| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology, and Genetics |
1 Lankenau Institute for Medical Research, Wynnewood, Pennsylvania; 2 Department of Pathology, Duke University School of Medicine, Durham, North Carolina; and 3 Department of Pathology, Anatomy, and Cell Biology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, Pennsylvania
Requests for reprints: George C. Prendergast, Lankenau Institute for Medical Research, 100 Lancaster Avenue, Wynnewood, PA 19096. Phone: 610-645-8475; Fax: 610-645-8533; E-mail: prendergast{at}limr.org.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Modifier genes may offer usefulness in this regard given their effects on dormancy versus progression in the context of certain oncogenic pathways that drive neoplasia (1, 2). Alterations in the structure or regulation of a candidate modifier gene that correlates with progression status can offer one line of evidence for a marker. By evaluating alterations in an animal model, one can directly determine whether they are coincidental or causal to disease. To identify disease modifier genes, classic genetics can be used to map genes by "top-down" designs or reverse genetics can be used to assess candidates via "bottom-up" designs, with the understanding that a candidate will be phenotypically silent in the absence of relevant oncogenic lesions. In the present study, we used the latter approach to test the hypothesis that Bin1 acts as a negative modifier of breast cancer progression.
Bin1 encodes a nucleocytosolic BAR adapter protein that can interact with the c-Myc oncoprotein and inhibit its cell transforming activity (35). c-Myc is involved in the development of many human breast cancers where its overexpression has been associated with poor prognosis (6). At least 10 splice isoforms of Bin1 exist, with differences in the pattern of tissue distribution, subcellular localization, and protein interactions that indicate diverse functional roles (710). BAR adapter proteins include a signature fold termed the BAR domain that recognizes curved vesicular membranes (11). Although BAR adapter proteins have a canonical function in membrane dynamics (12), in certain family members that localize to the nucleus (e.g., including Bin1 and APPL proteins), a moonlighting function in transcriptional regulation has been suggested (4, 5, 13). Notably, only those Bin1 isoforms that are capable of localizing to the nucleus are capable of suppressing oncogenic transformation, facilitating cell suicide, and promoting immune escape of transformed cells in various model systems (3, 4, 1420). Although attenuation of Bin1 by silencing or missplicing is a frequent event in many human cancers, including breast cancer (3, 16), the consequences of Bin1 loss on tumor progression have not been addressed directly in a preclinical model of disease. Therefore, we tested whether such losses were sufficient to drive initiation or progression of cancers in mice harboring mammary glandspecific deletions of Bin1.
| Materials and Methods |
|---|
|
|
|---|
|
X174 phage DNA (Fisher) as a molecular size marker. The primers used to monitor the Bin1 flox allele were 5'-TGGAGTCTGCCACCTTCTATCC-3' (loxP1) and 5'GCTCATACACCTCCTGAAGACAC3' (loxP2; Integrated DNA Technologies, Inc.) with expected sizes of 0.9, 1.07, and 0.31 kb for WT, flox, and recombined flox (flox
) alleles, respectively. Following a 4-min denaturation at 94°C, 35 cycles of PCR were done at 94°C for 20 s, 58°C for 1 min, and 72°C for 1 min with the addition of a 10-min final elongation step at 72°C. The primers and PCR conditions used to monitor the Bin1 KO allele have been described (22). The primers used to monitor the wap-cre gene were 5'-GCGGTCTGGCAGTAAAAACTATC-3' (Wap1) and 5'-GTGAAACAGCATTGCTGTCACTT-3'(Wap2) with allele-positive mice identified by a single 100-bp agarose gel band. PCR conditions for the wap-cre gene were as follows: after a 4-min denaturation at 94°C, 40 cycles of PCR were done at 94°C for 30 s, 62°C for 1 min, and 72°C for 1 min with the addition of a 5-min final elongation step at 72°C. The primers used to monitor the MMTV-c-myc gene were 5'-CCCAAGGCTTAAGTAAGTTTTTGG-3' (Myc1) and 5'-GGGCATAAGCACAGATAAAACACT-3' (Myc2) with allele-positive mice identified by a single 880-bp agarose gel band. PCR conditions for the MMTV-c-myc gene were as follows: after a 3-min denaturation at 96°C, 39 cycles of PCR were done at 96°C for 30 s, 58°C for 1 min, and 72°C for 1 min with the addition of a 5-min final elongation step at 72°C.
Mammary gland carcinogenesis. After one round of pregnancy, female mice received s.c. implants in the intrascapular area of two compressed pellets of 20 mg medroxyprogesterone acetate (Hormone Pellet Press). Three weeks later, we gave the first of four weekly doses of 50 mg/kg 7,12-dimethylbenz(a)anthracene (DMBA; Sigma, St. Louis, MO), given p.o. in cottonseed oil, with the three subsequent doses delivered 1, 3, and 4 weeks after the first dose. On this regimen, we observed mammary tumors to appear with a frequency of
100% with an average latency of 112 days,4 not significantly longer than the 99 days reported for CD2F1 (BALB/CXDBA/2) mice (23).
Cell biology. Murine mammary epithelial cells (MMEC) explanted from breast tumors were cultured in DMEM containing 10% fetal bovine serum (FBS; HyClone) and antibiotics. Cells were passaged multiple times at a 1:4 passage ratio to rid explanted tissue of contaminating fibroblasts and other cells. Western blot and immunofluorescence analyses with E-cadherin and ß-catenin antibodies (see below) were done to confirm the epithelial nature of MMEC cultures established in this manner. Cell proliferation assays were done by seeding 1 x 106 cells in 100-mm dishes and harvesting at various times later for counting by trypan blue exclusion (24). For serum deprivation, cells were treated the day after seeding them into culture for 24 h with DMEM containing 0.1% FBS. For anchorage-independent growth, 1 x 104 cells were seeded in soft agar, and colony formation was documented as described previously (24). For flow cytometry, cells were harvested, washed once with PBS, fixed in 70% ethanol, stained with propidium iodide, and analyzed on a FACScan device (Becton Dickinson). For motility assays, 1 x 106 cells were seeded in a 100 µL droplet in individual wells of a six-well plate and incubated for 16 h. When cells reached confluency within the droplet, its center was scratched, 2 mL DMEM plus 10% FBS was added to the well, and motility was documented at 48 h by photomicrography.
Western blot analysis. Cells were harvested by washing thrice in PBS before lysis in 1x radioimmunoprecipitation assay buffer [1x PBS containing 1% NP40, 0.5% sodium-deoxycholate, 0.1% SDS, 10 µg/mL phenylmethylsulfonyl fluoride] with 10 µL/mL Protease Inhibitor Set II and III (Calbiochem). Protein was quantitated by Bradford assay and 50 µg protein per sample was analyzed by SDS-PAGE. Gels were processed by standard Western blotting methods using the Bin1 antibody 2F11 (ammonium sulfate supernatant, 1:200 dilution) and horseradish peroxidase (HRP)conjugated goat anti-mouse secondary antibody (1:2,000 dilution; Cell Signaling). For actin, a primary anti-actin goat polyclonal antibody was used (1:500 dilution; Santa Cruz Biochemicals) and HRP-conjugated rabbit anti-goat secondary antibody (1:5,000 dilution; Southern Biotechnology Associates). For cell adhesion proteins, primary antibodies used included anti-E-cadherin (1:1,000 dilution; clone 36, Transduction Laboratories), anti-ß-catenin (1:1,000 dilution; clone 5H10, Zymed), anti-N-cadherin (1:1,000 dilution; clone 3B9, Zymed), anti-vimentin (1:1,000 dilution; clone Vim13.2, Sigma), and goat anti-mouse secondary antibody (1:1,000 dilution; Southern Biotechnology Associates). Detection was done routinely using a commercial kit (enhanced chemiluminescence-Western blot, Amersham).
