| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
1 Huck Institutes of the Life Sciences and 2 Department of Bioengineering, The Pennsylvania State University, University Park, Pennsylvania; Departments of 3 Pharmacology, 4 Pathology, and 5 Dermatology, The Pennsylvania State University College of Medicine; 6 The Foreman Foundation for Melanoma Research; and 7 The Penn State Melanoma Therapeutics Program, Hershey, Pennsylvania
Requests for reprints: Cheng Dong, Department of Bioengineering, The Pennsylvania State University, 233 Hallowell Building, University Park, PA 16802. Phone: 814-865-8091; Fax: 814-863-0490; E-mail: cxd23{at}psu.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
60% of melanomas (14). B-Raf encodes a RAS-regulated kinase that mediates cell growth and malignant transformation (5). B-Raf mutation is implicated in constitutive activation and hyperactivation of downstream proteins in the signaling cascade that promotes melanoma adhesion, migration, and proliferation (1, 4, 6, 7).
Melanoma metastasis requires that tumor cells detach from a primary site and invade the surrounding stroma, survive immune defenses and turbulence of the blood circulation after invading into the circulatory system, extravasate through the endothelial lining of blood vessels, and finally form a new colony in the surrounding tissue. Human polymorphonuclear neutrophils (PMN), which compose 50% to 70% of circulating leukocytes, have been shown under certain circumstances to promote tumor adhesion and transendothelial extravasation (8, 9). Miele et al. (10) reported that a dose- and time-dependent increase in surface expression of intercellular adhesion molecule-1 (ICAM-1) was found in human malignant melanoma cells. Furthermore, binding between ICAM-1 on malignant melanoma cells and ß2 integrins (e.g., CD11a/CD18, LFA-1 and CD11b/CD18, Mac-1) found on PMNs mediates melanoma extravasation through the endothelium (Fig. 1
; refs. 11, 12). Endogenous interleukin 8 (IL-8) secreted by melanoma cells also increases ß2 integrin expression on PMNs and modulates PMN-facilitated melanoma extravasation (12). IL-8 protein production requires the activation of nuclear transcription factor
B (NF-
B), NF-IL-6 (C/EBP), or activator protein-1 (13, 14). However, little is known about the regulation of IL-8 production and of interactions between PMN and melanoma by mutant V600EB-Raf in melanoma cells, which may, in turn, influence melanoma extravasation.
|
| Materials and Methods |
|---|
|
|
|---|
Use of PMNs was approved by the Pennsylvania State University Institutional Review Board (#19311). Fresh human blood was collected from healthy adults by venipuncture. PMNs were isolated using a Histopaque (Sigma) density gradient as described by the manufacturer and kept at 4°C in Dulbecco's PBS containing 0.1% human serum albumin until use. Cell preparations were 99.5% pure PMNs, confirmed by a Diff-Quick stain (Dade Behring, Inc.). In the cases of PMN and melanoma cell coculture, PMNs resuspended in RPMI 1640 supplemented with 5% FBS were added onto the confluent melanoma cell lines (1:1 ratio) directly and cocultured for 4 h. Ninety-five percent melanoma cells stay alive after 4-h contact culture with PMNs (data not shown).
In vitro and in vivo siRNA studies. SiRNA (100 pmol) was introduced into 1 x 106 1205 Lu or UACC 903M via nucleofection with an Amaxa Nucleofector using Solution R/program K-17 as previously described (15). The resultant transfection efficiency following nucleofection was >90% (15) and knockdown of mutant V600EB-Raf protein in 1205 Lu and UACC 903M melanoma cells persisted beyond 8 days in culture compared with control cells nucleofected with scrambled siRNA (18). Specificity of using this siRNA approach to knock down mutant V600EB-Raf has previously been described (18, 19). Duplexed stealth siRNA (Invitrogen) was used for these studies. The sequence for each respective siRNA is as follows: scrambled siRNA, AAUUCUCCGAACGUGUCACGUGAGA; MUT B-Raf, GGUCUAGCUACAGAGAAAUCUCGAU; scrambled siRNA for ICAM-1, GCTGTGCACGTATGAGATA; ICAM-1, GCTGACGTGTGCAGTAATA.
