
Cancer Research 67, 289, January 1, 2007. doi: 10.1158/0008-5472.CAN-05-4623
© 2007 American Association for Cancer Research
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
Nitric Oxide in Physiologic Concentrations Targets the Translational Machinery to Increase the Proliferation of Human Breast Cancer Cells: Involvement of Mammalian Target of Rapamycin/eIF4E Pathway
Shehla Pervin1,
Rajan Singh2,
Estebes Hernandez1,
Guoyao Wu4 and
Gautam Chaudhuri1,3
1 Departments of Obstetrics and Gynecology and Molecular and Medical Pharmacology, David Geffen School of Medicine at University of California at Los Angeles; 2 Division of Endocrinology and RCMI Molecular Medicine Core Laboratory at Charles R. Drew University of Science and Medicine; 3 Jonsson Comprehensive Cancer Center, Los Angeles, California; and 4 Department of Animal Sciences, Texas A&M University, College Station, Texas
Requests for reprints: Gautam Chaudhuri, Department of Obstetrics and Gynecology, David Geffen School of Medicine at University of California at Los Angeles, 27-117 CHS, 10833 Le Conte Avenue, Los Angeles, CA. Phone: 310-206-6575; Fax: 310-206-2057; E-mail: gchaudhuri{at}mednet.ucla.edu.
 |
Abstract
|
|---|
Nitric oxide (NO) in nanomolar (nmol/L) concentrations is consistently detected in tumor microenvironment and has been found to promote tumorigenesis. The mechanism by which NO enhances tumor progression is largely unknown. In this study, we investigated the possible mechanisms and identified cellular targets by which NO increases proliferation of human breast cancer cell lines MDA-MB-231 and MCF-7. DETA-NONOate, a long acting NO donor, with a half-life of 20 h, was used. We found that NO (nmol/L) dramatically increased total protein synthesis in MDA-MB-231 and MCF-7 and also increased cell proliferation. NO specifically increased the translation of cyclin D1 and ornithine decarboxylase (ODC) without altering their mRNA levels or half-lives. Critical components in the translational machinery, such as phosphorylated mammalian target of rapamycin (mTOR) and its downstream targets, phosphorylated eukaryotic translation initiation factor and p70 S6 kinase, were up-regulated following NO treatment, and inhibition of mTOR with rapamycin attenuated NO induced increase of cyclin D1 and ODC. Activation of translational machinery was mediated by NO-induced up-regulation of the Raf/mitogen-activated protein/extracellular signal-regulated kinase (ERK) kinase/ERK (Raf/MEK/ERK) and phosphatidylinositol 3-kinase (PI-3 kinase)/Akt signaling pathways. Up-regulation of the Raf/MEK/ERK and PI-3 kinase/Akt pathways by NO was found to be mediated by activation of Ras, which was cyclic guanosine 3',5'-monophosphate independent. Furthermore, inactivation of Ras by farnesyl transferase inhibitor or K-Ras small interfering RNA attenuated NO-induced increase in proliferation signaling and cyclin D1 and ODC translation, further confirming the involvement of Ras activation during NO-induced cell proliferation. [Cancer Res 2007;67(1):28999]
 |
Introduction
|
|---|
Nitric oxide (NO), a potent bioactive molecule, acts as a diffusible messenger in intercellular communication and intracellular signaling (13). NO interacts with different molecular targets from superoxide anion to protein macromolecules, which can be activated or inhibited through oxidation of thiols, hemes, Fe-S clusters, or other non-heme iron prosthetic groups of macromolecules (4, 5). The apparent outcome of NO signaling is dependent on the level of NO production, which is dictated by the isoforms of NO synthase (NOS)/endothelial (eNOS), neuronal (nNOS), or inducible (iNOS) NO synthases (6). Physiologic, low (nanomolar, nmol/L) concentrations of NO have been shown to increase tumorigenesis (79), whereas pathophysiologic high (micromolar, µmol/L) concentrations of NO, as produced by activated macrophages, induce tumoricidal effects (10). We have found that micromolar concentrations of NO, partially dependent on mitogen-activated protein kinase (MAPK) phosphatase-1 (MKP-1) induction, can either induce prolonged cytostasis or cytostasis followed by apoptosis in a number of human breast cancer cell lines. We have previously reported that micromolar concentrations of NO up-regulates MKP-1 and induces apoptosis in breast cancer cell line MDA-MB-468 by mitochondria-regulated pathway (11). In another study using the MDA-MB-231 cell line, we observed that NO (micromolar concentrations) was unable to up-regulate MKP-1, and apoptosis was not induced; however, cells underwent prolonged cytostasis by down-regulating cyclin D1 protein and hypophosphorylation of retinoblastoma protein (11, 12).
Recent studies have implicated low physiologic concentrations of NO (nmol/L) in regulating different processes of tumorigenesis. Clinical and experimental studies support a positive relationship between tumor malignancy and NOS activity in certain tumors (1315). Solid tumors have been found to produce sustained levels of NO, which is produced by tumor cells themselves or macrophages that infiltrate these tumors (16). NO production is stimulated by vascular endothelial growth factor (VEGF), a strong angiogenic factor that is up-regulated in tumor tissues (17). Cytokines and chemokines in tumor microenvironment may provide appropriate signals for recruitment and activation of macrophages that are capable of NO production (18). Although NO is an important component of tumor microenvironment, its role in tumor biology remains to be elucidated. Detailed investigation is required to understand cellular targets of NO, which could facilitate elucidation of signaling pathways involved in tumor growth, invasion, and metastasis. Extracellular signal-regulated kinases (ERK1/2), which play a vital role in VEGF induced endothelial cell proliferation, is the most well studied downstream target of NO (19). The purpose of this study was to determine the key signaling cascades targeted by physiologic (nanomolar) concentrations of NO in malignant breast cancer cell lines, including MDA-MB-231 and MCF-7, which could give us an insight into the possible mechanisms by which NO increases proliferation of tumor cells.
In this study, we have used human breast cancer cell lines MDA-MB-231, MCF-7, and MDA-MB-468 to study the mechanism by which DETA-NONOate, an NO donor, increases cell proliferation at physiologic concentrations. These human breast cancer cell lines with undetectable to low endogenous NOS levels (20) were exposed to various concentrations of DETA-NONOate, a long acting NO donor with a half-life of 20 h. We found that nanomolar concentrations of NO released by 30 to 60 µmol/L DETA-NONOate significantly increased proliferation in all these breast cancer cells. Due to comparable % increase in proliferation with NO treatment, we used MDA-MB-231 and MCF-7 to study the mechanism for increased proliferation. Nanomolar NO treatment increased the rate of synthesis of some proliferation-related proteins like cyclin D1 and ornithine decarboxylase (ODC) without altering the mRNA levels or half-lives. Nanomolar concentrations of NO, as released by 30 to 60 µmol/L DETA-NONOate, increased phosphatidylinositol 3-kinase (PI-3 kinase)/Akt signaling to activate mammalian target of rapamycin (mTOR) and its downstream effectors p70 S6 kinase (p70s6k) and eukaryotic translation initiation factor (eIF-4E), which are critical components in the translational machinery. Pharmacologic inhibition of PI-3 kinase/Akt or Raf/MAP/ERK kinase (MEK)/ERK1/2 signaling reduced the levels of phosphorylated eIF4E (peIF4E) and cyclin D1. NO-induced up-regulation of PI-3 kinase/Akt and Raf/MEK/ERK signaling was found to be mediated by Ras as inactivation of Ras by farnesyl transferase inhibitor (FTase inhibitor 111) or K-Ras si RNA attenuated the effect of NO on these signaling cascades. The effects of NO on cell proliferation were not attenuated in the presence of 1H-[1,2,3]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ), a guanylate cyclase inhibitor. Our studies therefore suggest that NO induced proliferation in these breast cancer cells was due to cyclic guanosine 3',5'-monophosphate (cGMP)independent up-regulation of PI-3 kinase/Akt and Raf/MEK/ERK1/2 signaling cascades.
 |
Materials and Methods
|
|---|
Materials. DETA-NONOate, ODQ, and 2-(4-carboxyphenyl)-4,4,5,5-tetramethyl-1-oxyl-3-oxide (cPTIO) were purchased from Cayman Biochemicals (Ann Arbor, MI). Actinomycin D, cycloheximide, rapamycin, 8-bromo-cGMP, leupeptin, aprotinin, phenylmethylsulfonyl fluoride (PMSF), and protein A-Sepharose beads were purchased from Sigma (St. Louis, MO); PD 98059, LY294002, and farnesyl transferase inhibitor (FTI) were from Calbiochem (San Diego, CA). All of the cell culture media were purchased from Life Technologies, Inc. (Gaithersburg, MD). Rabbit polyclonal antiphosphorylated Akt (anti-pAkt; 559029) was from PharMingen, BD Biosciences (San Diego, CA). ERK1/2 MAPK (9102) was from New England Biolabs (Beverly, MA). PI-3 kinase, ODC, cyclin D1, Akt, ERK1/2 were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Phosphorylated mTOR, peIF4E, phosphorylated p70s6k (pp70s6k), pAkt, phosphorylated ERK1/2 (pERK1/2), phosphorylated Raf (pRaf), and MBP kit were from Cell Signaling Technology (Beverly, MA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was purchased from Chemicon (Temecula, CA). Tran35S-label and [35S]cysteine were from MP Biomedicals (Solon, OH). [
-32P]dCTP and [
-32P]ATP were from Amersham Pharmacia (Piscataway, NJ).
Cell culture. Human breast cancer cell lines MDA-MB-231, MCF-7, and MDA-MB-468 were obtained from the American Type Culture Collection (Manassas, VA). MDA-MB-231, MCF-7 cells, and MDA-MB-468 were cultured in DMEM containing 10 mmol/L nonessential amino acids, 2 mmol/L L-glutamine, 1 µg/mL insulin, and 10% fetal bovine serum (FBS). For experimental purpose, cells were grown in 5% FBS, allowed to seed overnight, and treated with drugs for various time periods.
Measurement of rate of NO release by DETA-NONOate. The rate of NO released from 10 to 0 µmol/L DETA-NONOate in DMEM was assessed over time using Sievers chemiluminescent NO analyzer (21).
Measurement of total protein synthesis. Cells (2 x 106) were plated overnight in media containing DMEM and 5% FBS. The cells were kept starved for 3 h in methionine/cysteinefree media (Life Technologies), after which they were labeled for further 3 h with 100 µCi/mL of a mixture of [35S]methionine and [35S]cysteine. After removal of the radioactive media, the cells were collected, washed twice with PBS, and lysed on ice for 30 min in 1 mL of lysis buffer [10 mmol/L Tris/HCl buffer (pH 7.4), 150 mmol/L NaCl, 1 mmol/L EDTA (pH 8), 0.1% (v/v) Triton X-100] containing 0.2 mmol/L PMSF, 1 µmol/L pepstatin A, and 1 µmol/L leupeptin. Cell lysates were clarified by centrifugation at 2,200 x g for 5 min, and the protein concentrations of the supernatant were determined using Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, Inc., Hercules, CA). Equal amounts of lysates were spotted on Whatman No. 3MM and washed with TCA, and incorporation of labeled [35S]methionine/[35S]cysteine in protein was measured in a scintillation counter.
Cell viability. Cells seeded in six-well plate (7.5 x 105 per well) were allowed to grow overnight. The cells treated with various concentrations of DETA-NONOate for 24 h were collected, and viability was determined by trypan blue exclusion method. The number of viable cells at each concentration and time point was determined in triplicate with a hemacytometer.
Western analysis. Cells were lysed in cell lysis buffer containing 50 mmol/L HEPES (pH 7.5), 1 mmol/L DTT, 150 mmol/L NaCl, 1 mmol/L EDTA, 0.1% Tween 20, 10% glycerol, 10 mmol/L ß-glycerophosphate, 1 mmol/L NaF, 0.1 mmol/L orthovanadate, 10 µg/mL leupeptin, 10 µg/mL aprotinin, and 0.1 mmol/L PMSF. Western blot was done as previously described (11).
Determination of ODC activity. MDA-MB-231 cells (5 x 106 per plate) were treated with DETA-NONOate (060 µmol/L) for 24 h, washed twice with homogenization buffer [0.1 mmol/L pyridoxal-5-phosphate, 0.1 mmol/L EDTA, 2.5 mmol/L DTT, and 50 mmol/L sodium phosphate pH (7.2)], followed by homogenization in 1 mL of homogenization buffer and centrifugation at 13,000 x g for 15 min at 4°C. The supernatant, free from mitochondria, was used for ODC assay (22).
Immunoprecipitation of labeled cyclin D1 and ODC. [35S]methionine- and [35S]cysteine-labeled cyclin D1 was immunoprecipitated from the total cell lysates, which was prepared for measuring total protein synthesis. Radiolabeled total cell lysate (500 µg) was incubated overnight with 1 µg of monoclonal anti-cyclin D1 and anti-ODC antibodies in modified radioimmunoprecipitation assay buffer (50 mmol/L Tris-HCl, 150 mmol/L NaCl, 1% NP40, and 0.5% sodium deoxycholate). The immune complex was precipitated with 30 µL of Protein A-agarose (Santa Cruz Biotechnology), washed four times with lysis buffer, and analyzed by 10% SDS-PAGE.
Northern analysis. Cells were treated with DETA-NONOate for various time points, and total cellular RNA was extracted using RNeasy (Qiagen, Chatsworth, CA) according to the manufacturer's instruction. Equal amounts (15 µg per lane) of RNA were resolved by electrophoresis on a 1.2% formaldehyde-agarose gel, blotted onto nylon membrane, and probed using standard protocol (12).
Immunoprecipitation and kinase assay. Cells were lysed in lysis buffer containing 50 mmol/L Tris/HCl (pH 8), 300 mmol/L NaCl, 10 mmol/L MgCl2, 0.5% Igepal Ca-630 (Sigma), 1 mmol/L EDTA, and antiprotease cocktail (Roche, Indianapolis, IN); 500 µg of supernatant were precleared by incubation (4 h at 4°C) once with Protein A/G-agarose (Santa Cruz Biotechnology) and once with Protein A/G-agarose preincubated with preimmune serum. The precleared lysate was adjusted to 150 mmol/L NaCl and 0.25% Igepal Ca-630 and subjected to overnight immunoprecipitation on a rotating wheel at 4°C using rabbit antiserum or anti-Akt antibody. The mixtures were incubated further for 4 h at 4°C with 50 µL of Protein A/G-agarose. After five washes in 50 mmol/L Tris/HCl (pH 8), 0.25% Igepal Ca-630, 1 mmol/L EDTA, and 150 mmol/L NaCl, the immunoprecipitates were analyzed by kinase assay using myelin basic protein as the substrate.
Inhibition of K-Ras by small interfering RNA. Synthetic small interfering RNA (siRNA) targeting activated K-Ras (GGAGCUGUUGGCGUAGGCAA) present in MDA-MB-231 cells, and random oligo VIII as a control for nonspecific siRNA effects were purchased from Dharmacon Research (Lafayette, CO) as described (23). Amaxa nucleofecter was used for the transfection (
85% efficiency) for 24 h, after which the cells were treated with and without DETA-NONOate for another 24 h, and cell proliferation was measured.
cGMP assay. cGMP was measured using Enzyme Immunoassay kit from Assay Designs, Inc. (Ann Arbor, MI).
Statistics. Data are presented as mean ± SE. Differences between the groups were analyzed by ANOVA. If overall ANOVA revealed significant differences, then pairwise comparisons between groups were done using Student's t test. Ps < 0.05 were considered statistically significant. The experiments were repeated three to five times, and data from representative experiments are shown.
 |
Results
|
|---|
Nanomolar NO increased proliferation of breast cancer cells. In this study, we used lower, physiologic concentrations of NO (nanomolar; DETA-NONOate at 1060 µmol/L) to elucidate the cellular targets and the possible mechanisms by which it promotes tumor growth. We have determined that 10, 30, and 60 µmol/L DETA-NONOate releases 2, 33, and 52 nmol/L NO in the culture media as described in Materials and Methods. We initially assessed the effect of different concentrations of NO on cell proliferation in human breast cancer cell lines MDA-MB-231, MCF7, and MDA-MB-468 (data not shown). A significant increase in viable cells after exposure to 30 µmol/L (26 ± 2% for MDA-MB-231, P < 0.05 and 27 ± 2% for MCF7, P < 0.05) and 60 µmol/L (53 ± 3% for MDA-MB-231, P < 0.01 and 63 ± 4% for MCF7, P < 0.01) of DETA-NONOate was observed compared with control cells (Fig. 1A
). Because the NO-induced % increase in cell proliferation of MDA-MB-231, MCF-7, and MDA-MB-468 was very comparable, we have used MDA-MB-231 and MCF-7 for further experiments. To assess whether the increased proliferation was due to NO released from DETA-NONOate, MDA-MB-231 and MCF-7 cells were coincubated with DETA-NONOate and cPTIO (50 µmol/L), a well-known NO quencher (24). Coincubation with cPTIO attenuated NO-induced increase in proliferation of these cells (Fig. 1A), suggesting that the increase with DETA-NONOate (3060 µmol/L) was due to the NO released from the chemical compound. To examine whether nanomolar NO affected the rate of total protein synthesis in MDA-MB-231 and MCF-7 cell lines, DETA-NONOatetreated cells were pulse labeled with [35S]methionine/[35S]cysteine for 6 h. Equal amounts of lysates were spotted on Whatman No. 3MM and washed with TCA, and incorporation of labeled [35S]methionine/[35S]cysteine in protein was measured in a scintillation counter. We observed a significant increase in [35S]methionine/[35S]cysteinelabeled proteins in cells exposed to 30 µmol/L (57 ± 3% for MDA-MB-231, P < 0.05 and 46 ± 16% for MCF7, P < 0.05) and 60 µmol/L (118 ± 6 for MDA-MB-231, P < 0.01 and 146 ± 8 for MCF7, P < 0.01) of DETA-NONOate, compared with the control cells (Fig. 1B).

View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 1. A, nanomolar NO increases proliferation of MDA-MB-231 and MCF-7 cells, which is attenuated in the presence of cPTIO. Cells after treatment with DETA-NONOate (1060 µmol/L) for 24 h were subjected to cell count by trypan blue exclusion method. DETA-NONOate (1060 µmol/L) increases cell proliferation up to 55% to 65% compared with control cells. Cells treated simultaneously with DETA-NONOate (1060 µmol/L) and cPTIO (50 µmol/L) for 24 h were subjected to cell counting by trypan blue exclusion method. Columns, mean of four experiments; bars, SE. *, P 0.05; **, P 0.01, compared with control, 0 µmol/L DETA-NONOate. B, nanomolar NO increases protein synthesis in MDA-MB-231 and MCF-7 cells. Cells (1 x 106) treated with DETA-NONOate (1060 µmol/L) for 24 h were exposed to 100 µCi/mL [35S]methionine/[35S]cysteine for further 6 h, and total labeled cytosolic proteins were quantified using a scintillation counter. DETA-NONOate (1060 µmol/L) increased the total protein synthesis in these cells. Columns, mean of four experiments; bars, SE. *, P 0.05; **, P 0.01, compared with control, 0 µmol/L DETA-NONOate. C, nanomolar NO increases cyclin D1 and ODC protein levels in MDA-MB-231 cells. Cells after treatment with DETA-NONOate (1060 µmol/L) for 24 h were subjected to Western blot analysis for cyclin D1 and ODC. Values from densitometric scan and appropriate statistical analyses are discussed in Results. D, nanomolar NO increases cyclin D1 and ODC protein levels in MCF-7 cells. Cells after treatment with DETA-NONOate (1060 µmol/L) for 24 h were subjected to Western blot analysis for cyclin D1 and ODC. Values from densitometric scan and appropriate statistical analyses are discussed in Results. E, NO increases ODC activity in MDA-MB 231 cells. Cells after treatments with DETA-NONOate (1060 µmol/L) for 24 h were assayed for ODC activity as described in Materials and Methods. Columns, mean of three independent experiments; bars, SE. *, P 0.05.
|
|
To investigate the mechanism by which nanomolar NO increased proliferation of MDA-MB-231 and MCF-7 cells, we examined some of the cell cycle proteins involved in G1-S progression. ODC, which is strongly implicated in G1 progression, was also assessed in nanomolar NOtreated MDA-MB-231 and MCF-7 cells. We observed that nanomolar NO treatment increased the levels of cyclin D1 and ODC in MDA-MB-231 (Fig. 1C) and MCF-7 cells (Fig. 1D). Densitometric scans showed a significant increase in cyclin D1 protein in MDA-MB-231 (1.6 ± 0.3-fold at 30 µmol/L, P < 0.05 and 2.2 ± 0.3-fold at 60 µmol/L, P < 0.05) and in MCF7 (1.5 ± 0.4-fold at 30 µmol/L, P < 0.05 and 2.6 ± 0.3-fold at 60 µmol/L, P < 0.05) after exposure to DETA-NONOate (Fig. 1C and D). We also found a significant increase in ODC protein in MDA-MB-231 (1.7 ± 0.3-fold at 30 µmol/L, P < 0.05 and 1.9 ± 0.2-fold at 60 µmol/L, P < 0.05) and in MCF7 (1.6 ± 0.3-fold at 30 µmol/L, P < 0.05 and 2.1 ± 0.3-fold at 60 µmol/L, P < 0.05) after DETA-NONOate exposure (Fig. 1C and D). We further assessed the enzymatic activity of ODC in MDA-MB-231 cell lysates after treatment with DETA-NONOate (060 µmol/L) for 24 h. We observed a significant increase in enzymatic activity of ODC following treatment of these cells with DETA-NONOate (0.98 ± 0.06 nmol/mg protein at 10 µmol/L, P < 0.05; 1.1 ± 0.05 nmol/mg protein at 30 µmol/L, P < 0.05; and 0.99 ± 0.08 nmol/mg protein at 60 µmol/L, P < 0.05) compared with control (0.76 ± 0.04 nmol/mg protein; Fig. 1E).
Nanomolar NO increased the rate of synthesis of cyclin D1 and ODC. To determine whether increased levels of cyclin D1 and ODC proteins were due to up-regulation of their transcription, Northern blot analysis was done. Nanomolar NO treatment of MDA-MB-231 cells did not alter the mRNA levels of cyclin D1 or ODC when compared with control cells (Fig. 2A
). In addition, blocking cellular transcription with actinomycin D (1 µg/mL) did not attenuate NO-induced increase in cyclin D1 (Fig. 2B) and ODC (data not shown) proteins, suggesting the involvement of posttranscriptional mechanisms in the process.

View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 2. A, NO does not change the mRNA levels of cyclin D1 and ODC in MDA-MB-231 cells. Cells after treatments with DETA-NONOate (1060 µmol/L) for 24 h were subjected to RNA extraction, and Northern blot analysis was done using cyclin D1, ODC, and GAPDH probes. The experiment was repeated thrice. Representative data. B, actinomycin D does not abrogate nanomolar NOinduced increase in cyclin D1 levels. Cells (MDA-MB-231) after various treatments for 24 h (lane 1, control; lane 2, 60 µmol/L DETA-NONOate; lane 3, 1 µg/mL actinomycin D; lane 4, actinomycin D + 60 µmol/L DETA-NONOate) were prepared for Western blot analysis for cyclin D1. Three independent experiments were done. Representative data. C, nanomolar NO increases the rate of synthesis of cyclin D1 and ODC in MDA-MB-231 cells. Cells treated with DETA-NONOate for 24 h was labeled with [35S]methionine for 6 h, and cyclin D1 and ODC were immunoprecipitated with cyclin D1 and ODC antibodies. Immunoprecipitates were analyzed by SDS-PAGE and autoradiography. Representative of three independent experiments. ADU, arbitrary densitometric unit. *, P 0.01; **, P 0.001, compared with control, 0 µmol/L DETA-NONOate. D, nanomolar NO does not alter the half-life of cyclin D1. Cells treated with DETA-NONOate (60 µmol/L) for 24 h were further exposed to cycloheximide for 2, 4, and 6 h and Western blotted for cyclin D1. Representative of three independent experiments.
|
|
Changes in steady-state protein levels can be accomplished by alterations in either the rate of synthesis or by change in protein half-life. To determine the effect of NO on the rate of synthesis of cyclin D1 and ODC, the MDA-MB-231 cells after various treatments were starved in methionine/cysteinefree growth media and further pulse labeled for 3 h with [35S]methionine/[35S]cysteine. Total cyclin D1 or ODC was immunoprecipitated from the labeled cell lysates using anti-cyclin D1 or anti-ODC antibodies and analyzed by SDS-PAGE and autoradiography. Cells exposed to nanomolar NO had increased labeled cyclin D1 (3.1 ± 0.3-fold, P < 0.001) and ODC (3.6 ± 0.4-fold, P < 0.001) proteins at 60 µmol/L DETA-NONOate compared with control cells, suggesting an increased rate of translation of their mRNAs (Fig. 2C). To ascertain the potential mechanisms by which nanomolar NO increased translation of cell cycle proteins, we decided to focus on cyclin D1 as the downstream target of NO for further experiments. To assess whether NO affected protein stability of cyclin D1, we analyzed cyclin D1 turnover before and after NO treatment by Western analysis. Protein degradation was monitored by blocking the de novo protein synthesis in the cells with cycloheximide (100 µg/mL). The half-life of cyclin D1 (
30 min with or without NO) was unaltered under these conditions, whereas overall cyclin D1 protein levels were significantly increased with NO treatment (Fig. 2D). These results indicate that nanomolar NO did not affect the stability of cyclin D but increased its rate of synthesis.