Zymogram analysis. Gelatinase activity in protein extracts from established MMEC tumor cell lines was monitored as described.5
Orthotopic tumor formation assay. Cells (1 x 107) were suspended in 200 µL DMEM and injected orthotopically into the mammary fat pads of syngeneic F1 offspring from FVB-N and C57BL/6J breeders (The Jackson Laboratory) or immunocompromised CD-1 nude (Crl:CD-1-nuBR) mice (Charles River Laboratories). When tumors reached
20 mm in diameter, mice were euthanized and tumor weight(s) and volume(s) were calculated via caliper (volume = width2 x length x 0.52).
| Results |
|---|
|
|
|---|
C mutation was included, such that exon 3 was flanked on its 5' side by a WT loxP site and on its 3' side by the mutated loxP site (Fig. 1A). This variation conferred a selective advantage to Cre-mediated excision of the neo cassette in vitro, without compromising the subsequent ability of Cre to delete the floxed target sequence in vivo.4 Chimeric mice generated from targeted ES cell transfectants were interbred with transgenic mice to produce strains that included the WT Bin1 allele (+), floxed KO allele (flox), and straight KO allele (22) along with a breast-specific wap-cre transgene and, in some experiments, a MMTV-c-myc transgene. In animals carrying the wap-cre gene, loxP-mediated recombination in females was induced by parity because the whey acidic protein (wap) promoter is activated in mammary epithelial cells during pregnancy. Bin1 is haplosufficient for survival (22), so the breeding scheme compared mice with +/flox or KO/flox genotypes to compare the effects of functional ablation. As expected, mice with a wap-cre;KO/flox genotype exhibited tissue-specific conversion of the floxed allele to the desired flox
allele in genomic DNA isolated from mammary gland from late pregnancy through weaning (Fig. 1B and C). To simplify nomenclature, in the text that follows, we refer to mice with a wap-cre;+/flox or wap-cre;KO/flox genotype as Bin1+mam or Bin1
mam mice, respectively, indicating the retention of one functional allele or the loss of both alleles in the mammary gland. In work to be reported elsewhere,6 we confirmed that the flox
allele is functionally inactivated based on its ability to phenocopy a straight KO allele with regard to myocardial hypertrophy and perinatal lethality (22). These experiments confirmed that the model system operated as required to investigate the effect of Bin1 ablation on remodeling and tumorigenesis in the mammary gland.
To evaluate whether Bin1 loss affected mammary gland remodeling induced by pregnancy, female mice were set up for timed pregnancies by monitoring for vaginal plugs. After parturition, litter sizes were normalized to five pups and nursing was continued 1 week to ensure full lactation before pups were removed to induce mammary gland involution. Mammary gland tissues were isolated for analysis from virgins (control) or at 18.5 days post coitum (dpc), 7.5 days post partum (dpp; full lactation), 10.5 dpp (early involution), 17.5 dpp (late involution), and 27.5 dpp (full regression). A delay in the kinetics of ductolobular development was apparent at 18.5 dpc, at which time Bin1
mam mice showed significantly less glandular remodeling than Bin1+mam mice (Fig. 2
). However, during lactation at 7.5 dpp, this defect had resolved, such that no deficiencies were apparent in nursing and pups showed no signs of malnutrition. During glandular involution, a delay in remodeling again became apparent, such that ductolobular regression was achieved with somewhat slower kinetics in Bin1
mam mice. We concluded that Bin1 was nonessential for formation of a fully functional lactating mammary gland but that it was needed to optimally support the rapid kinetics of ductolobular remodeling in the gland during pregnancy and weaning.
|
To evaluate Bin1 as a suppressor gene, we compared the effect of tissue-specific ablation in three cohorts of Bin1+mam and Bin1
mam female mice carried out as nonparous animals (virgin), uniparous animals (one round of pregnancy), or multiparous animals (seven rounds of pregnancy). After birth, litters were normalized to five pups, nursed 10 days, and then removed. By 2 years of age, both strains of mice developed mammary gland tumors with the same low frequency (Table 1
). No differences were seen between uniparous and multiparous groups, which were combined as parous. Although the tumors that arose in the cohort of Bin1
mam mice were relatively more poorly differentiated, the similarly low incidence observed argued against the notion that Bin1 functioned as a classic breast tumor suppressor gene.
|
mam female mice were treated with DMBA and monitored for tumor formation. Both cohorts displayed similar rates of tumor latency, multiplicity, and lung metastasis (Table 1). However, whereas Bin1+mam mice developed well-differentiated tumors, characterized by high tubule formation, low mitotic indices, and limited nuclear pleomorphism, Bin1
mam mice developed poorly differentiated tumors, characterized by low tubule formation, high mitotic indices, and high degrees of nuclear pleomorphism (Table 1). Nuclear pleomorphism was particularly increased by Bin1 loss (Fig. 3
). Additionally, Bin1
mam mice displayed a relative increase in lymphocyte infiltration compared with Bin1+mam mice (57% versus 20% of tumors; A.P.S., data not shown). In parallel experiments done in a mosaic model, we saw a similar pattern of development of more poorly differentiated mammary tumors in Bin1
mam mosaic mice.4 Together, these observations suggested that Bin1 functioned as a negative modifier to restrict the progression of tumors initiated by activation of the ras pathway.
|
mam cohort was that it displayed a coincident elevation in uterine endometritis and ovarian granulosa cell tumors, implying either haploinsufficiency or a noncell autonomous effect of Bin1 loss in the uterus and ovary. DMBA treatment is known to cause such lesions in addition to mammary tumors (e.g., ref. 25) but not at the relatively higher penetrance observed in mice from the Bin1
mam cohort. The transcriptional activity of the wap promoter is restricted to brain and the mammary gland during the lactational stage of pregnancy (26), and consistent with this pattern of expression, we did not detect recombination of the Bin1 floxed allele in the ovary or uterus of Bin1
mam mice.4 Nevertheless, there was an increased incidence of DMBA-induced ovarian granulosa cell tumors in Bin1
mam mice (43%) relative to Bin1+mam mice (13%), all of whom also had mammary tumors at diagnosis (Supplementary Figure S1; Supplementary Table S1). In the uterus, a similar incidence of cystic hyperplasia was observed but only the Bin1
mam cohort displayed endometritis (Supplementary Figure S2; Supplementary Table S1). These observations corroborated the concept of Bin1 as a negative modifier of lesions produced by DMBA treatment, due to either haploinsufficiency or a noncell autonomous mechanism of action in the ovary and uterus.
In contrast to the above observations, we found that Bin1 deletion had little effect when tumor formation was initiated by a c-myc transgene. In female MMTV-c-myc mice carried out under multiparous conditions to activate transgene expression, mammary adenocarcinomas develop at a frequency approaching 100% with a latency of 7 to 10 months (27). In multiparous c-Myc;Bin1+mam and c-Myc;Bin1
mam females, we observed the development of similar moderate to poorly differentiated mammary adenocarcinomas, with similar latencies, high tumor grades, and robust metastatic propensities (Supplementary Table S2). These tumors were characterized by large round cells with histologic evidence of an abundance of infiltrating macrophages and apoptotic cells (data not shown). When these mice were treated with DMBA, we observed the development of similar poorly differentiated mammary carcinomas. However, c-Myc;Bin1
mam mice also developed aggressive lymphomas that appeared in some animals before mammary carcinomas had formed (Supplementary Table S2). As above, this observation suggested either haploinsufficiency or a cell nonautonomous modifier effect on DMBA-induced tumors (28) in cooperation with MMTV-c-myc (the expression of which is leaky in lymphoid cells). Taken together, these findings argue that the effects of Bin1 loss were selective insofar as cooperation was only observed in the absence of c-Myc overexpression (which on its own was sufficient to drive formation of poorly differentiated high-grade mammary carcinomas). We concluded that Bin1 loss cooperated specifically with DMBA-induced ras activation to drive breast tumor progression.
Aggressive characteristics of mouse mammary tumor cells lacking Bin1. To gain insight into how Bin1 loss facilitates tumor progression, we compared the behavior of MMECs established from several DMBA-induced tumors excised from Bin1
mam and Bin1+mam mice. Bin1
mam cell lines grew to higher densities and displayed a spindle morphology consistent with the more aggressive features displayed by the tumors from which they were derived (Fig. 4A
). The status of Bin1 in cell lines was confirmed by PCR and Western blot analysis and the analysis of a representative pair is presented below (Fig. 4B; data not shown). Western blot analyses confirmed the expression of E-cadherin and ß-catenin, but not of vimentin, which is expressed strongly in mammary myoepithelial cells and fibroblasts (Fig. 4C). Immunohistochemical staining of primary tumors confirmed common expression of E-cadherin and ß-catenin (data not shown), consistent with the likelihood that the established tumor cell populations are indeed epithelial in character. N-cadherin was also expressed in these cell lines; however, because there was no correlation to Bin1 status, this mesenchymal marker was interpreted as a general feature of DMBA-induced breast carcinogenesis in the mouse (Fig. 4C). Bin1
mam cells displayed a 34 times higher rate of in vitro proliferation under anchorage-dependent conditions (Fig. 4D). Under conditions of anchorage-independent growth in soft agar culture, only Bin1
mam cells displayed detectable colony formation activity in parallel with their more aggressive growth character (data not shown). Bin1
mam cells also exhibited severalfold greater resistance to apoptosis elicited by serum deprival (Fig. 4E), extending evidence of a proapoptotic role for Bin1 in neoplastic cells (1416, 18, 19). Lastly, Bin1
mam cells displayed an increased motility in monolayer culture associated with increased gelatinase activity attributable to activated matrix metalloproteinase (MMP-9; Fig. 4F and G). Taken together, these results strengthened the evidence that Bin1 acts in the guise of a negative modifier in cancer.
|
mam and Bin1+mam MMECs to form orthotopic tumors in syngeneic immunocompetent mice and immunocompromised nude mice, based on an earlier demonstration that Bin1 loss could promote immune escape of myc+ras-transformed keratinocytes (20). Unfortunately, none of the MMEC populations established from DMBA-induced mammary tumors could form tumors in syngeneic FVB/N x BL/6 F1 female mice, preventing us from exploring this issue further. In contrast, after orthotopic injection of 107 cells into the fat pads of immunocompromised female nude mice, Bin1
mam cells formed tumors efficiently, whereas Bin1+mam cells formed mainly indolent nodules up to 5 months after seeding (Fig. 4H). The more profound in vivo growth differences observed could not be fully explained by the in vitro differences documented, suggesting that Bin1 loss may provide an additional undefined benefit in vivo. Nude mice retain natural killer (NK) cell and some B-cell immune functions, but we observed a similar pattern of tumor growth in severe combined immunodeficient (SCID) and SCID/beige murine hosts, which completely lack T/B and T/B/NK cell functions, respectively (data not shown). In summary, we concluded that Bin1 acts to limit the progression of DMBA mammary tumors at several intrinsic levels, including by negatively modifying the proliferation, survival, and motility of tumor cells. | Discussion |
|---|
|
|
|---|
We observed no long-term effects of Bin1 deletion on cancer incidence in virgin or parous animals, indicating that this gene does not function as a classic tumor suppressor in the mammary gland. In contrast, when mammary tumors were initiated by DMBA in Bin1-deficient mice, we found that high-grade carcinomas emerged that exhibited increased proliferation, survival, and motility relative to tumors induced in control mice expressing Bin1. Interestingly, we noted a coincident increase of ovarian tumors or lymphomas in Bin1
mam mice, which reflected either haploinsufficiency or a noncell autonomous mechanism of action in these settings. Although the underlying mechanisms of these effects were undefined, they provided further corroboration of the concept of Bin1 as a negative modifier in breast cancer.
In previous work in transformed mouse keratinocyte and fibroblast models, we observed that Bin1 loss strongly affected the capacity for immune escape with less effect on proliferation and survival (19, 20). In particular, in the transformed keratinocyte model, we had identified a role for indoleamine 2,3-dioxygenase (IDO) in mediating immune escape (20). Unfortunately, we could not evaluate effects of Bin1 loss on IDO-mediated immune escape in the DMBA mammary carcinogenesis model because none of the tumor MMEC populations had the ability to form grafts in immunocompetent hosts. In any case, other evidence suggests that in breast cancer, the mechanism of immune escape based on IDO elevation may be more relevant in the peripheral immune cells in tumor-draining lymph nodes than in the tumor cells themselves (31), the latter of which do not tend to overexpress IDO like other solid tumors (32). Therefore, breast models may not be especially pathophysiologically germane to evaluate how Bin1 attenuation in tumor cells affects immune escape. In assessing cell-intrinsic qualities, differences in the effects of Bin1 on proliferation and survival in the keratinocyte and fibroblast models may reflect their in vitro generation, where strong selections for survival and proliferation are imposed (perhaps defeating the benefits of losing a negative modifier). In contrast, the findings from the in vivogenerated breast model reported here corroborate the findings of a large number of reports showing the ability of Bin1 to limit cell proliferation and survival (3, 4, 1419, 33, 34). In this study, we also observed increased motility and elevated MMP-9 activity in MMEC tumor cell populations lacking Bin1, a finding that we have since corroborated in the transformed keratinocyte and fibroblast models characterized previously.7 Further assessment of the mechanism of MMP-9 dysregulation as well as the effects of Bin1 loss on proliferation and survival is currently being conducted in a mosaic model where direct in vivo evaluations in other tissues are possible.
