
Cancer Research 67, 4949-4955, May 15, 2007. doi: 10.1158/0008-5472.CAN-07-0297
© 2007 American Association for Cancer Research
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
Suicide Gene Therapy of Human Colon Carcinoma Xenografts Using an Armed Oncolytic Adenovirus Expressing Carboxypeptidase G2
Silke Schepelmann1,2,
Lesley M. Ogilvie1,
Douglas Hedley1,
Frank Friedlos1,
Janet Martin1,
Ian Scanlon1,
Ping Chen3,
Richard Marais2 and
Caroline J. Springer1
The Institute of Cancer Research, Cancer Research UK Centres for 1 Cancer Therapeutics and 2 Cell and Molecular Biology, London, United Kingdom; and 3 Genetic Therapy, Inc., Gaithersburg, Maryland
Requests for reprints: Caroline J. Springer, Cancer Research UK Centre for Cancer Therapeutics, The Institute of Cancer Research, 15 Cotswold Road, Sutton, Surrey SM2 5NG, United Kingdom. Phone: 44-80872-24214; Fax: 44-20872-24046; E-mail: Caroline.Springer{at}icr.ac.uk.
 |
Abstract
|
|---|
We have designed a targeted systemic suicide gene therapy that combines the advantages of tumor-selective gene expression, using the human telomerase promoter (hTERT), with the beneficial effects of an oncolytic adenovirus to deliver the gene for the prodrug-activating enzyme carboxypeptidase G2 (CPG2) to tumors. Following delivery of the vector (AdV.hTERT-CPG2) and expression of CPG2 in cancer cells, the prodrug ZD2767P was administered for conversion by CPG2 to a cytotoxic drug. This system is sometimes termed gene-directed enzyme prodrug therapy (GDEPT). Here, we have shown that it is applicable to 10 human colorectal carcinoma cell lines with a direct correlation between viral toxicity and CPG2 production. SW620 xenografts were selected for analysis and were significantly reduced or eradicated after a single administration of AdV.hTERT-CPG2 followed by a prodrug course. The oncolytic effect of adenovirus alone did not result in DNA cross-links or apoptosis, whereas DNA cross-links and apoptosis occurred following prodrug administration, showing the combined beneficial effects of the GDEPT system. The apoptotic regions extended beyond the areas of CPG2 expression in the tumors, indicative of significant bystander effects in vivo. Higher concentrations of vector particles and CPG2 were found in the AdV.hTERT-CPG2 plus prodrug–treated tumors compared with the virus alone, showing an unexpected beneficial and cooperative effect between the vector and GDEPT. This is the first time that a tumor-selective GDEPT vector has been shown to be effective in colorectal carcinoma and that apoptosis and significant bystander effects have been identified as the mechanisms of cytotoxicity within the tumor. [Cancer Res 2007;67(10):4949–55]
 |
Introduction
|
|---|
Despite recent advances in the treatment of colorectal cancer, the death rate remains high. In 2002, more than 56,000 people died from the disease in the U.S.4 Agents with novel mechanisms of actions are needed both in second- and third-line metastatic disease when other options have been exhausted, along with improvements in the treatment for earlier clinical settings. Oncolytic adenovirus therapy has emerged as a promising candidate (1, 2). It has been shown to produce clinical benefits in patients with colon cancer (3) and has recently been approved for cancer treatment in China (4). Oncolytic adenoviruses are particularly efficient in combination with chemotherapy (5–7). They are also efficient gene delivery vectors (8) and can be administered to patients via the hepatic artery (3, 6), which makes oncolytic adenoviruses attractive for systemic gene therapy of metastasized colorectal cancer.
We have constructed the oncolytic adenovirus AdV.hTERT-CPG2 for gene-directed enzyme-prodrug therapy (GDEPT; refs. 8, 9). GDEPT is a suicide gene therapy approach that directs chemotherapeutic agents to tumors selectively (10). AdV.hTERT-CPG2 replicates in, and kills, telomerase-positive tumor cells, and at the same time targets expression of the GDEPT enzyme carboxypeptidase G2 (CPG2) to the cancer cells (8) for conversion of the alkylating agent mustard prodrug ZD2767P (11, 12) to a cytotoxic drug. It is unlikely that all cells of a tumor (particularly non–cancer stromal cells) will synthesize CPG2 following the administration of AdV.hTERT-CPG2. Therefore, a so-called "bystander effect" is required, i.e., the ability of CPG2-expressing, prodrug-activating cells to kill adjacent, nonexpressing cells (13).
Here, we describe the use of an oncolytic adenoviral vector that can target tumors systemically and selectively for activation of a potent prodrug. We show significant long-term antitumor efficacy following a single systemic administration of AdV.hTERT-CPG2 followed by a course of prodrug delivery in a xenograft model of human colorectal cancer. We identify the mechanisms for this efficacy and show that the oncolytic effect of the virus alone is enhanced significantly by the effects of the activated prodrug ZD2767P, resulting in DNA cross-linking, apoptosis, and bystander killing. Thus, combining the replicating virus with our GDEPT system has significant advantages over the oncolytic vector or GDEPT alone.
 |
Materials and Methods
|
|---|
Cells and adenoviruses. The replicating adenoviruses AdV.hTERT-CPG2 and AdV.hTERT have been previously described (8). Cell lines were maintained in DMEM containing 10% fetal bovine serum. Cell survival was determined using MTS assays (CellTiter96 Aqueous Nonradioactive Cell Proliferation Assay, Promega). Synthesis of ZD2767P (11), CPG2 assays (10), GDEPT, and bystander experiments (8) were done as described previously. Floating and adherent cells were pooled and analyzed by flow cytometry (14) for cell cycle studies or Annexin V FITC binding (Annexin V FITC Apoptosis Detection Kit, Calbiochem).
Western immunoblotting. We used anti-poly(ADP-ribose) polymerase (PARP; BD Biosciences PharMingen), anti-cyclin A (Ab-6, clone 6E6; Labvision Corporation), anti-cyclin E (M20), anti-cyclin D1 (M20, sc-718), anti-cyclin B1 (GNS1, sc-245), or anti-ERK2 antibodies (C14, all from Santa Cruz Biotechnology).
Comet assays. Assays were done in duplicate. Four hours after treatment, half of the cells were incubated in 100 µmol/L of H2O2 (Sigma) to induce DNA fragmentation. Olive tail moments (ref. 15; 100 for each sample) were analyzed using the CometAssay kit (Trevigen, AMS Biotechnology) and CometScore software.5
Animals. SW620 xenografts were established in female mice (Crl:CD1-Fox nu/nu, 7 x 106 cells s.c., eight animals per group; Charles River). After 6 days, PBS or adenovirus was administered into the tail vein (1011 vp/kg), following allocation to treatment groups by stratified distribution on tumor size. ZD2767P (300 mg/kg) was administered as described (16) 5 days after adenovirus therapy. Additional courses of prodrug (six doses in total) were injected at weekly intervals. Tumor volumes were calculated relative to the mean of the first measurement and plotted while at least five animals survived. Animals were culled when tumors reached 1.7 cm in any dimension or a mean of 1.5 cm in two perpendicular dimensions. P values were calculated using GraphPad Prism version 4.02 for Windows (GraphPad Software). CPG2 assays were as described (17).
Immunofluorescence. Xenografts were frozen in isopentane 5 days after the second prodrug dose (1011 vp/kg). Cryosections (5 µmol/L) were exposed to rabbit polyclonal antibody against cleaved caspase-3 (Cell Signaling) and rat monoclonal anti-CPG2 antibody (ICR hybridoma unit), followed by Alexa-Fluor 488–conjugated anti-rabbit and Alexa-Fluor 555–conjugated anti-rat secondary antibodies (Molecular Probes, Invitrogen). Nuclei were counterstained with TO-PRO-3 (Molecular Probes, Invitrogen). Samples were imaged on a Leica confocal microscope at 20x magnification using the same intensity parameters.
Real-time PCR. Adenoviral copy numbers were determined as described (8). For coxsackievirus and adenovirus receptor (CAR) detection, cDNA was synthesized from total RNA (Trizol, Invitrogen) using random nonamers (Sigma). Samples were analyzed in triplicate using the 7900 HT Fast Real-time PCR system (Applied Biosystems) and the Quantitect Probe PCR kit (Qiagen). CAR forward (mouse + human) 5'AAAGCCAAAGGGGAAACTGC, reverse (mouse) 5'TTTGTCTCCAGAATACAAAATGATCACTTGA, reverse (human) 5'TTTGTCTCCAGAATATAAAATAATCACTTGA, probe (mouse + human) 5'[6-FAM]AGTCCCGAAGACCAGGGACC[TAMRA-6-FAM]. Glyceraldehyde-3-phosphate dehydrogenase forward (mouse + human) 5'CTTCATTGACCTCAACTACA, reverse (mouse) 5'TAGACTCCACGACATACT, reverse (human) 5'TGGACTCCACGACGTACT, probe (mouse + human) 5'[6-FAM]CCCATCACCATCTTCCA[TAMRA-6-FAM]. Tumor cDNA was analyzed using human primers, murine primers were used for all other tissues.
 |
Results and Discussion
|
|---|
The telomerase reverse transcriptase gene is active in a wide range of human cancers, including colorectal carcinoma (18). Therefore, we hypothesized that the oncolytic vector AdV.hTERT-CPG2 would target colorectal carcinoma cells. The viral cytotoxicity was measured by determining the EC50 value for each cell line (Table 1
). In order to assess the suitability of the virus as a GDEPT gene delivery vector, we also measured the CPG2 enzyme activity in the cells following infection. The adenovirus was potent in all cell lines (EC50 values, 0.02–511 pfu/cell; CPG2 levels, 0.3–4.2 units/mg). There was a significant inverse correlation between EC50 values and CPG2 levels [log EC50 = –0.77 x (CPG2); P = 0.024] (Table 1). These data show that AdV.hTERT-CPG2 is an effective oncolytic vector for delivering CPG2 to colon cancer.
We selected a colon cancer cell line, SW620, which grows reproducibly as xenografts, for further study to determine the mechanism of cell death of our therapy. Cell cycle analyses showed that the adenovirus arrested SW620 cells in the S-G2-M phase (Fig. 1A
). Infection with AdV.hTERT-CPG2 altered the expression of the cell cycle regulators cyclin D1 and cyclin E, but not that of cyclin A or B1 (Fig. 1B), providing further evidence that adenoviruses trap the infected cells in S-G2-M phase, as reported by Bernt et al. (19). Next, we examined the survival of SW620 cells after GDEPT treatment. In combination with the prodrug ZD2767P, AdV.hTERT-CPG2 sensitized SW620 cells 160-fold to the prodrug, showing the antitumor cell activity of our therapy (Fig. 1C).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 1. AdV.hTERT-CPG2 is an effective vector for GDEPT. A, representative cell cycle profiles of uninfected and infected SW620 cells. AdV.hTERT-CPG2 increased the percentage of cells in the S-G2-M phase. The experiment was done in triplicate. P < 0.01, for each of the indicated cell cycle phases, compared with uninfected cells (two-tailed unpaired t test). B, Western blot analyses of cyclin expression levels in uninfected and infected SW620 cells (10 pfu/cell, 96 h after infection). AdV.hTERT-CPG2 altered the expression of cyclins D1 and E in infected cells. Equal protein loading was confirmed by probing the blots for ERK2. C, AdV.hTERT-CPG2 increased the sensitivity of SW620 cells to the prodrug ZD2767P. Uninfected cells (EC50 = 309.7 µmol/L) or cells infected with the adenovirus (0.01 pfu/cell, EC50 = 1.93 µmol/L) were treated with the prodrug and the cell viability was expressed as a percentage of untreated controls. Sigmoidal dose-response curves were fitted to the data and EC50 values were calculated using GraphPad Prism software, version 4.0a. The 95% confidence intervals did not overlap (uninfected cells, 276.1–347.5; infected cells, 1.5–2.4 pfu/cell).
|
|
For systemic cancer gene therapy in vivo, tumor-selective gene expression is crucial. Therefore, we tested adenoviral targeting in nude mice bearing SW620 xenografts. We examined CAR and found that it is expressed in a range of mouse tissues (Fig. 2A
). We also found that livers, guts, and lungs have higher CAR expression levels than tumors (Fig. 2A). Murine CAR is known to function as a receptor for human adenoviruses (20). However, when we administered AdV.hTERT-CPG2 via a single tail vein injection and measured the CPG2 activity in the tissues, we showed that the adenovirus selectively targeted CPG2 to the tumors (20.6 units/g; Fig. 2B), despite the ubiquitous presence of the CAR receptor (Fig. 2A). We detected little or no CPG2 activity (<0.07 units/g) in the brains, bone marrow, kidneys, spleens, ovaries, guts, or lungs from the animals. The two nontumoral tissues with the highest CPG2 activity levels were muscle (0.2 units/g, 102-fold less than tumors) and livers (0.7 units/g, 29-fold less than tumors). These results indicate selective targeting of AdV.hTERT-CPG2 for colon carcinoma cells in our in vivo model.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 2. Antitumor activity of AdV.hTERT-CPG2 in combination with ZD2767P. A, relative quantities of CAR mRNA in the tissues from mice bearing SW620 xenografts (real-time PCR). CAR expression was detected in all tissues. Expression levels were determined using glyceraldehyde-3-phosphate dehydrogenase as an internal standard and expressed as relative quantities compared with tumor values. Columns, means from five samples; bars, SE. For each sample, a control without reverse transcriptase was analyzed. No differences in PCR amplification efficiencies were seen when human tumor samples were analyzed using murine primers and vice versa (data not shown). B, tumor-targeting of AdV.hTERT-CPG2 in the same model. CPG2 expression in the tissues 8 days after systemic administration of AdV.hTERT-CPG2 (1012 vp/kg; tumors, P < 0.05; two-tailed t test compared with liver). Columns, means from five animals; bars, SE. C, relative tumor volumes of SW620 xenografts after systemic GDEPT treatment with AdV.hTERT-CPG2/prodrug (n = eight mice per group). AdV.hTERT-CPG2 and prodrug ( ), AdV.hTERT-CPG2 alone ( ), ZD2767P only ( ), and controls ( ). D, Kaplan-Meier analysis of the SW620 therapy. GDEPT significantly increased survival compared with controls (P < 0.02) and to AdV.hTERT.CPG2 (P < 0.02). Neither the AdVhTERT.CPG2 alone nor the prodrug alone had a significant effect on the survival compared with controls (both P > 0.05).
|
|
To test the efficacy of the GDEPT therapy in vivo, we administered the AdV.hTERT-CPG2 adenovirus systemically, followed by the prodrug ZD2767P, to nude mice bearing SW620 xenografts. In order to select the lowest optimum dose of AdV.hTERT-CPG2 for these experiments, we initially assessed three different viral dosages (1011, 3.3 x 1011, and 6.7 x 1011 vp/kg). We examined the concentration of CPG2 expressed in the tumors, livers, and plasmas at 4, 8, and 14 days after virus administration (Table 2
). Based on these results, we selected a dose of 1011 vp/kg, which gave excellent tumor/liver and tumor/plasma ratios (803:1 and 398:1, respectively, 8 days after virus administration). Neither AdV.hTERT-CPG2 nor the prodrug alone affected the growth of the xenografts, whereas this GDEPT in combination induced a significant tumor growth delay (Fig. 2C). The average body weight losses (% of initial weight ± SE) while at least five animals remained were not more than 6.2 ± 3.3 for GDEPT, 3 ± 2.1 for the adenovirus, and 5.1 ± 2.1 for the prodrug alone, compared with 4.7 ± 1.1 in the control group, indicating that the treated groups had limited or no toxicity compared with the controls. The median survival of the controls or the animals that received only the adenovirus was 52 days (Fig. 2D). ZD2767P without AdV.hTERT-CPG2 did not increase median survival (Fig. 2D). In contrast, GDEPT more than doubled the control survival to 111 days (Fig. 2D). This showed that in combination with ZD2767P, AdV.hTERT-CPG2 is effective even when virus-mediated tumor cell killing is low (Fig. 2C and D). Our data show that arming an oncolytic adenovirus with CPG2 improves its efficacy, thus allowing the use of lower viral doses and improving the safety of adenoviruses.
A consideration when engineering an oncolytic adenovirus for GDEPT is that the activated drug may inhibit viral replication. To investigate the effect of GDEPT on the replication of the adenovirus in vivo, we used quantitative real-time PCR and measured the adenoviral copy numbers in SW620 xenografts of mice that had received a single tail vein injection of AdV.hTERT-CPG2 or AdV.hTERT-CPG2 in combination with prodrug (Fig. 3A
). We detected
10 times more adenoviral particles per gram of tumor in the GDEPT-treated animals compared with the animals that had only been injected with the adenovirus (Fig. 3A). There was a correlation between the adenoviral load and CPG2 enzyme activity in the tumors; CPG2 activity levels were
3.6-fold higher in the tumors after AdV.hTERT-CPG2 plus ZD2767P treatment, compared with the adenovirus alone (Fig. 3B). Following a single injection of
2.5 x 1010 viral particles per mouse, we detected a total viral load in the tumors of 1.7 x 1011 (GDEPT) and 1.1 x 1011 particles (virus only) 8 days later, a 4-fold increase over the inoculum, proving that AdV.hTERT-CPG2 had replicated. Thus, CPG2-activated ZD2767P does not inhibit the replication of AdV.hTERT-CPG2 in vivo. Moreover, GDEPT facilitates the accumulation of the adenovirus in colon cancer xenografts. Activation of ZD2767P results in higher CPG2 expression levels from the adenovirus, which in turn results in the conversion of a larger number of prodrug molecules, providing an amplification effect. By contrast, it was reported that the vaccinia/purine nucleoside phosphorylase system abolished viral replication in the presence of the prodrug (21). Another study described the antiviral effect of the activated prodrug generated by a vaccinia vector expressing cytosine deaminase (22). Also, thymidine kinase–activated prodrug inhibited the replication of herpes simplex virus 1 vectors (23, 24), and the prodrug CB1954 was shown to block the replication of a nitroreductase-expressing oncolytic adenovirus (25). Of note, here we find that the CPG2-activated prodrug ZD2767P actually enhances the viral particle concentration in AdV.hTERT-CPG2–infected tumors with a concomitant increase in CPG2 concentration. This positive feedback can therefore increase both GDEPT and viral antitumor efficacy. To our knowledge, this advantageous cooperation between an oncolytic vector and activated prodrug has not been observed in any other GDEPT system. Thus, AdV.hTERT-CPG2 is an excellent vector for CPG2-mediated GDEPT in vivo.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 3. Mechanism of cancer cell killing by AdV.hTERT-CPG2/ZD2767P therapy. A, GDEPT cooperates with AdV.hTERT-CPG2 to facilitate viral spread. Adenoviral copy numbers in the tumors after systemic virus delivery to mice carrying SW620 xenografts. The animals received three rounds of ZD2767P or vehicle and tumors were analyzed 6 days after the last prodrug administration (*, P < 0.05, two-tailed Mann-Whitney test). B, CPG2 activity in the samples from (A; *, P < 0.05, two-tailed Mann-Whitney test). Columns, means from five animals; bars, SE. C, DNA cross-link formation in SW620 cells after GDEPT. The cells were treated with AdV.hTERT or AdV.hTERT-CPG2 as single agents (0.01 pfu/cell) or in combination with 100 µmol/L of ZD2767P (72 h after infection), and analyzed using the comet assay. Controls consisted of untreated cells, cells that received the prodrug alone or cells that were treated with the DNA cross-linking agents nitrogen mustard (100 µmol/L mechlorethamine) or cisplatin (500 µmol/L). DNA cross-links reverse the effects of H2O2-induced DNA fragmentation, resulting in little or no Olive tail increase. Results were expressed as the fold increase in Olive tail moment after H2O2-treatment compared with the untreated control. Arrows, nuclei. The experiment was done in triplicate. Columns, means of 100 cells; bars, SE; ***, P < 0.0001 (unpaired, two-tailed t test). D, GDEPT induces apoptosis. SW620 cells were analyzed by Annexin V-FITC flow cytometry (*, P < 0.05, compared with controls without prodrug; top) and Western blotting to detect PARP cleavage (equal protein loading was confirmed using an anti-ERK2 antibody; bottom). The cells were infected for 3 d (0.01 pfu/cell), 100 µmol/L of ZD2767P were added and the cells were replated 5 h later. Cell counts were expressed as the percentage of total cells. AdV.hTERT-CPG2 or ZD2767P alone did not cause apoptosis. The experiment was done in triplicate.
|
|
We examined the mechanism by which the GDEPT kills tumor cells and investigated the consequences of prodrug activation on SW620 cells using single cell gel electrophoresis "comet" assays. In untreated cells, hydrogen peroxide treatment induced DNA fragmentation, resulting in comet tails (ref. 15; Fig. 3C). The DNA cross-linking agents nitrogen mustard and cisplatin prevented the migration of the DNA from the nuclei, retarding the electrophoretic mobility and reducing the comet tails (Fig. 3C). ZD2767P alone did not induce substantial DNA cross-links in uninfected cells or cells that were infected with the nonexpressing adenovirus AdV.hTERT (Fig. 3C). Similarly, the adenoviruses alone did not affect comet tail formation (Fig. 3C). However, AdV.hTERT-CPG2 plus ZD2767P significantly reduced the comet tails, showing that the activated prodrug cross-linked the DNA (Fig. 3C). Cross-linking prevents DNA from being separated for synthesis and cell division, killing the cancer cells in S-G2-M phase, which is also when AdV.hTERT-CPG2 arrests infected cells (Fig. 1A), suggesting that both components of our therapy may cooperate (Fig. 1C).
We then tested whether GDEPT induces apoptosis in SW620 cells. We did two different apoptosis assays; loss of membrane phospholipid asymmetry and selective permeability were studied using the flow cytometric Annexin V-propidium iodide assay, whereas PARP cleavage was assessed by Western blotting. Both assays showed the induction of apoptosis following GDEPT treatment (Fig. 3D). By contrast, no evidence of apoptosis was seen in untreated cells or in cells that received either the AdV.hTERT-CPG2 adenovirus or the prodrug alone (Fig. 3D). Together, these data show that CPG2-activated ZD2767P kills human colorectal cancer cells by forming DNA cross-links and inducing apoptosis. They also indicate that the GDEPT cooperates with the replicating adenovirus to kill the tumor cells.
We next assessed the bystander effect of our AdV.hTERT-CPG2/ZD2767P therapy using mixed cultures of WM-266-4 cells, which are poorly infected by adenovirus and therefore do not express CPG2 following treatment with AdV.hTERT-CPG2 and SW620 cells, which are
800-fold more receptive to adenovirus-mediated killing and express 2.9 units/g of CPG2 following infection (Table 1). Initially, we tested whether the adenovirus alone could mediate a bystander effect. We used a viral dose that selectively lysed only the SW620 cells in the cocultures (0.2 pfu/cell). Fifty percent cell death was achieved when only 8.8% of the cells were SW620, indicating that AdV.hTERT-CPG2 could induce bystander killing on its own in the absence of prodrug (Fig. 4A
). Next, we examined the GDEPT-mediated bystander effect. We treated the WM-266-4/SW620 cocultures with low levels of AdV.hTERT-CPG2 (0.002 pfu/cell) that do not mediate a substantial viral-mediated bystander effect. Under these conditions, in the presence of ZD2767P, the GDEPT mounted a bystander effect with 50% of the cells in the culture being killed when only 9% of the cells were CPG2-expressing SW620 cells (Fig. 4B). The data suggests that the AdV.hTERT/ZD2767P therapy mounts two types of bystander effects: prodrug-mediated and virus-mediated.

View larger version (79K):
[in this window]
[in a new window]
|
Figure 4. In vivo bystander effect and apoptosis. A, virus-mediated bystander effect. SW620 and WM-266-4 cells were mixed at various proportions and infected using AdV.hTERT-CPG2 at a dose that only lysed SW620 cells (0.2 pfu/cell). Cell survival was expressed as the percentage of uninfected cells. Dashed line, prediction of cell survival in the absence of a bystander effect. Points, combined results from three experiments; bars, SE. B, GDEPT-mediated bystander effect. SW620/WM-266-4 cocultures were treated with AdV.hTERT-CPG2 (0.002 pfu/cell), followed by 50 µmol/L of ZD2767P. Under the experimental conditions used, only the SW620 cells expressed CPG2. Cell survival was determined as the percentage of infected cells that did not receive any prodrug. C, apoptosis and bystander effect in vivo. AdV.hTERT-CPG2 was administered via a single tail vein injection into mice bearing SW620 xenografts, followed by systemic ZD2767P. Detection of CPG2 (red), cleaved caspase-3 (a marker for apoptosis; green), and colocalization (yellow) in the tumors by immunofluorescent labeling.
|
|
We then examined the in vivo effect of our therapy on established tumors (Fig. 4C). We treated mice bearing SW620 xenografts systemically with AdV.hTERT-CPG2, followed by two courses of ZD2767P, and examined the expression of CPG2 and the apoptosis marker cleaved caspase-3 in the tumors by immunofluorescence. CPG2 was detected only in the tumors of animals that had received the adenovirus, but not in the controls or in the prodrug alone group (Fig. 4C). AdV.hTERT-CPG2 without prodrug did not activate caspase-3. By contrast, substantial apoptosis was seen in the tumors after GDEPT treatment (Fig. 4C). These findings confirmed the in vitro data (Fig. 3D) and showed that the oncolytic adenovirus and GDEPT kill tumor cells via different mechanisms, making it less likely for resistance to the combined treatment to develop. Notably, in GDEPT-treated tumors, we detected apoptosis in uninfected cells that did not express CPG2, showing a GDEPT-mediated bystander effect of the therapy in vivo (Fig. 4C). We have thus shown an effective GDEPT system which can selectively and systemically target CPG2 to tumors for the activation of a prodrug capable of killing cells by apoptosis and of providing a bystander effect.
 |
Acknowledgments
|
|---|
Grant support: Cancer Research UK (CR-UK) grants number C309/A2187 and C309/A8274 (S. Schepelmann, L.M. Ogilvie, D. Hedley, F. Friedlos, J. Martin, I. Scanlon, R. Marais, and C.J. Springer), and Genetic Therapy, Inc. (P. Chen).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank David Robertson, Jacky Metcalfe and Ian Titley for their help with the confocal microscopy, cell culture and flow cytometry; we also thank Paul Hallenbeck, Carl Hay (Genetic Therapy, Inc.), and Professors Paul Workman and Alex Matter for helpful discussions.
 |
Footnotes
|
|---|
Note: The basic oncolytic virus program of Genetic Therapy, Inc. was acquired by Cell Genesys, Inc., South San Francisco, California.
4 http://www.cdc.gov/cancer/colorectal/statistics 
5 http://www.autocomet.com/main_home.php 
Received 1/25/07.
Revised 3/ 5/07.
Accepted 3/15/07.
 |
References
|
|---|
- Alemany R, Balague C, Curiel DT. Replicative adenoviruses for cancer therapy. Nat Biotechnol 2000;18:723–7.[CrossRef][Medline]
- Liu TC, Galanis E, Kirn D. Clinical trial results with oncolytic virotherapy: a century of promise, a decade of progress. Nat Clin Pract Oncol 2007;4:101–17.[CrossRef][Medline]
- Reid TR, Freeman S, Post L, McCormick F, Sze DY. Effects of Onyx-015 among metastatic colorectal cancer patients that have failed prior treatment with 5-FU/leucovorin. Cancer Gene Ther 2005;12:673–81.[CrossRef][Medline]
- Jia H, Kling J. China offers alternative gateway for experimental drugs. Nat Biotechnol 2006;24:117–8.[CrossRef][Medline]
- Khuri FR, Nemunaitis J, Ganly I, et al. A controlled trial of intratumoral ONYX-015, a selectively-replicating adenovirus, in combination with cisplatin and 5-fluorouracil in patients with recurrent head and neck cancer. Nat Med 2000;6:879–85.[CrossRef][Medline]
- Reid T, Galanis E, Abbruzzese J, et al. Hepatic arterial infusion of a replication-selective oncolytic adenovirus (dl1520): phase II viral, immunologic, and clinical endpoints. Cancer Res 2002;62:6070–9.[Abstract/Free Full Text]
- Hecht JR, Bedford R, Abbruzzese JL, et al. A phase I/II trial of intratumoral endoscopic ultrasound injection of ONYX-015 with intravenous gemcitabine in unresectable pancreatic carcinoma. Clin Cancer Res 2003;9:555–61.[Abstract/Free Full Text]
- Schepelmann S, Hallenbeck P, Ogilvie LM, et al. Systemic gene-directed enzyme prodrug therapy of hepatocellular carcinoma using a targeted adenovirus armed with carboxypeptidase G2. Cancer Res 2005;65:5003–8.[Abstract/Free Full Text]
- Schepelmann S, Springer CJ. Viral vectors for gene-directed enzyme prodrug therapy. Curr Gene Ther 2006;6:647–70.[CrossRef][Medline]
- Marais R, Spooner RA, Light Y, Martin J, Springer CJ. Gene-directed enzyme prodrug therapy with a mustard prodrug/carboxypeptidase G2 combination. Cancer Res 1996;56:4735–42.[Abstract/Free Full Text]
- Springer CJ, Dowell R, Burke PJ, et al. Optimization of alkylating agent prodrugs derived from phenol and aniline mustards: a new clinical candidate prodrug (ZD2767) for antibody-directed enzyme prodrug therapy (ADEPT). J Med Chem 1995;38:5051–65.[Medline]
- Francis RJ, Sharma SK, Springer C, et al. A phase I trial of antibody directed enzyme prodrug therapy (ADEPT) in patients with advanced colorectal carcinoma or other CEA producing tumours. Br J Cancer 2002;87:600–7.[CrossRef][Medline]
- Moolten FL. Tumor chemosensitivity conferred by inserted herpes thymidine kinase genes: paradigm for a prospective cancer control strategy. Cancer Res 1986;46:5276–81.[Abstract/Free Full Text]
- Karasarides M, Chiloeches A, Hayward R, et al. B-RAF is a therapeutic target in melanoma. Oncogene 2004;23:6292–8.[CrossRef][Medline]
- Olive PL, Banath JP, Durand RE. Heterogeneity in radiation-induced DNA damage and repair in tumor and normal cells measured using the "comet" assay. Radiat Res 1990;122:86–94.[Medline]
- Friedlos F, Davies L, Scanlon I, et al. Three new prodrugs for suicide gene therapy using carboxypeptidase G2 elicit bystander efficacy in two xenograft models. Cancer Res 2002;62:1724–9.[Abstract/Free Full Text]
- Stribbling SM, Martin J, Pedley RB, Boden JA, Sharma SK, Springer CJ. Biodistribution of an antibody-enzyme conjugate for antibody-directed enzyme prodrug therapy in nude mice bearing a human colon adenocarcinoma xenograft. Cancer Chemother Pharmacol 1997;40:277–84.[CrossRef][Medline]
- Shay JW, Bacchetti SA. A survey of telomerase activity in human cancer. Eur J Cancer 1997;33:787–91.[CrossRef][Medline]
- Bernt KM, Steinwaerder DS, Ni S, Li ZY, Roffler SR, Lieber A. Enzyme-activated prodrug therapy enhances tumor-specific replication of adenovirus vectors. Cancer Res 2002;62:6089–98.[Abstract/Free Full Text]
- Bergelson JM, Krithivas A, Celi L, et al. The murine CAR homolog is a receptor for coxsackie B viruses and adenoviruses. J Virol 1998;72:415–19.[Abstract/Free Full Text]
- Puhlmann M, Gnant M, Brown CK, Alexander HR, Bartlett DL. Thymidine kinase-deleted vaccinia virus expressing purine nucleoside phosphorylase as a vector for tumor-directed gene therapy. Hum Gene Ther 1999;10:649–57.[CrossRef][Medline]
- McCart JA, Puhlmann M, Lee J, et al. Complex interactions between the replicating oncolytic effect and the enzyme/prodrug effect of vaccinia-mediated tumor regression. Gene Ther 2000;7:1217–23.[CrossRef][Medline]
- Nakamura H, Mullen JT, Chandrasekhar S, Pawlik TM, Yoon SS, Tanabe KK. Multimodality therapy with a replication-conditional herpes simplex virus 1 mutant that expresses yeast cytosine deaminase for intratumoral conversion of 5-fluorocytosine to 5-fluorouracil. Cancer Res 2001;61:5447–52.[Abstract/Free Full Text]
- Pawlik TM, Nakamura H, Mullen JT, et al. Prodrug bioactivation and oncolysis of diffuse liver metastases by a herpes simplex virus 1 mutant that expresses the CYP2B1 transgene. Cancer 2002;95:1171–81.[CrossRef][Medline]
- Chen MJ, Green NK, Reynolds GM, et al. Enhanced efficacy of Escherichia coli nitroreductase/CB1954 prodrug activation gene therapy using an E1-55K-deleted oncolytic adenovirus vector. Gene Ther 2004;11:1126–36.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
F. Friedlos, P. Lehouritis, L. Ogilvie, D. Hedley, L. Davies, D. Bermudes, I. King, J. Martin, R. Marais, and C. J. Springer
Attenuated Salmonella Targets Prodrug Activating Enzyme Carboxypeptidase G2 to Mouse Melanoma and Human Breast and Colon Carcinomas for Effective Suicide Gene Therapy
Clin. Cancer Res.,
July 1, 2008;
14(13):
4259 - 4266.
[Abstract]
[Full Text]
[PDF]
|
 |
|