Nanomolar NO up-regulates PI-3 kinase/pAkt activation in MDA-MB-231 cells. Increased rate of synthesis of cyclin D1 and ODC could reflect a direct effect of nanomolar NO on the translational machinery or result from activation of signaling pathways, such as those initiated by tyrosine kinase activation. The PI-3 kinase/Akt pathway plays an important role in human cancer and has been found to modulate the activity of key translation factors in the translational machinery (25). To analyze whether nanomolar NOinduced increase in rate of synthesis of cyclin D1 and ODC was through the PI-3 kinase/Akt pathway, we examined the levels of total and pAkt by immunoblot analysis using total and phospho-specific antibodies that detected phospho- groups on both Ser473 and Thr308 in Akt. Treatment of MDA-MB-231 cells with 60 µmol/L DETA-NONOate increased the levels of pAkt by 1.8 ± 0.2-fold (P < 0.01) compared with untreated control cells, whereas total Akt level remained unchanged (Fig. 3A
). To further confirm whether nanomolar NOtreated cells had increased pAkt activity, a kinase assay was done, where total Akt was immunoprecipitated from cell lysates, and the pellets were subjected to kinase assay using myelin basic protein as substrate. We observed a 3.1 ± 0.3-fold (P < 0.001) increased phosphorylation of myelin basic protein (Fig. 3B) in cells treated with 60 µmol/L DETA-NONOate compared with control, suggesting an increase in pAkt activity after treatment with nanomolar NO.

View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 3. A, nanomolar NO treatment increases pAkt levels in MDA-MB-231 cells. Cells treated with DETA-NONOate were Western blotted for pAkt, Akt, and GAPDH. Representative data from four independent experiments. Right, densitometric scan of pAkt. Columns, mean of four experiments; bars, SE. **, P 0.01, compared with control, 0 µmol/L DETA-NONOate. B, nanomolar NO treatment increases pAkt activity in MDA-MB-231 cells. Cells after DETA-NONOate treatment were prepared for immunoprecipitation with Akt antibody, and a kinase assay was done using myelin basic protein as the substrate. The immunoprecipitate was Western blotted with antiphospho-myelin basic protein (pMBP) antibody. Representative of three independent experiments. C, inhibition of PI-3 kinase/Akt in DETA-NONOatetreated cells decreases the levels of both pAkt and cyclin D1. Cells (MDA-MB-231) treated with various concentrations of DETA-NONOate (060 µmol/L), either in the presence or absence of LY294002 (30 µmol/L), and Western blot analysis was done for pAkt, cyclin D1, and GAPDH. Representative data from three independent experiments. D, nanomolar NOtreated cells had increased association of p110 and p85 subunits of PI-3 kinase. Cells (MDA-MB-231) treated with DETA-NONOate were immunoprecipitated with an anti-p85 subunit of PI-3 kinase and Western blotted with an anti-p110 subunit of PI-3 kinase. As an experimental control, p85 was also immunoprecipitated from input lysates, which were immunoblotted with anti-p85 antibody. Representative data from three independent experiments.
|
|
We used pharmacologic inhibitors of PI-3 kinase to examine whether increase in pAkt activity regulated cyclin D1 translation in NO-treated cells. Treatment of MDA-MB-231 cells with LY294002 (30 µmol/L), a PI-3 kinase inhibitor, decreased the basal levels of pAkt (50 ± 6%, P < 0.05) and cyclin D1 (60 ± 7%, P < 0.02) and attenuated DETA-NONOate (60 µmol/L)induced increase of pAkt (60 ± 8-fold, P < 0.001) and cyclin D1 (54 ± 11-fold, P < 0.02; Fig. 3C). Similar results were obtained when wortmannin, another PI-3 kinase inhibitor, was used to inhibit pAkt (data not shown). These results indicated that nanomolar NOinduced increased cyclin D1 synthesis was possibly via up-regulation of pAkt in MDA-MB-231 cells. Activated PI-3 kinase enhances the synthesis of phosphatidylinositol 3'-phosphates, which binds to pleckstrin homology domain of Akt and increases its activation by targeting it to the cell membrane (26). To assess whether nanomolar NOinduced activation of Akt was due to increased activity of upstream PI-3 kinase, lysates from control and nanomolar NOtreated cells were immunoprecipitated with antibody against regulatory p85 subunit of PI-3 kinase and Western blotted with antibody against its catalytic p110 subunit. We found that nanomolar NO treatment increased the association of p110 subunit and p85 subunits of PI-3 kinase (3.2 ± 0.3-fold at 60 µmol/L DETA-NONOate, P < 0.001) compared with control cells (Fig. 3D), suggesting a possible mechanism for increase in its activity. In addition, for loading control, we immunoprecipitated p85 from the same treated lysates, which was blotted with anti-p85 antibody (Fig. 3D).
Nanomolar NO increased the activity of mTOR and its downstream targets eIF4E and p70s6k. The mTOR is a downstream effector of PI-3 kinase/Akt signaling pathway, which mediates crucial aspects of Akt-induced oncogenesis (27). To determine the effect of NO on mTOR activity, Western blot analysis was done using phospho-specific antibody to Ser2448, which has been shown to be important in the control of mTOR activity. We observed that nanomolar NO treatment increased the levels of phosphorylated mTOR (pmTOR) by 1.8 ± 0.3-fold (P < 0.05) in MDA-MB-231 and 2.1 ± 0.4-fold (P < 0.05) in MCF-7 compared with control cells (Fig. 4A and B
). Two translational components, ribosomal p70s6k and eIF4E binding protein 1 (4E-BP-1), are the best-characterized downstream effectors of mTOR. 4E-BP-1 binds to and represses the function of eIF4E, and phosphorylation of 4E-BP-1 dissociates it from eIF4E complex, enhancing a cap-dependent translation (28). Effect of nanomolar NO treatment on the phosphorylation state of p70s6k was assessed using phospho-specific antibody to Thr389 and Thr229, sites whose phosphorylation are vital to p70s6k activation. Effect of NO on the phosphorylation state of eIF4E was assessed by Western blot analysis using a phospho-specific antibody to Ser209 whose phosphorylation was important to eIF4E activation. There were increased phosphorylation levels of eIF4E by 1.7 ± 0.3-fold (P < 0.05) in MDA-MB-231 (Fig. 4A) and 1.8 ± 0.2-fold (P < 0.05) in MCF-7 cells after 60 µmol/L DETA-NONOate treatment. This was also accompanied by a significant increase in pp70s6k (1.7 ± 0.2-fold, P < 0.05 in MDA-MB-231 and 1.6 ± 0.2-fold, P < 0.05 in MCF-7) at a similar concentration of the NO donor (Fig. 4B). To elucidate whether NO-induced activation of mTOR was involved in the increase of cyclin D1 in MDA-MB-231 cells, we further inhibited mTOR with rapamycin, a specific inhibitor of mTOR kinase. A reduction (53 ± 8%) in cyclin D1 levels in rapamycin-treated cells was observed compared with control, suggesting the involvement of the pAkt/mTOR pathway in nanomolar NOinduced increase in cyclin D1 synthesis (Fig. 4C).

View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 4. A, nanomolar NO treatment increases the levels of pmTOR, pP70s6k, and peIF4E in MDA-MB-231 cells. Cells after treatment with DETA-NONOate were Western blotted with phospho-specific antibodies for mTOR (Ser2448), p70s6k (Thr229 and Thr389), and eIF4E (Ser209). Representative data from four independent experiments. *, P 0.05, compared with control, 0 µmol/L DETA-NONOate. B, nanomolar NO treatment increases the levels of pmTOR, pp70s6k, and peIF4E in MCF-7 cells. Cells after treatment with DETA-NONOate were Western blotted with phospho-specific antibodies for mTOR (Ser2448), p70s6k (Thr229 and Thr389), and eIF4E (Ser209). Representative data from three independent experiments. *, P 0.05, compared with control, 0 µmol/L DETA-NONOate. C, rapamycin treatment abrogates nanomolar NOinduced increase in cyclin D1. MDA-MB-231 cells after various treatments were prepared for Western analysis for cyclin D1. Membrane was stained with Ponseau S for equal loading. Representative autoradiograph of three independent experiments.
|
|
FTase inhibitor 111 inhibits nanomolar NOinduced activation of PI-3 kinase/Akt and pERK1/2. Farnesylation of Ras is required to anchor it to the cell membrane and trigger signaling through the PI-3 kinase/Akt and Raf/MEK/ERK pathways (29). To explore the possible role of Ras in nanomolar NOmediated activation of membrane-bound PI-3 kinase/Akt, Ras was rendered inactive in MDA-MB-231 cells by FTI (FTase inhibitor 111). FTI (25 µmol/L) treatment alone was sufficient to reduce the levels of pAkt in these cells. FTI treatment also attenuated NO-induced increase in pAkt, suggesting requirement of activated Ras in NO-mediated increase in PI-3 kinase/Akt signaling (Fig. 5A
). A decline in the level of cyclin D1 in FTI and NO plus FTItreated MDA-MB-231 cells (Fig. 5A) further emphasizes the role of Ras/PI-3 kinase/Akt signaling in cyclin D1 synthesis. Because it is reported that Ras also increases the signaling through the Raf/MEK/ERK pathway, we examined the levels of pERK1/2 in FTI and NO plus FTItreated cells. To examine the effect of nanomolar NO on pERK1/2 in MDA-MB-231 cells, Western blot using a phospho-specific antibody against Thr202/Tyr204 of pERK1/2 was done. Whereas DETA-NONOate (60 µmol/L) increased the levels of pAkt (2.15 ± 0.07-fold, P < 0.001), pERK1/2 (1.6 ± 0.2-fold, P < 0.02), and cyclin D1 (1.82 ± 0.12-fold, P < 0.05) compared with control cells. In DETA-NONOatetreated cells after simultaneous treatment with FTI (25 µmol/L), the respective increases in pAkt (P < 0.001) and cyclin D1 (P < 0.001) were abolished (Fig. 5A). We also observed that DETA-NONOate (60 µmol/L)induced increase in cell proliferation was abolished when the cells were simultaneously treated with FTI (Fig. 5B). It is reported that K-Ras is highly activated in MDA-MB-231 cells (30). To further assess the involvement of K-Ras in NO-induced proliferation, we treated the cells with K-Ras siRNA, which reduced the level of K-Ras by 65% to 70%. We observed that K-Ras siRNA significantly attenuated NO-induced increase in cell proliferation (P < 0.05; Fig. 5C) in these cells. The above data suggest that nanomolar NOmediated increase of PI-3 kinase/Akt and pERK1/2 was most likely at least in part mediated through activation of Ras.


View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 5. A, FTI treatment of MDA-MB-231 cells attenuates nanomolar NOinduced increase in pAkt, pERK, and cyclin D1. Cells after various treatments were prepared for Western blot analysis for pAkt, pERK, and cyclin D1. Representative autoradiograph of three independent experiments. Bottom left, arbitrary densitometric unit of pAkt after normalization with GAPDH from Fig. 3A. **, P 0.001, compared with control, 0 µmol/L DETA-NONOate; #, P 0.001, compared with the DETA-NONOate alonetreated group. Bottom right, arbitrary densitometric unit of cyclin D1 after normalization with GAPDH from Fig. 3A. *, P 0.05, compared with control, 0 µmol/L DETA-NONOate; **, P 0.001, compared with the DETA-NONOate alonetreated group. B, FTI treatment of MDA-MB-231 cells attenuates nanomolar NOinduced increase in cell proliferation. Cells (1 x 105) after various treatments were subjected to cell counting by trypan blue exclusion method. Columns, mean of four experiments; bars, SE. **, P 0.02; ***, P 0.003, compared with control group, without DETA-NONOate and FTI treatment. C, inhibition of K-Ras expression and NO-induced cell proliferation by siRNA. K-Ras and random siRNA were transfected in MDA-MB-231 cells by Amaxa, and cells were treated with or without DETA-NONOate (60 µmol/L). % Increase in cell proliferation compared with control cells was plotted after 24 h. *, P 0.05. D, nanomolar NO increases Raf/MEK/ERK signaling in MDA-MB-231 cells. Cells treated with DETA-NONOate were Western blotted with phosphor-specific antibody for Raf (Ser259), MEK (Ser217, Ser221), and ERK1/2 (Thr202, Tyr204). Cell lysates were also blotted for anti ERK1/2 and GAPDH antibodies. Representative autoradiograph of three independent experiments. Right, arbitrary densitometric units of pRaf, pMEK, and pERK1/2 after normalization with GAPDH from (C). *, P 0.05; **, P 0.005, compared with control, 0 µmol/L DETA-NONOate. E, PD 98059 treatment attenuates NO-induced increase in cyclin D1 levels. Cells treated with various concentrations of DETA-NONOate and PD 98059 (30 µmol/L) was Western blotted for cyclin D1 with anti-cyclin D1 antibody. Representative autoradiograph of four independent experiments. **, P 0.02, compared with control group without DETA-NONOate and PD 98059; #, P 0.02, compared with DETA-NONOatetreated group only. F, PD 98059 treatment attenuates NO-induced increase in eIF4E. Cells treated with various concentrations of DETA-NONOate and PD 98059 (30 µmol/L) was Western blotted for eIF4E. Representative autoradiograph of four independent experiments. *, P 0.05, compared with control group without DETA-NONOate and PD 98059 treatment; #, P 0.02, compared with DETA-NONOatetreated group only.
|
|
To examine the mechanism by which nanomolar NO increased the levels of pERK1/2 in MDA-MB-231 cells, the levels of pMEK1/2 and pRaf, which are kinases upstream to ERK1/2, were examined. Lysates from nanomolar NOtreated and control cells were Western blotted with phospho-specific antibodies to Ser259 for pRaf and Ser217/221 for pMEK1/2 and pERK1/2. We observed that DETA-NONOate (60 µmol/L)treated cells had increased levels of pRaf (1.6 ± 0.1, P < 0.02), pMEK (1.9 ± 0.1, P < 0.001), and pERK1/2 (2.1 ± 0.2, P < 0.001) compared with control group, whereas the levels of ERK1/2 remained unchanged (Fig. 5D), suggesting increased Raf/MEK/pERK1/2 signaling in MDA-MB-231 cells.
To examine whether Raf/MEK/ERK1/2 signaling was involved in nanomolar NOinduced increase in cyclin D1 levels, PD 98059, an inhibitor of MEK1/2, was used to inhibit ERK1/2 activity in MDA-MB-231 cells. After treatment with PD 98059 (30 µmol/L) inhibitor for 48 h, cells were further exposed to nanomolar NO for 24 h. We observed that DETA-NONOate (60 µmol/L) increased cyclin D1 (2.1 ± 0.7-fold, P < 0.02) expression compared with control cells, whereas simultaneous treatment of cells with PD 98059 (30 µmol/L) led to a significant inhibition of DETA-NONOateinduced increase in cyclin D1, suggesting involvement of Raf/MEK/ERK1/2 signaling in cyclin D1 synthesis (Fig. 5E). Because pERK1/2 is known to increase the activity of cap-binding translation factor eIF4E, we assessed the levels of peIF4E and in the presence of PD 98059. DETA-NONOate (30 µmol/L) induced increase in peIF4E (1.8 ± 0.12, P < 0.02) compared with control (1.08 ± 0.2) and was abolished in cells simultaneously treated with PD 98059 (Fig. 5F).
Because nanomolar NO has been found to increase Raf/MEK/ERK1/2 and PI-3 kinase/Akt signaling in MDA-MB-231 cells, we assessed the possibility of a cross-talk between these pathways after nanomolar NO treatment. In presence of PD 98059 inhibitors when the levels of pERK1/2 was lowered at 48 h, nanomolar NO induced increase in the levels of pAkt was not attenuated, suggesting the increased signaling through these pathways occurred independent of each other (data not shown).
Nanomolar NOinduced increase in PI-3 kinase/Akt and Raf/MEK/ERK signaling is cGMP independent in MDA-MB-231 cells. Because cGMP influences a number of crucial NO-regulated signaling events, we assessed whether low concentrations of nanomolar NOmediated increase in cell proliferation of MDA-MB-231 was cGMP dependent. To determine the role of cGMP in nanomolar NOinduced increase in Raf/MEK/ERK and PI-3 kinase/Akt signaling, cells after various treatments were analyzed for cGMP levels as described in Materials and Methods. Pharmacologic inhibitor of guanylate cyclase ODQ (30 µmol/L; ref. 31) was used to block the production of cGMP in NO-treated cells. The level of cGMP was found to peak at 3 h of NO treatment in MDA-MB-231 cells, after which the levels of cGMP declined (Fig. 6A
). In our study, DETA-NONOate (60 µmol/L) treatment significantly increased cGMP (14.4 ± 1.3, P < 0.003 after 3 h and 10.1 ± 1.1, P < 0.003 after 6 h) compared with control, whereas simultaneous treatment of DETA-NONOate treated cells with ODQ (30 µmol/L) led to a significant decrease (0.8 ± 0.2, P < 0.001 at 3 h and 0.7 ± 0.18, P < 0.001 at 6 h) in cGMP levels (Fig. 6A). Higher concentrations of NO (µmol/L), which is associated with cytostasis and apoptosis, led to an increase in cGMP levels to 40 to 50 pmol/mL at 3 h (data not shown). Even in the presence of ODQ, when NO-induced increase in cGMP was abrogated, nanomolar NO increased the proliferation of MDA-MB-231 cells (Fig. 6B). Pretreatment of DETA-NONOate (60 µmol/L)treated cells with ODQ did not attenuate nanomolar NOinduced increase in the levels of pERK1/2 (1.6 ± 0.2-fold versus 1.9 ± 0.3-fold), cyclin D1 (1.8 ± 0.3-fold versus 1.7 ± 0.2-fold), or pAkt (2.1 ± 0.3-fold versus 2.0 ± 0.3-fold) compared with control group, suggesting that cGMP-independent mechanisms were operative in MDA-MB-231 cells (Fig. 6C). These experiments suggest that nanomolar NOmediated Ras activation in MDA-MB-231 cells seems to be cGMP independent.

View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 6. A, DETA NONOate increases cGMP levels in MDA-MB-231 cells, which were abrogated by ODQ. Cells treated with DETA-NONOate (60 µmol/L) or DETA-NONOate plus ODQ for 3 or 6 h were utilized to measure cGMP as described in Materials and Methods. Columns, mean of four experiments; bars, SE. **, P 0.003; ***, P 0.001. B, DETA-NONOateinduced increase in cell proliferation was not attenuated by ODQ. Cells were treated with DETA-NONOate or DETA-NONOate plus ODQ for 24 h, after which they were harvested and subjected to cell counting by trypan blue exclusion method. Columns, mean of four experiments; bars, SE. C, DETA-NONOateinduced increase in pERK1/2, pAkt, and cyclin D1 was not abrogated by ODQ. Cells were treated with DETA-NONOate or DETA-NONOate plus ODQ for 24 h, after which they were prepared for Western blot analysis for pERK1/2, pAkt, and cyclin D1 using the respective antibodies. Representative autoradiograph of four independent experiments.
|
|
 |
Discussion
|
|---|
Tumor-associated NO, depending on its local concentration and duration of exposure, can affect tumor growth positively or negatively by regulating specific signal transduction pathways (32, 33). Although controversies still persist regarding concentrations of NO, there are substantial experimental evidences that support a positive association between nanomolar concentrations of NO and tumor progression (79). In this study, we observed that low concentrations (nanomolar) of NO target the translational machinery to increase the rate of synthesis of cyclin D1 and ODC (Fig. 2C), without altering their mRNA levels or half-lives. Translational control has been predicted for many proliferation-related proteins after sequence comparison of their 5' untranslated regions (UTR) with other mRNA species (34). Although malignant cells harbor potentially perturbed translational machinery, there are also evidences that manipulation of this machinery leads to cancer development and progression (33, 34). Studies have identified cyclin D1 and ODC as two integral cell cycle transit proteins whose cap-dependent transcripts are subject to strong translational control (33, 34). Recent studies show that posttranscriptional events play a critical role in maintaining high protein levels of cyclin D1, a potential oncogenic element in tumors (35). Considerable increase in ODC activity due to up-regulation in the translation of the ODC mRNA into protein has been found in Ras-overexpressed cells (36). ODC, a key regulatory enzyme in the biosynthesis of polyamines, is associated with carcinogenesis, and breast tumor tissues have been found to have 2- to 3-fold higher polyamine levels than surrounding normal tissues (36). Both cyclin D1 and ODC mRNA contain highly structured 5' UTRs, rendering them to be less efficiently translated in normal cells (37). In our study, NO treatment of MDA-MB-231 and MCF-7 cells increased the activity of key components in the translational machinery. eIF4E is an important regulatory component of the translation initiation complex that controls the activation of proto-oncogenes and is present in limiting concentration in the cells. We observed increased levels of peIF4E in nanomolar NOtreated cells, which could explain the increased translation of cyclin D1 and ODC, both of which have lengthy highly structured 5' UTR. To our knowledge, this is the first report where NO, at least, partially up-regulates the rate of synthesis of cyclin D1 and ODC through the mTOR/eIF4E pathway.
Biological activities of NO can be mediated by either cGMP-dependent (38) or cGMP-independent pathways (3941). The most important physiologic effects of NO are mediated by binding to guanylyl cyclasecoupled specialized heme group, which results in activation of guanylyl cyclase and production of cGMP (38). In our study, cells pretreated with ODQ, an inhibitor of guanylate cyclase, did not attenuate nanomolar NOinduced increase in pERK, pAkt, and cyclin D1, which was assessed at 24 h. In addition, nanomolar NOinduced increase in cell proliferation was also not attenuated in presence of ODQ, suggesting that NO initiated cGMP-independent mechanisms, which were operative in this malignant breast cancer cell line. In our study, we observed that NO increased cell proliferation by up-regulating PI-3 kinase/Akt activity by a cGMP-independent mechanism. Our results are contrary to the study where NO promotes endothelial cell migration and neovascularization by increasing PI-3 kinase/Akt activity in a cGMP-dependent mechanism (42). Our results are also inconsistent with the study where NO in low concentrations increases survival of neurons and endothelial cells by increasing the activity of PI-3 kinase/Akt in a cGMP-mediated manner (43). Inconsistency with our results could be due to utilization of other NO donors (GSNO and SNAP) with shorter half-life in other studies, which is in contrast to our study, where DETA-NONOate, with the longest half-life of the entire known NO donors, was used. The inconsistency could also be due to other studies using normal cell types (endothelial and neuronal cells), which have very different biological settings than the malignant human breast cancer cells used in our study. In our studies, we were also analyzing longer-lasting perturbations in the signaling pathways that lead to proliferation, a sharp contrast to the transient changes detected in most studies. However, to our knowledge, this is the first report where NO increases PI-3 kinase/Akt signaling in a cGMP-independent manner by activation of membrane-bound Ras. This increase in the levels of pAkt is only with lower concentrations of NO, whereas higher concentrations (micromolar) decrease the levels of pAkt-inducing apoptosis (11).
In this study, we observed that NO up-regulates ERK1/2 signaling at least in part by activating Ras in a cGMP-independent manner. Our results are inconsistent with report where NO mediates cGMP-dependent activation of ERK1/2 to promote migration of mouse mammary tumor cells (19). There is probability that in these NOS-overexpressing mouse mammary tumors, Ras or its associated adaptor proteins involved in amplification of Ras signaling were not adequately expressed, thereby preventing the effects of NO on Ras modifications to be manifested. Our results are also inconsistent with those of another study conducted in human breast cancer cell line MCF-7, where NO-mediated cGMP-dependent ERK1/2 activation was very transient (1 h) in nature (33). The inconsistency with our results where we get persistent ERK1/2 activation is probably because other studies used short half-life NO donors (DEA/NO and Spermine/NO), whereas we used DETA-NONOate, which has a much longer half-life.
Recent studies show that NO regulates a wide range of biological functions via posttranslational modifications, leading to nitrosylation of critical cysteine residues of proteins in signaling cascade (40, 41). The reversible regulation of proteins by nitrosothiols has been established as critical signaling mechanism by nNOS (40). Nanomolar NO has been reported to activate Ras posttranslationally, due to S-nitrosylation of critical Cys118 residue, which stimulates guanine nucleotide exchange (44). Ras, a membrane-bound proto-oncogene, plays a key role as a molecular switch that links the activation of cell surface receptors with signaling cascades that control proliferation. Data from our study suggest that nanomolar NO treatment of MDA-MB-231 cells led to Ras-mediated increase in PI-3 kinase/Akt and Raf/MEK/ERK signal transduction pathways. Posttranslational modification of Ras protein, by farnesyl transferase, is critical for its attachment to the cell membrane for proper functioning. FTase inhibitor 111 alone decreased the basal levels of pERK1/2, pAkt, and cyclin D1 and induced cytostasis (Fig. 5A and B), which suggests the dependence of these cells on functional Ras for proliferation. Pretreatment with FTase inhibitor 111 also attenuated nanomolar NOinduced increase in pERK1/2, pAkt, or cyclin D1 and cell proliferation (Fig. 5A and B). Furthermore, K-Ras siRNA attenuated NO-induced cell proliferation (Fig. 5C), indicating a critical role of Ras in nanomolar NOmediated cell proliferation signaling. MDA-MB-231 is one of the most malignant breast cancer cell lines, which contains numerous genetic mutations leading to overexpression of potential oncogenes. Growth factor receptor binding protein 2, which complexes with adaptor proteins involved in Ras signaling and HER-2, which increases the sensitivity of Ras signaling, are overexpressed in breast cancer cells (4447). In this biological setting, low concentration of NO could amplify Ras signaling by inducing conformational changes of the membrane-bound Ras protein. Because NO has been shown to promote guanine nucleotide exchange on Ras to promote Ras-GTP levels, there is also a possibility that NO might be modulating Rheb/mTOR activity. The major difference between mode of action of Ras and that of Rheb is that in case of Ras, GTP charging is necessary for ability of Ras to bind and activate its effectors, whereas Rheb GTP charging is necessary only for effector function (48).
In summary, our data show that low concentrations of NO increases the rate of synthesis of cyclin D1 and ODC in MDA-MB-231 and MCF-7 cell lines by activating mTOR, eIF4E, and p70s6k in the translational machinery via PI-3 kinase/Akt and RAF/MEK/ERK1/2 signaling cascades. The up-regulation of Akt and ERK1/2 activity was due to NO-induced cGMP-independent Ras activation. Results from our studies may have important clinical implications. Most authors have found increased expression of iNOS (18, 49) and eNOS expression (50) compared with weak to undetectable expression seen in benign breast epithelium. Although iNOS is expressed in breast cancer, the activity is at least one to two orders of magnitude lower than the enzyme activity associated with cytotoxicity and apoptosis (51). Furthermore, epithelial and stromal expression of eNOS has been shown in phyllodes tumor, and there is a positive correlation between eNOS expression and tumor grade (50). On this basis, it has been suggested that NO may provide a positive growth signal within the tumor. Our studies have elucidated the potential molecular mechanisms by which this may occur. Further studies are being planned to confirm these in vitro findings in an animal model in vivo.
 |
Acknowledgments
|
|---|
Grant support: Palomba Weingarten, Allegra Charach Cancer Research Fund, USPHS grant CA-78357 (G. Chaudhuri), grant 1S06-GM068510-03 (R. Singh), RCMI grant G12RR03026, and the Entertainment Industry Foundation Women's Cancer Research Fund.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Janis Cuevas and Svetlana Arutyunova for their technical assistance.
Received 12/27/05.
Revised 9/29/06.
Accepted 10/25/06.
 |
References
|
|---|
- Gong L, Pitari G, Schulz S, Waldman SA. Nitric oxide signaling: systems integration of oxygen balance in defense of cell integrity. Curr Opin Hematol 2004;11:714.[CrossRef][Medline]
- Torreilles J. Nitric oxide: one of the more conserved and widespread signaling molecules. Front Biosci 2001;6:D116172.[Medline]
- Schindler H, Bogdan C. NO as a signaling molecule: effects on kinases. Int Immunopharmacol 2001;1:144355.[CrossRef][Medline]
- Levonen AL, Patel RP, Brookes P, et al. Mechanisms of cell signaling by nitric oxide and peroxynitrite: from mitochondria to MAP kinases. Antioxid Redox Signal 2001;3:21529.[CrossRef][Medline]
- Demple B. Signal transduction by nitric oxide in cellular stress responses. Mol Cell Biochem 2002;2345:118.
- Forstermann U, Boissel JP, Kleinert H. Expressional control of the constitutive isoforms of nitric oxide synthase (NOS I and NOS III). FASEB J 1998;12:77390.[Abstract/Free Full Text]
- Stepnik M. Roles of nitric oxide in carcinogenesis: protumorigenic effects. Int J Occup Med Environ Health 2002;15:21927.[Medline]
- Ekmekcioglu S, Tang CH, Grimm EA. NO news is not necessarily good news in cancer. Curr Cancer Drug Targets 2005;5:10315.[CrossRef][Medline]
- Siegert A, Rosenberg C, Schmitt WD, Denkert C, Hauptmann S. Nitric oxide of human colorectal adenocarcinoma cell lines promotes tumour cell invasion. Br J Cancer 2002;86:13105.[CrossRef][Medline]
- Juang SH, Xie K, Xu L, et al. Suppression of tumorigenicity and metastasis of human renal carcinoma cells by infection with retroviral vectors harboring the murine inducible nitric oxide synthase gene. Hum Gene Ther 1998;9:84554.[Medline]
- Pervin S, Singh R, Freije WA, Chaudhuri G. MKP-1-induced dephosphorylation of extracellular signal-regulated kinase is essential for triggering nitric oxide-induced apoptosis in human breast cancer cell lines: implications in breast cancer. Cancer Res 2003;63:885360.[Abstract/Free Full Text]
- Pervin S, Singh R, Chaudhuri G. Nitric oxide-induced cytostasis and cell cycle arrest of a human breast cancer cell line (MDA-MB-231): potential role of cyclin D1. Proc Natl Acad Sci U S A 2001;98:35838.[Abstract/Free Full Text]
- Lala PK, Chakraborty C. Role of nitric oxide in carcinogenesis and tumour progression. Lancet Oncol 2001;2:14956.[CrossRef][Medline]
- Wink DA, Vodovotz Y, Laval J, Laval F, Dewhirst MW, Mitchell JB. The multifaceted roles of nitric oxide in cancer. Carcinogenesis 1998;19:71121.[Abstract/Free Full Text]
- Thomsen LL, Miles DW. Role of nitric oxide in tumour progression: lessons from human tumours. Cancer Metastasis Rev 1998;17:10718.[CrossRef][Medline]
- Gratton JP, Lin MI, Yu J, et al. Selective inhibition of tumor microvascular permeability by cavtratin blocks tumor progression in mice. Cancer Cell 2003;4:319.[CrossRef][Medline]
- Morales-Ruiz M, Fulton D, Sowa G, et al. Vascular endothelial growth factor-stimulated actin reorganization and migration of endothelial cells is regulated via the serine/threonine kinase Akt. Circ Res 2000;86:8926.[Abstract/Free Full Text]
- Thomsen LL, Miles DW, Happerfield L, Bobrow LG, Knowles RG, Moncada S. Nitric oxide synthase activity in human breast cancer. Br J Cancer 1995;72:414.[Medline]
- Jadeski LC, Chakraborty C, Lala PK. Nitric oxide-mediated promotion of mammary tumour cell migration requires sequential activation of nitric oxide synthase, guanylate cyclase and mitogen-activated protein kinase. Int J Cancer 2003;106:496504.[CrossRef][Medline]
- Singh R, Pervin S, Karimi A, Cederbaum S, Chaudhuri G. Arginase activity in human breast cancer cell lines: N(omega)-hydroxy-L-arginine selectively inhibits cell proliferation and induces apoptosis in MDA-MB-468 cells. Cancer Res 2000;60:330512.[Abstract/Free Full Text]
- Xu Q, Wink DA, Colton CA. Nitric oxide production and regulation of neuronal NOS in tyrosine hydroxylase containing neurons. Exp Neurol 2004;188:34150.[CrossRef][Medline]
- Singh R, Pervin S, Wu G, Chaudhuri G. Activation of caspase-3 activity and apoptosis in MDA-MB-468 cells by N(omega)-hydroxy-L-arginine, an inhibitor of arginase, is not solely dependent on reduction in intracellular polyamines. Carcinogenesis 2001;22:18639.[Abstract/Free Full Text]
- Kim I-A, Bae S-S, Fernandes A, et al. Selective inhibition of Ras, phosphoinositide 3 kinase, and Akt isoforms increases the radiosensitivity of human carcinoma cell lines. Cancer Res 2005;65:790210.[Abstract/Free Full Text]
- Sarkar R, Webb RC, Stanley JC. Nitric oxide inhibition of endothelial cell mitogenesis and proliferation. Surgery 1995;118:2749.[CrossRef][Medline]
- Mirza AM, Kohn AD, Roth RA, McMahon M. Oncogenic transformation of cells by a conditionally active form of the protein kinase Akt/PKB. Cell Growth Differ 2000;11:27992.[Abstract/Free Full Text]
- Balsara BR, Pei J, Mitsuuchi Y, et al. Frequent activation of AKT in non-small cell lung carcinomas and preneoplastic bronchial lesions. Carcinogenesis 2004;25:20539.[Abstract/Free Full Text]
- Altomare DA, Wang HQ, Skele KL, et al. AKT and mTOR phosphorylation is frequently detected in ovarian cancer and can be targeted to disrupt ovarian tumor cell growth. Oncogene 2004;23:58537.[CrossRef][Medline]
- Vignot S, Faivre S, Aguirre D, Raymond E. mTOR-targeted therapy of cancer with rapamycin derivatives. Ann Oncol 2005;16:52537.[Abstract/Free Full Text]
- Pervin S, Singh R, Gau CL, Edamatsu H, Tamanoi F, Chaudhuri G. Potentiation of nitric oxide-induced apoptosis of MDA-MB-468 cells by farnesyltransferase inhibitor: implications in breast cancer. Cancer Res 2001;61:47016.[Abstract/Free Full Text]
- Warnberg F, White D, Anderson E, et al. Effect of a farnesyl transferase inhibitor (R115777) on ductal carcinoma in situ of the breast in a human xenograft model and on breast and ovarian cancer cell growth in vitro and in vivo. Breast Cancer Res 2006;8:21.
- Zaragoza C, Soria E, Lopez E, et al. Activation of the mitogen activated protein kinase extracellular signal-regulated kinase 1 and 2 by the nitric oxide-cGMP-cGMP-dependent protein kinase axis regulates the expression of matrix metalloproteinase 13 in vascular endothelial cells. Mol Pharmacol 2002;62:92735.[Abstract/Free Full Text]
- Jenkins DC, Charles IG, Thomsen LL, et al. Roles of nitric oxide in tumor growth. Proc Natl Acad Sci U S A 1995;92:43926.[Abstract/Free Full Text]
- Thomas DD, Espey MG, Ridnour LA, et al. Hypoxic inducible factor 1alpha, extracellular signal-regulated kinase, and p53 are regulated by distinct threshold concentrations of nitric oxide. Proc Natl Acad Sci U S A 2004;101:88949.[Abstract/Free Full Text]
- Parsa AT, Holland EC. Cooperative translational control of gene expression by Ras and Akt in cancer. Trends Mol Med 2004;10:60713.[CrossRef][Medline]
- Grewe M, Gansauge F, Schmid RM, Adler G, Seufferlein T. Regulation of cell growth and cyclin D1 expression by the constitutively active FRAP-p70s6K pathway in human pancreatic cancer cells. Cancer Res 1999;59:35817.[Abstract/Free Full Text]
- Shantz LM. Transcriptional and translational control of ornithine decarboxylase during Ras transformation. Biochem J 2004;377:25764.[CrossRef][Medline]
- Mamane Y, Petroulakis E, Rong L, Yoshida K, Ler LW, Sonenberg N. eIF4E-from translation to transformation. Oncogene 2004;23:1729.
- Murad F. The nitric oxide-cyclic GMP signal transduction system for intracellular and intercellular communication. Recent Prog Horm Res 1994;49:23948.[Medline]
- Lander HM. An essential role for free radicals and derived species in signal transduction. FASEB J 1997;11:11824.[Abstract]
- Jaffrey SR, Erdjument-Bromage H, Ferris CD, Tempst P, Snyder SH. Protein S-nitrosylation: a physiological signal for neuronal nitric oxide. Nat Cell Biol 2001;3:1937.[CrossRef][Medline]
- Hess DT, Matsumoto A, Kim SO, Marshall HE, Stamler JS. Protein S-nitrosylation: purview and parameters. Nat Rev Mol Cell Biol 2005;6:15066.[CrossRef][Medline]
- Kawasaki K, Smith RS, Jr., Hsieh CM, Sun J, Chao J, Liao JK. Activation of the phosphatidylinositol 3-kinase/protein kinase Akt pathway mediates nitric oxide-induced endothelial cell migration and angiogenesis. Mol Cell Biol 2003;23:572637.[Abstract/Free Full Text]
- Ciani E, Virgili M, Contestabile A. Akt pathway mediates a cGMP-dependent survival role of nitric oxide in cerebellar granule neurones. J Neurochem 2002;81:21828.[CrossRef][Medline]
- Heo J, Prutzman KC, Mocanu V, Campbell SL. Mechanism of free radical nitric oxide-mediated Ras guanine nucleotide dissociation. J Mol Biol 2005;346:142340.[CrossRef][Medline]
- Janes PW, Daly RJ, deFazio A, Sutherland RL. Activation of the Ras signalling pathway in human breast cancer cells. Oncogene 1994;9:36018.[Medline]
- Pandey P, Kharbanda S, Kufe D. Association of the DF3/MUC1 breast cancer antigen with Grb2 and the Sos/Ras exchange protein. Cancer Res 1995;55:40003.[Abstract/Free Full Text]
- Reese DM, Slamon DJ. HER-2/neu signal transduction in human breast and ovarian cancer. Stem Cells 1997;15:18.[Medline]
- Long X, Lin Y, Ortiz-Vega S, Yonezawa K, Avruch J. Rheb binds and regulates the mtor kinase. Curr Biol 2005;15:70213.[CrossRef][Medline]
- Vakkala M, Kahlos K, Lakari E, Paakko P, Kinnula V, Soini Y. Inducible nitric oxide synthase expression, apoptosis, and angiogenesis in in situ and invasive breast carcinomas. Clin Cancer Res 2000;6:240816.[Abstract/Free Full Text]
- Tse GM, Wong FC, Tsang AK, et al. Stromal nitric oxide synthase (NOS) expression correlates with the grade of mammary phyllodes tumour. J Clin Pathol 2005;58:6004.[Abstract/Free Full Text]
- Thomsen LL, Miles DW. Role of nitric oxide in tumor progression: lessons from human tumours. Cancer Metastasis Rev 1998;17:10718.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
J. Ding, B. Ning, W. Gong, W. Wen, K. Wu, J. Liang, G. He, S. Huang, W. Sun, T. Han, et al.
Cyclin D1 Induction by Benzo[a]pyrene-7,8-diol-9,10-epoxide via the Phosphatidylinositol 3-Kinase/Akt/MAPK- and p70s6k-dependent Pathway Promotes Cell Transformation and Tumorigenesis
J. Biol. Chem.,
November 27, 2009;
284(48):
33311 - 33319.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Pervin, A. H. Tran, S. Zekavati, J. M. Fukuto, R. Singh, and G. Chaudhuri
Increased Susceptibility of Breast Cancer Cells to Stress Mediated Inhibition of Protein Synthesis
Cancer Res.,
June 15, 2008;
68(12):
4862 - 4874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. H. Wei, Y. Yang, G. Wu, and L. J. Ignarro
IL-4 and IL-13 upregulate ornithine decarboxylase expression by PI3K and MAP kinase pathways in vascular smooth muscle cells
Am J Physiol Cell Physiol,
May 1, 2008;
294(5):
C1198 - C1205.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Yeager, C. Brewer, K. Q. Cai, X.-X. Xu, and A. Di Cristofano
Mammalian Target of Rapamycin Is the Key Effector of Phosphatidylinositol-3-OH Initiated Proliferative Signals in the Thyroid Follicular Epithelium
Cancer Res.,
January 15, 2008;
68(2):
444 - 449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. A. Corl, J. Odle, X. Niu, A. J. Moeser, L. A. Gatlin, O. T. Phillips, A. T. Blikslager, and J. M. Rhoads
Arginine Activates Intestinal p70S6k and Protein Synthesis in Piglet Rotavirus Enteritis
J. Nutr.,
January 1, 2008;
138(1):
24 - 29.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Ying, A. B. Hofseth, D. D. Browning, M. Nagarkatti, P. S. Nagarkatti, and L. J. Hofseth
Nitric Oxide Inactivates the Retinoblastoma Pathway in Chronic Inflammation
Cancer Res.,
October 1, 2007;
67(19):
9286 - 9293.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Brewer, N. Yeager, and A. Di Cristofano
Thyroid-Stimulating Hormone Initiated Proliferative Signals Converge In vivo on the mTOR Kinase without Activating AKT
Cancer Res.,
September 1, 2007;
67(17):
8002 - 8006.
[Abstract]
[Full Text]
[PDF]
|
 |
|