It is apparent that the effects of Bin1 loss in the mammary gland were selective because of the specific cooperation of Bin1 loss in driving progression with ras activated by DMBA but not c-myc overexpressed from the MMTV promoter. These data imply that the functional effects of Bin1 loss and myc overexpression must overlap to some extent because of the ability of either Bin1 loss or myc activation to cooperate with ras activation to drive breast tumor progression (present study; ref. 35). Bin1 loss obviously does not fully phenocopy myc activation. Thus, along with evidence that nuclear Bin1 proteins functionally interact with c-Myc protein (35), a logical inference is that Bin1 acts to limit a subset of myc functions that are selectively important to progression in cooperation with ras. In this context, it is interesting to note that although maintaining the expression of myc throughout the cell cycle is sufficient to prevent cell cycle exit and to drive tumorigenesis, many human cancers not only deregulate myc but overexpress it (36). Following the implication that myc overexpression may benefit tumor progression, our data support a model where Bin1 loss partly or fully phenocopies such benefits in cooperation with ras activation (Fig. 5 ).
|
One clinical implication of our findings is that losses of nuclear Bin1 may predict poor prognosis of breast cancers when c-Myc is not overexpressed but Ras signaling is deregulated, for example, due to deregulation of an upstream growth factor receptor. Although some fraction of breast carcinomas overexpress c-Myc, signaling poor prognosis (4044), and immunohistochemical losses of Bin1 that seem to occur more frequently (16, 45) may be useful in the larger number of cases where c-Myc is not overexpressed. The findings of this study prompt an examination of Bin1 in retrospective or prospective studies where its potential usefulness as a progression marker can be further evaluated (46).
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Gwen Guillard, and Wei Weng for their contributions.
| Footnotes |
|---|
Current address for A.P. Soler: Richfield Laboratory of Dermatopathology, Cincinnati, Ohio.
4 M.Y. Chang, unpublished observation. ![]()
5 http://www.chemicon.com/techsupp/protocol/gelatinzymograph.asp. ![]()
6 M.Y. Chang and G.C. Prendergast, in preparation. ![]()
7 J.B. Duhadaway, unpublished observation. ![]()
Received 7/25/06. Revised 9/12/06. Accepted 10/23/06.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
E. Kennah, A. Ringrose, L. L. Zhou, S. Esmailzadeh, H. Qian, M.-w. Su, Y. Zhou, and X. Jiang Identification of tyrosine kinase, HCK, and tumor suppressor, BIN1, as potential mediators of AHI-1 oncogene in primary and transformed CTCL cells Blood, May 7, 2009; 113(19): 4646 - 4655. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ramalingam, J. B. Duhadaway, E. Sutanto-Ward, Y. Wang, J. Dinchuk, M. Huang, P. S. Donover, J. Boulden, L. M. McNally, A. P. Soler, et al. Bin3 Deletion Causes Cataracts and Increased Susceptibility to Lymphoma during Aging Cancer Res., March 15, 2008; 68(6): 1683 - 1690. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Y. Chang, J. Boulden, J. B. Katz, L. Wang, T. J. Meyer, A. P. Soler, A. J. Muller, and G. C. Prendergast Bin1 Ablation Increases Susceptibility to Cancer during Aging, Particularly Lung Cancer Cancer Res., August 15, 2007; 67(16): 7605 - 7612. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |