CrossRef][Medline]
  31. Liu L, Xu-Welliver M, Kanugula S, Pegg AE. Inactivation and degradation of O6-alkylguanine-DNA alkyltransferase after reaction with nitric oxide. Cancer Res 2002;62:3037–43.[Abstract/Free Full Text]
  32. Wang L, Spratt TE, Pegg AE, Peterson LA. Synthesis of DNA oligonucleotides containing site-specifically incorporated O6-[4-oxo-4-(3-pyridyl)butyl]guanine and their reaction with O6-alkylguanine-DNA alkyltransferase. Chem Res Toxicol 1999;12:127–31.[CrossRef][Medline]
  33. El Amri C, Mauffret O, Monnot M, et al. A DNA hairpin with a single residue loop closed by a strongly distorted Watson-Crick G.C base-pair. J Mol Biol 1999;294:427–42.[CrossRef][Medline]
  34. Zarbl H, Sukumar S, Arthur AV, Martin-Zanca D, Barbacid M. Direct mutagenesis of Ha-ras-1 oncogenes by N-nitroso-N-methylurea during initiation of mammary carcinogenesis in rats. Nature 1985;315:382–5.[CrossRef][Medline]
  35. Bishop RE, Moschel RC. Positional effects on the structure and stability of abbreviated H-ras DNA sequences containing O6-methylguanine residues at codon 12. Chem Res Toxicol 1991;4:647–54.[CrossRef][Medline]
  36. Pauly GT, Peterson LA, Moschel RC. Mutagenesis by O6-[4-oxo-4-(3-pyridyl)butyl]guanine in Escherichia coli and human cells. Chem Res Toxicol 2002;15:165–9.[CrossRef][Medline]
  37. Vidal A, Abril N, Pueyo C. DNA repair by Ogt alkyltransferase influences EMS mutational specificity. Carcinogenesis 1995;16:817–21.[Abstract/Free Full Text]
  38. Vidal A, Abril N, Pueyo C. The influence of DNA repair by Ogt alkyltransferase on the distribution of alkylnitrosourea-induced mutations in Escherichia coli. Environ Mol Mutagen 1997;29:180–8.[Medline]
  39. Peterson LA, Vu C, Hingerty BE, Broyde S, Cosman M. Solution structure of O6-[4-oxo-4-(3-pyridyl)butyl]guanine adduct in an 11mer DNA duplex: evidence for formation of a base triplex. Biochemistry 2003;42:13134–44.[Medline]
  40. Cosman M, Peterson LA, Vu CC, Hingerty BE. Solution structure of an O6-[4-oxo-4-(3-pyridyl)butyl]guanine adduct positioned opposite dT in an 11mer DNA duplex. Proc Am Assoc Cancer Res 2005;46:4820.
  41. Voigt JM, Topal MD. O6-methylguanine and A.C and G.T mismatches cause asymmetric structural defects in DNA that are affected by DNA sequence. Biochemistry 1990;29:5012–8.[CrossRef][Medline]
  42. Boiteux S, Costa dO, Laval J. The Escherichia coli O6-methylguanine-DNA methyltransferase does not repair promutagenic O6-methylguanine residues when present in Z-DNA. J Biol Chem 1985;260:8711–5.[Abstract/Free Full Text]
  43. Boiteux S, Laval F. Repair of O6-methylguanine, by mammalian cell extracts, in alkylated DNA and poly(dG-m5dC).(poly dG-m5dC) in B and Z forms. Carcinogenesis 1985;6:805–7.[Abstract/Free Full Text]
  44. Keller PB, Loprete DM, Hartman KA. Structural forms and transitions of poly(dG-dC) with Cd(II), Ag(I), and NaNO3. J Biomol Struct Dyn 1988;5:1221–9.[Medline]
  45. Spitz MR, Wei Q, Dong Q, Amos CI, Wu X. Genetic susceptibility to lung cancer: the role of DNA damage and repair. Cancer Epidemiol Biomarkers Prev 2003;12:689–98.[Free Full Text]
  46. Pegg AE, Kanugula S, Edara S, Pauly GT, Moschel RC, Goodtzova K. Reaction of O6-benzylguanine-resistant mutants of human O6-alkylguanine-DNA alkyltransferase with O6-benzylguanine in oligodeoxyribonucleotides. J Biol Chem 1998;273:10863–7.[Abstract/Free Full Text]
  47. Bystritskiy AA, Razin SV. Breakpoint clusters: reason or consequence? Crit Rev Eukaryot Gene Expr 2004;14:65–77.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
R. Guza, L. Ma, Q. Fang, A. E. Pegg, and N. Tretyakova
Cytosine Methylation Effects on the Repair of O6-Methylguanines within CG Dinucleotides
J. Biol. Chem., August 21, 2009; 284(34): 22601 - 22610.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mijal, R. S.
Right arrow Articles by Peterson, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mijal, R. S.
Right arrow Articles by Peterson, L. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online