Animal experimentation was done according to protocols approved by the Institutional Animal Care and Use Committee at The Pennsylvania State University College of Medicine. SiRNA (100 pmol) was nucleofected into GFP-tagged 1205 Lu or UACC 903M cells, which were then replated in culture dishes. Thirty-six hours later, 1 x 106 of 1205 Lu or 0.5 x 106 of UACC 903M in 0.2-mL HBSS were injected i.v. into the lateral tail veins of nude mice. The effect of siRNA knockdown in melanoma xenograft module can last up to day 17.5 (19). Mice were sacrificed 17 days later and lungs were analyzed for the presence of fluorescent tumors using a Nikon SMZ 1500 dissecting microscope with a Plan Apo 1.6x objective and fluorescence detection capabilities. Images of five random fields were photographed at a magnification of x4.8 from the ventral surface of each lung and the number of fluorescent tumors as well as area scored in pixels occupied by each tumor was quantified using IP lab imaging software (Scanalytics). Duplicate experiments consisting of eight animals were used per group.
Colocalization of mouse PMN and human melanoma cell line. Colocalization of mouse PMNs and human melanoma cells in lungs was used to verify interactions between cells and provide evidence of tethering of melanoma cells to the endothelium lining mediated by PMNs. Briefly, 1 x 106 GFP-tagged human metastatic melanoma cells (1205 Lu) in 0.2 mL of HBSS were injected i.v. into the lateral tail veins of nude mice. After 24 h, phycoerythrin-conjugated rat anti-mouse Gr-1 monoclonal antibody (BD PharMingen) at a concentration of 1 mg/kg of body weight in 100-µL PBS was injected i.v. into the lateral tail veins of mice. Mice were sacrificed 2 h later and lungs analyzed using a Nikon SMZ 1500 dissecting microscope with fluorescence detection capabilities.
ELISA determination. At the end of coculture assays, cell-free supernatants were collected by centrifugation at 430 x g for 5 min and IL-8 was quantified by a sandwich ELISA following standard protocols. Primary and secondary antibody pairs were obtained from R&D Systems. Standard human recombinant IL-8 was also obtained from R&D Systems and a standard curve was included in each ELISA plate. Plates were read on a Packard Spectracount at 405 nm and the data analyzed using I-Smart Software. Intra-assay variation was typically 10% to 15%.
Flow migration assay. Flow migration assay was measured in a modified 48-well chemotactic Boyden chamber consisting of a top and bottom plate separated by a gasket (8, 20). Before each experiment, a monolayer of EI cells was grown (typically 36 h after cell seeding) on sterile polyvinylpyrrolidone-free polycarbonate filters (8 µm pore size; NeuroProbe) precoated with fibronectin (30 µg/mL, 3 h; Sigma). The center 12 wells of bottom plate were filled with soluble chemoattractant type IV collagen [100 µg/mL in RPMI 1640/0.1% bovine serum albumin (BSA); BD Biosciences] and surrounding control wells were filled with medium (RPMI 1640/0.1% BSA). Studies have shown that melanoma cells express
2ß1 integrin receptors for soluble collagen IV protein and migrate toward collagen IV stimulation (21, 22). Apparatus was assembled by placing filter on bottom plate followed by addition of a sealing gasket and top plate. The chamber was primed with 37°C medium to eliminate bubbles in the system. For migration assay, 5 x 105 melanoma cells only or PMNs together with melanoma cells (5 x 105 of each) were put in the chamber either under static conditions or under shear flow conditions for 4 h in a 37°C, 5% CO2 incubator. To quantify migration, migrated cells were stained with Protocol Brand Hema3 solution (Fisher Scientific) and counted using an inverted microscope (Diaphot 330, Nikon) with NIH Image software (v. ß4.0.2).
Electromobility shift assay. Nuclear extracts were prepared by lysing 106 cells with 10% NP40 in buffer A [10 mmol/L HEPES (pH 7.9), 10 mmol/L KCl, 0.1 mmol/L EDTA, 0.1 mmol/L EGTA, 1 mmol/L DTT, 0.5 mmol/L phenylmethylsulfonyl fluoride (PMSF)] for 15 min. Cells were then spun to separate nuclei from cytoplasmic component. Nuclear pellet was resuspended in buffer C [20 mmol/L HEPES (pH 7.9), 0.4 mol/L NaCl, 1 mmol/L EDTA, 1 mmol/L EGTA, 1 mmol/L DTT, 1 mmol/L PMSF] for 15 min. Annealed NF-
B binding site oligonucleotides (5'-AGCTAAGGGACTTTCCGCTGGGGACTTTCCAGG-3' and 5'-AGCTCCTGGAAAGTCCCCAGCGGAAAGTCCCTT-3') were end-filled with [
-32P]dCTP using bacterial Klenow fragment (Promega). The DNA probe was incubated with nuclear extracts in a reaction mixture containing dI-dC (GE Healthcare), 0.25 mol/L HEPES (pH 7.5), 0.6 mol/L KCl, 9% glycerol, 1 mmol/L EDTA, 0.75 mol/L DTT, and 50 mmol/L MgCl2 for 30 min at room temperature. A total of 0.5 µg of anti-p50 or anti-p65 (NF-
B, Santa Cruz Biotechnology) was added to the reaction mixture during the 30-min incubation to supershift complexes. The incubation mixtures were run on a 6% polyacrylamide gel at 130 V and the gel was dried and photographed.
Statistics. All results were shown as mean ± SE unless otherwise stated. Student's t test was used for pairwise comparisons and ANOVA was used for groupwise comparisons, followed by the appropriate post hoc test (Dunnett's, Tukey's, or Dunn's). Results were considered significant at P < 0.05.
| Results |
|---|
|
|
|---|
|
13% melanoma cells and mouse PMNs were colocalized together, indicating that mouse PMNs are also facilitating melanoma cell adhesion to the endothelium, which could promote extravasation and thus metastases.
Inhibiting mutant V600EB-Raf reduced melanoma cell extravasation. Melanoma cell lung metastasis in vivo requires adhesion to and subsequent extravasation through the endothelial lining of lung vessels (23). To evaluate the role of mutant V600EB-Raf in facilitating melanoma extravasation, 1205 Lu cell extravasation was tested using an in vitro flow migration model (Fig. 3
). Under static condition, melanoma only (without PMNs) migration was reduced by 25% following mutant V600EB-Raf inhibition (Fig. 3A). Under flow conditions of 4 dyn/cm2 when PMNs were not present, very few migrations of melanoma cells were observed and there were no migratory differences between control cells and those in which mutant V600EB-Raf had been inhibited (Fig. 3B, Neutrophil). Previous studies have shown that PMNs facilitated melanoma adhesion and subsequent extravasation through an endothelial-like cell monolayer (8, 11, 12, 20). Our results confirmed that PMNs promoted 1205 Lu melanoma cell migration under flow conditions of 4 dyn/cm2 (Fig. 3B, +Neutrophil) compared with melanoma cells alone (Fig. 3B, Neutrophil). Furthermore, inhibition of mutant V600EB-Raf significantly retarded PMN-mediated melanoma cell extravasation by
2-fold under flow conditions (Fig. 3B, +Neutrophil), indicating that inhibition of mutant V600EB-Raf may affect interactions between PMNs and melanoma cells. These data showed that inhibition of mutant V600EB-Raf significantly retards melanoma extravasation across the endothelial-like cell monolayer, suggesting one potential mechanism for regulating metastasis development.
|
500 pg/mL/105 cells (Fig. 4A
). However, inhibition of mutant V600EB-Raf resulted in
2-fold less IL-8 production (Fig. 4A). In addition, IL-8 production from the melanoma-PMN microenvironment was also inhibited after knockdown of mutant V600EB-Raf. Results showed that, following coculture of PMN and control melanoma cells, IL-8 production increased
1.5-fold compared with the summed background levels of melanoma and PMN cultured alone (Fig. 4B). In contrast, approximately equivalent or slightly reduced levels of IL-8 were detected in the cocultures between PMN and melanoma cells (1205 Lu or UACC 903M) nucleofected with siRNA targeting mutant V600EB-Raf (Fig. 4B). These data suggest that knockdown of mutant V600EB-Raf significantly reduced IL-8 production from melanoma cells alone and reduced the capacity of IL-8 production from the tumor microenvironment involving the immune system.
|
|
2-fold following coculture with control melanoma cells (Fig. 5C). In contrast, in the cases of PMN cocultured with 1205 Lu cells following inhibition of mutant V600EB-Raf, Mac-1 expression on PMNs was unchanged and significantly less than controls (Fig. 5C). Collectively, these data indicated that knockdown of mutant V600EB-Raf inhibited ICAM-1 expression on the surface of melanoma cells as well as Mac-1 up-regulation on PMNs after PMN-melanoma coculture, which in turn retarded PMN-facilitated melanoma extravasation through disruption of ICAM-1-ß2 integrin binding.
Disruption of NF-
B activity following inhibition of mutant V600EB-Raf reduced IL-8 levels and ICAM-1 expression. IL-8 protein production requires the activation of nuclear NF-
B (13, 14). NF-
B has also been reported to induce ICAM-1 expression on melanoma cells (27). Previous studies have implicated Raf kinases in NF-
B signaling (14, 28). To investigate whether inhibition of mutant V600EB-Raf disrupts NF-
B signaling, thereby reducing IL-8 production from melanoma cells and ICAM-1 expression on melanoma cells, electromobility shift assay was used to measure NF-
B expression in 1205 Lu. Results indicate that NF-
B expression was reduced by
50% following inhibition of mutant V600EB-Raf (Fig. 6A
). To further evaluate the role played by NF-
B in IL-8 production, 1205 Lu were pretreated with pyrrolidinedithiocarbamate (100 µmol/L; Calbiochem), a NF-
B inhibitor, for 1 h and IL-8 production was measured by ELISA. Results showed that IL-8 levels decreased significantly compared with untreated control (Fig. 6B). In addition, ICAM-1 expression on melanoma cells after pyrrolidinedithiocarbamate treatment was also reduced compared with untreated control (Fig. 6B). Together, these results suggest that interruption of downstream NF-
B signaling following inhibition of mutant V600EB-Raf reduced IL-8 production and ICAM-1 expression from melanoma cells to decrease melanoma extravasation.
|
| Discussion |
|---|
|
|
|---|
The extravasation of melanoma cells was significantly reduced under static conditions following inhibition of mutant V600EB-Raf. A previous study has shown that melanoma cell migration to type IV collagen under static condition requires activation of NF-
B (29). We now show that NF-
B activation in melanoma cells is reduced after inhibition of mutant V600EB-Raf, indicating a potential mechanism for reduced extravasation under static conditions. This observation is supported by previous studies showing that mutant V600EB-Raf renders the mitogen-activated protein pathway constitutively active, thereby eliciting constant activation of downstream signaling components and the corresponding transcription factor substrates including NF-
B (30, 31). Cancer metastasis happens when extravasated cells proliferate and form secondary tumors (32). Our in vitro proliferation experiments showed reduced growth of melanoma cells after knockdown of mutant V600EB-Raf (data not shown). Therefore, besides the interruption of extravasation after inhibition of the mutant V600EB-Raf, the decreased proliferation of extravasated cells may also contribute to inhibition of metastasis.
Chemokines or cytokines secreted by tumor cells and/or PMN play important roles in communication between melanomas and PMN. Therefore, disruption of the signals between these cell types could be used for therapeutic advantages (33). IL-8 expression in human melanoma cells correlates with the level of anoxia and the aggressiveness of the melanoma (34). Induction of transcription of IL-8 in these anoxic tumor areas is dependent on NF-
B activity (35). Consistent with these reports, our results showed that IL-8 secretion from melanoma cells decreased after inhibition of NF-
B. Our results also indicate that knockdown of mutant V600EB-Raf significantly decreased the production of IL-8 from melanoma cells alone. It is possible to attribute this observation to the disruption of NF-
B signaling after inhibition of mutant V600EB-Raf. In support of this possibility, mutant forms of B-Raf have been reported to be able to activate NF-
B signaling (30). Furthermore, our results indicate that coculture of PMNs and control melanoma cells increased IL-8 production; however, IL-8 production after coculture of PMNs and melanoma following inhibition of mutant V600EB-Raf was unchanged or even reduced. Previous studies have found that endogenously secreted IL-8 from melanoma cells induced an increase in IL-8 production from PMN after coculture of PMNs and melanoma cells (36). Therefore, reduced IL-8 secretion from melanoma-PMN microenvironment after inhibition of mutant V600EB-Raf could be attributed to both reduced IL-8 production from melanoma cells and reduced IL-8 from PMN due to the reduced amount of IL-8 from melanoma cells.
Previous studies have investigated the role of PMNs in mediating melanoma cell adhesion to and extravasation through an endothelial cell layer under flow conditions (8, 11). Studies also showed that binding between ICAM-1 on melanoma and ß2 integrin on PMN is essential for this process. In this study, results showed that inhibition of mutant V600EB-Raf in melanoma reduced PMN-facilitated melanoma migration significantly. Potential mechanisms were investigated and we found that ICAM-1 expression on melanoma cells was reduced after treatment with siRNA against mutant V600EB-Raf. A possible mechanism causing reduced ICAM-1 expression could be disruption of NF-
B signaling after inhibition of mutant V600EB-Raf. In support of this possibility, NF-
B has been reported to facilitate tumor invasion and metastasis by inducing expression of ICAM-1 on melanoma cells (27). Our results also confirmed that inhibition of NF-
B reduced ICAM-1 expression on melanoma cells. In addition, we have shown that PMN-melanoma coculture can increase Mac-1 expression on PMNs, which was inhibited after knockdown of mutant V600EB-Raf. It has also been reported that IL-8 could trigger the functional up-regulation of the ligand binding activity of the ß2 integrins, Mac-1 in particular, on PMNs (25, 37). Our results show reduced IL-8 from PMN-melanoma cocultures following inhibition of mutant V600EB-Raf, possibly explaining the mechanism for reduced Mac-1 expression on PMN after coculture with melanoma following inhibition of mutant V600EB-Raf. Collectively, those data indicate one mechanism of reduced melanoma extravasation under flow conditions after mutant V600EB-Raf inhibition, which is through interruption of the ICAM-1/ß2 integrin binding mechanism necessary for PMN-facilitated melanoma extravasation.
In conclusion, we showed that targeting mutant V600EB-Raf reduces melanoma metastasis, which is mediated through reduction of melanoma cell extravasation through the endothelium. Mechanistically, reduced melanoma extravasation following inhibition of mutant V600EB-Raf is due to the disruption of downstream NF-
B signaling that causes reduced endogenous IL-8 production and the disruption of ICAM-1/ß2 integrin binding that is essential for PMN-facilitated melanoma extravasation. Therefore, this study suggests that targeting mutant V600EB-Raf signaling may offer a potential mechanism for therapeutic inhibition of NF-
B functioning in melanoma.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 11/16/06. Revised 3/21/07. Accepted 4/13/07.
| References |
|---|
|
|
|---|
B-inducing kinase-MAPK signaling pathway up-regulates NF-
B activity in melanoma cells. J Biol Chem 2002;277:79208.
B, chemokine gene transcription and tumor growth. Nat Rev Immunol 2002;2:66474.[CrossRef][Medline]
-mediated induction of intercellular adhesion molecule-1 is inhibited by dexamethasone. J Biol Chem 1994;269:618592.
B by memebrane shuttle kinase MEKK1, a signaling pathway critical for transformation. Proc Natl Acad Sci U S A 2000;97:461520.
B. Oncogene 2003;22:98108.[CrossRef][Medline]
B pathway and cellular transformation. Cancer Res 2004;64:342835.
B RelA transcription factor is consititutively activated in human pancreatic adenocarcinoma cells. Clin Cancer Res 1999;5:11927.This article has been cited by other articles:
![]() |
S. Liang and C. Dong Integrin VLA-4 enhances sialyl-Lewisx/a-negative melanoma adhesion to and extravasation through the endothelium under low flow conditions Am J Physiol Cell Physiol, September 1, 2008; 295(3): C701 - C707. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liang, C. Fu, D. Wagner, H. Guo, D. Zhan, C. Dong, and M. Long Two-dimensional kinetics of {beta}2-integrin and ICAM-1 bindings between neutrophils and melanoma cells in a shear flow Am J Physiol Cell Physiol, March 1, 2008; 294(3): C743 - C753. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Madhunapantula and G. P. Robertson Is B-Raf a Good Therapeutic Target for Melanoma and Other Malignancies? Cancer Res., January 1, 2008; 68(1): 5 - 8. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |