Cancer Research Cell Death Mechanisms and Cancer Therapy  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 67, 6155, July 1, 2007. doi: 10.1158/0008-5472.CAN-05-4431
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Valenzuela, H. F.
Right arrow Articles by Baum, L. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Valenzuela, H. F.
Right arrow Articles by Baum, L. G.

Cell, Tumor, and Stem Cell Biology

O-Glycosylation Regulates LNCaP Prostate Cancer Cell Susceptibility to Apoptosis Induced by Galectin-1

Hector F. Valenzuela1, Karen E. Pace1, Paula V. Cabrera1, Rachel White1, Katja Porvari3, Helena Kaija3, Pirkko Vihko3,4 and Linda G. Baum1,2

1 Department of Pathology and 2 Jonsson Comprehensive Cancer Center, School of Medicine, University of California at Los Angeles, Los Angeles, California; 3 Research Center for Molecular Endocrinology and WHO CCR, Biocenter Oulu, University of Oulu, Oulu, Finland; and 4 Department of Biological and Environmental Sciences, Division of Biochemistry, University of Helsinki, Helsinki, Finland

Requests for reprints: Linda G. Baum, Department of Pathology and Laboratory Medicine, School of Medicine, University of California at Los Angeles, 10833 LeConte Avenue, Los Angeles, CA 90095-1732. Phone: 310-206-5985; E-mail: lbaum{at}mednet.ucla.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Resistance to apoptosis is a critical feature of neoplastic cells. Galectin-1 is an endogenous carbohydrate-binding protein that induces death of leukemia and lymphoma cells, breast cancer cells, and the LNCaP prostate cancer cell line, but not other prostate cancer cell lines. To understand the mechanism of galectin-1 sensitivity of LNCaP cells compared with other prostate cancer cells, we characterized glycan ligands that are important for conferring galectin-1 sensitivity in these cells, and analyzed expression of glycosyltransferase genes in galectin-1–sensitive, prostate-specific antigen–positive (PSA+) LNCaP cells compared with a galectin-1–resistant PSA LNCaP subclone. We identified one glycosyltransferase, core 2 N-acetylglucosaminyltransferase, which is down-regulated in galectin-1–resistant PSA LNCaP cells compared with galectin-1–sensitive PSA+ LNCaP cells. Intriguingly, this is the same glycosyltransferase required for galectin-1 susceptibility of T lymphoma cells, indicating that similar O-glycan ligands on different polypeptide backbones may be common death trigger receptors recognized by galectin-1 on different types of cancer cells. Blocking O-glycan elongation by expressing {alpha}2,3-sialyltransferase 1 rendered LNCaP cells resistant to galectin-1, showing that specific O-glycans are critical for galectin-1 susceptibility. Loss of galectin-1 susceptibility and synthesis of endogenous galectin-1 has been proposed to promote tumor evasion of immune attack; we found that galectin-1–expressing prostate cancer cells killed bound T cells, whereas LNCaP cells that do not express galectin-1 did not kill T cells. Resistance to galectin-1–induced apoptosis may directly contribute to the survival of prostate cancer cells as well as promote immune evasion by the tumor. [Cancer Res 2007;67(13):6155–62]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Specific alterations in the glycosylation pattern of cell-surface glycoproteins and glycolipids occur during cellular transformation and tumor progression (16). These novel "glyco-epitopes" are proposed to facilitate tumor progression by several mechanisms, which include promoting cellular detachment from basement membrane and migration to sites of metastasis, masking of tumor cells to avoid an immune response, and protecting tumor cells from endogenous inducers of apoptosis (1, 5, 7, 8).

Altered tumor cell glycosylation as well as changes in expression of glycan-binding lectins by tumor cells and stroma has been described in prostate cancer, the most common cancer in men and the second highest cause of cancer deaths in Western society (3, 4, 917). Changes in prostate cancer cell glycosylation have been proposed to affect prostate cancer cell growth, invasion and metastasis, and progression to androgen independence. For example, prostate-specific antigen (PSA) from cancer patients typically bears increased levels of {alpha}2,3-linked sialic acid compared with PSA from patients with benign prostatic hyperplasia (18). Similarly, the tumor cell-surface glycoprotein prostate mucin antigen, which bears abundant O-glycans, is expressed on prostate tumor cells but not on normal prostate cells (19). O-Glycans on prostate cancer cells often bear the Tn antigen (GalNAc-O-Ser/Thr), a glyco-epitope that has been proposed as a target for tumor immunotherapy (20), and the T antigen on O-glycans (Galß1,3GalNAc) plays a role in prostate cancer cell adhesion to endothelium (21).

Several members of the galectin family of lectins are aberrantly expressed in prostate cancer and have been implicated in the process of prostate cancer progression (917, 2126). Galectins are soluble carbohydrate-binding proteins that can remain intracellular, where they regulate cell signaling and cell survival, or can be secreted via a nonclassic pathway to mediate cell-cell and cell-matrix interactions (27). Galectin-8, also known as prostate carcinoma tumor antigen 1, is selectively expressed in prostate carcinoma, compared with normal or benign hyperplastic prostate (16, 17). As galectin-8 modulates cell adhesion to extracellular matrix proteins such as fibronectin, galectin-8 may be involved in tumor cell invasion. Galectin-3 is proposed to have both intracellular and extracellular functions in prostate cancer. Cytoplasmic galectin-3 promotes prostate cancer cell resistance to apoptosis, anchorage-independent growth, and invasion into extracellular matrix, whereas extracellular galectin-3 mediates prostate cell attachment to endothelial cells (912, 2125).

Galectin-1 acts extracellularly to induce apoptosis of normal and transformed T lymphocytes, as well as breast and trophoblast tumor cells (27, 28). Whereas specific types of cell-surface glycosylation are known to create or mask the glycan ligands required for galectin-1–induced T-lymphocyte cell death (8, 2931), nothing is known about features of cell-surface glycosylation that regulate epithelial cancer cell susceptibility to galectin-1. Expression of galectin-1 by LNCaP prostate cancer cells, either by treatment with sodium butyrate or transfection with rat galectin-1 cDNA, induced apoptosis of this cell line, although these studies did not examine secretion of galectin-1 by the LNCaP cells, nor were glycan ligands for galectin-1 characterized (26). In contrast, the prostate cancer cell lines DU145 and PC-3 synthesize and secrete abundant galectin-1, implying that these cell lines are resistant to death triggered by galectin-1 (25). Similarly, a PSA LNCaP subclone showed a >25-fold increase in expression of galectin-1 mRNA and increased expression of galectin-1 protein, compared with androgen-dependent PSA+ LNCaP cells (32, 33). Because loss of PSA expression is correlated with progression to a more aggressive tumor, the robust expression of galectin-1 by PSA LNCaP cells suggested a correlation between increasing galectin-1 expression and prostate cancer cell progression. Similarly, Castronovo and colleagues have found that increasing expression of galectin-1 in prostate tumor stroma correlates with tumor aggressiveness and poor prognosis in prostate cancer patients, implying that tumor cell acquisition of resistance to galectin-1–induced cell death confers a selective advantage to tumor cells that can evade galectin-1–induced cell death (14). Moreover, recent work in a murine melanoma model showed that melanoma expression of galectin-1 induced death of infiltrating T cells, whereas suppression of tumor cell expression of galectin-1 enhanced CD8 T-cell attack of the tumor (34). We have directly shown that galectin-1 in extracellular matrix can kill infiltrating T cells (35). Thus, resistance to galectin-1 apoptosis may enhance prostate cancer cell metastasis as well as evasion of an immune response.

As mentioned above, the specific glycan ligands bound by galectin-1 to trigger cell death have not been identified in prostate cancer cells. In the present study, we identify a specific glycan structure required for galectin-1 to induce death of LNCaP cells. Importantly, this glycan ligand on LNCaP cells that is required for susceptibility to galectin-1–induced cell death is the same structure required for T-cell susceptibility to galectin-1 (29, 30); as prostate cancer cells do not express the T-cell glycoprotein receptors that participate in galectin-1–induced cell death (CD45, CD43, and CD7; refs. 30, 36, 37), these data indicate that galectin-1–induced death of epithelial and mesenchymal cells involves a common saccharide ligand that can be attached to different polypeptide backbones on different cell types. Finally, we find that prostate cancer cells expressing galectin-1 are potent inducers of T-cell apoptosis, supporting the model that galectin-1 expression by tumor cells promotes evasion of an immune response (34, 35, 38).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines. The human prostate cell lines LNCaP, PC-3, and DU145 and the human T-cell line CEM were obtained from the American Type Culture Collection. CEM, LNCaP, and the PSA+ and PSA LNCaP subclones (32) were grown in 100 x 20 mm tissue culture dishes in 10-mL RPMI 1640 supplemented with 10% fetal bovine serum (FBS), 100 mg/mL streptomycin, and 100 units/mL penicillin. DU145 was grown in DMEM with 10% FBS and PC-3 was grown in Ham's F12K medium with 7% FBS (Life Technologies, Inc.). Cells were maintained in a humidified incubator at 37°C with 5% CO2.

Galectin-1 detection. For immunofluorescence microscopy, LNCaP, DU145, and PC-3 were grown for 48 h on glass coverslips until 50% confluent. Cells were fixed with 2% paraformaldehyde in PBS for 30 min on ice, washed with PBS, stained with polyclonal rabbit anti-human galectin-1 antibody (1:500), and bound antibody was detected with fluorescein-conjugated goat anti-rabbit immunoglobulin G (IgG; 1:300; Jackson Immunochemical) exactly as previously described (30). Slides were analyzed using an Axioskop 2 plus microscope and Axiovision 3.1 software (Zeiss).

For immunoblotting, subconfluent monolayers of prostate cells were removed from plates with PBS-EDTA (5 mmol/L). Cells were lysed in lysis buffer (50 mmol/L Tris-Cl, 1% NP40, 5 mmol/L EDTA, 1 mmol/L phenylmethylsulfonyl fluoride, 10 µg/mL aprotinin, 10 µg/mL leupeptin, 150 mmol/L NaCl) for 30 min on ice, samples centrifuged to pellet nuclei, and protein concentrations of the supernatants determined by Bio-Rad Protein Assay (Bio-Rad). Equal amounts of total cell protein (20 µg/lane) were separated by SDS-PAGE and transferred to nitrocellulose membranes; membranes were blocked with 10% nonfat milk and incubated overnight at 4°C with rabbit polyclonal antibody to galectin-1 (1:1,000). Membranes were washed in TBS with 0.5% Tween and incubated with horseradish peroxidase–conjugated goat anti-rabbit reagent (1:1,000; Bio-Rad). Samples were visualized with Hyperfilm enhanced chemiluminescence (Amersham). To detect equal loading, blots were stripped and reprobed with anti-actin (1:5,000; Sigma-Aldrich).

ELISA quantification of cell-surface galectin-1 was done exactly as in ref. 35, with 0.02 x 106 to 2 x 106 of the indicated cells added per well, using anti–galectin-1 IgG purified from rabbit polyclonal antiserum to galectin-1. Galectin-1 concentration was determined based on a standard curve using purified recombinant galectin-1.

Galectin-1 prostate cell death assays. Subconfluent monolayers of prostate cell lines grown in 35-mm six-well plates were treated with 20 µmol/L galectin-1 in a final volume of 2-mL PBS with 1.2 mmol/L DTT for 5 h at 37°C. Control samples included cells treated with PBS/1.2 mmol/L DTT only (galectin-1 buffer control) and cells treated with 100 mmol/L lactose for 5 min before galectin-1 to show saccharide-specific galectin-1–induced cell death. The supernatant was removed and adherent cells were treated with 2 mL of 0.25% trypsin-EDTA (Life Technologies) and collected with a plastic scraper, resuspended by gentle pipetting in PBS, and labeled by terminal deoxynucleotide dUTP nick end labeling (TUNEL) using the APO-DIRECT kit (PharMingen). Data were acquired on a FACScan flow cytometer (Becton Dickinson) to detect FITC-labeled DNA and analysis was done with CellQuest software. Single cells were discriminated by analysis of DNA width versus DNA area, and only single cells were analyzed for TUNEL labeling.

Flow cytometric analysis of cellular glycosylation. Subconfluent LNCaP cells were treated with 2 mmol/L benzyl-{alpha}-N-acetylgalactosamine (benzyl-{alpha}-GalNAc) in ethanol, with 25 µmol/L deoxymannojirimycin (DMNJ) dissolved in media (Calbiochem), or with appropriate buffer controls for 72 h at 37°C. Cells were resuspended with PBS-EDTA and washed with PBS. LNCaP cells (1 x 106) were stained with 5 µL (1 mg/mL) of biotin-conjugated peanut agglutinin (PNA) or phytohemagglutinin (PHA) lectins (EY Laboratories) for 30 min on ice. Cells were washed and bound lectin was detected with phycoerythrin-conjugated streptavidin for 20 min on ice. Cells were washed and analyzed by flow cytometry. Data were acquired using a FACScan flow cytometer and analyzed with CellQuest software.

Analysis of glycosyltransferase gene expression in PSA+ and PSA LNCaP cells. Microarray analysis of differentially expressed genes in two LNCaP-derived prostate cancer cell lines was previously described (32). To validate differences in expression of the core 2 ß1,6-N-acetylglucosaminyltransferase (core 2 GnT) in the two cell lines, reverse transcription-PCR (RT-PCR) analysis was done. Briefly, RNA was isolated using Qiagen RNA isolation kit (Qiagen) and RT-PCR was done according to the protocol provided in the SuperScript One-Step RT-PCR with Platinum Taq (Invitrogen) using core 2 GnT forward (GCAATGAGTGCAAACTGGAAG) and core 2 GnT reverse (AATTGCCCGTAATGGTCAGTGTT) primers. Core 2 GnT RT-PCR products were quantified by spectrophotometric analysis (Ultraspec 2000, Pharmacia Biotech) on dilutions done until a linear range of product was observed. Values were normalized by comparison to expression of ß-actin (forward primer GCTCGTCGTCGACAACGGCTC and reverse primer CAAACATGATCTGGGTCATCTTCT).

Expression of ß-galactoside {alpha}2,3-sialyltransferase 1 in LNCaP cells. ß-Galactoside {alpha}2,3-sialyltransferase 1 (ST3Gal1) cDNA (ref. 39; gift of Dr. James Paulson, The Scripps Research Institute, La Jolla, CA) was subcloned into pcDNA3.1 (Invitrogen; pST3). Subconfluent monolayers of LNCaP cells were grown for 5 days before transfection in Opti-MEM I media (Life Technologies). Each 100-mm dish was transfected with 16.7 µg of pST3 or vector alone (control) in Lipofectin reagent (Life Technologies) following the manufacturer's protocol. Transfected cells were selected by culture in media with G418 (100 µmol/L; Life Technologies) for 3 days.

Prostate cell induction of T-cell death. CEM T cells (106; >98% viable by trypan blue exclusion) in RPMI were added to confluent monolayers of the indicated prostate cell lines for 8 h at 37°C. Plates were vigorously washed by pipetting with PBS or with 0.1 mol/L lactose in PBS to recover T cells. The recovered cells were washed with PBS and assayed by flow cytometric detection of TUNEL labeling (described above) to detect T-cell death. Forward versus side scatter analysis of the cells was used to discriminate T cells from any nonadherent prostate cells that were removed during the wash step; nonadherent prostate cells were <5% of total cells analyzed in all experiments. As a positive control for T-cell death, 106 CEM cells were treated with 20 µmol/L recombinant human galectin-1 or buffer alone. Data were acquired using a FACScan flow cytometer and analyzed with CellQuest software.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Galectin-1 expression by prostate cancer cell lines. Galectin-1 is expressed by DU145 and PC-3 prostate cancer cell lines but not by PSA+ LNCaP cells (25, 26). We confirmed that DU145 and PC-3 make abundant galectin-1 whereas LNCaP cells do not produce galectin-1 detected by immunoblotting, as previously shown (refs. 25, 26; Fig. 1A ). Moreover, DU145 and PC-3 cells externalize galectin-1; cell-surface galectin-1 was detected by ELISA (Fig. 1A) and by immunofluorescent labeling of DU145 and PC-3 cells (Fig. 1B). Importantly, galectin-1 on DU145 and PC-3 cells can be released by preincubation with lactose (data not shown), showing that secreted endogenous galectin-1 is retained on the cell surface via lectin-carbohydrate interactions.


Figure 1
View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Galectin-1 triggers cell death of LNCaP prostate cancer cells. A, left, immunoblotting reveals galectin-1 expression by DU145 and PC-3 cells but not by LNCaP cells. The blot was stripped and reprobed to detect actin to show equal loading. Right, expression of galectin-1 detected by ELISA on cell monolayers. DU145 and PC-3 cells externalize galectin-1, whereas no galectin-1 is detected on LNCaP cells. B, immunofluorescence shows abundant galectin-1 on DU145 and PC-3 cells but not LNCaP cells (magnification, x400). C, right, recombinant human galectin-1 induces cell death of LNCaP cells, detected by TUNEL staining (X axis) and analysis by flow cytometry. Left, DU145 cells are resistant to cell death induced by galectin-1. Thick line, galectin-1 treatment; thin line, galectin-1 in the presence of lactose to block binding; filled histogram, buffer control treated cells. D, quantification of cell death triggered by galectin-1 binding, determined as percentage of TUNEL-positive cells (*, P < 0.001). Open columns, buffer control; filled columns, galectin-1 treated; hatched columns, galectin-1 plus lactose. Columns, mean of triplicate samples from one of five replicate experiments; bars, SE.

 
Prostate cancer cell susceptibility to galectin-1–induced cell death. Because DU145 cells but not LNCaP cells produce and externalize abundant galectin-1, we reasoned that DU145 cells would be resistant to cell death triggered by exogenous galectin-1, whereas LNCaP cells would die after binding exogenous galectin-1. As shown in Fig. 1C and D, LNCaP cells are susceptible to cell death induced by exogenous galectin-1. Importantly, the effect of galectin-1 on LNCaP cells was inhibited by addition of lactose, showing that galectin-1–induced cell death required galectin-1 binding to saccharide ligands on the surface of the LNCaP cells. Cell death was detected by the TUNEL assay, showing that the cells reached a late stage of apoptosis in which DNA degradation has occurred. In contrast to LNCaP cells, DU145 cells were resistant to galectin-1–induced apoptosis (Fig. 1D), consistent with the observation that DU145 cells synthesize and secrete abundant endogenous galectin-1.

O-Glycans on cellular glycoproteins are required for LNCaP susceptibility to galectin-1–induced death. As shown in Fig. 1, galectin-1–induced death of LNCaP cells requires galectin-1 binding to saccharide ligands on the cells. Galectin-1 preferentially binds to galactose-terminated saccharide ligands, particularly to lactosamine (Galß1,4GlcNAc) sequences that can be found on N- or O-linked glycans on cell-surface glycoproteins (27, 2931). These lactosamine sequences can be elongated to form polylactosamine structures that are high-avidity ligands for galectin-1. On N-glycans, elongation of polylactosamine sequences is typically initiated by the action of the N-acetylglucosaminyltransferase V enzyme, whereas on O-glycans, elongation of polylactosamine sequences is typically initiated by the action of the core 2 GnT enzyme (29). Because the lactose inhibition data in Fig. 1D showed that galectin-1–induced death of LNCaP cells required galectin-1 binding to saccharide ligands on the cell surface, we asked if galectin-1–induced death of LNCaP cells required N- or O-glycan structures.

We used inhibitors to modify glycosylation of N- and O-glycans. The inhibitor DMNJ modifies N-glycans by inhibiting mannosidase II, the enzyme that trims high-mannose structures on N-glycans to allow subsequent addition of N-acetylglucosamine residues and elongation of lactosamine sequences (31). Loss of N-acetylglucosamine sequences, particularly on the glycan branch modified by N-acetylglucosaminyltransferase V, can be detected by loss of staining with the plant lectin PHA. As shown in Fig. 2A , treatment of LNCaP cells with DMNJ markedly reduced PHA staining, indicating the effectiveness of DMNJ treatment in reducing lactosamine addition to N-glycans. To modify O-glycan elongation, we used benzyl-{alpha}-GalNAc that can modify O-glycan elongation in two different ways (3941). In cells with low amounts of sialylated O-glycans, benzyl-{alpha}-GalNAc blocks elongation of O-glycans beyond the initial GalNAc residue (Fig. 3 ), an effect that can be detected by reduced reactivity with the plant lectin PNA. In cells with high levels of sialylated O-glycans, benzyl-{alpha}-GalNAc inhibits O-glycan sialylation, resulting in exposure of nonsialylated O-glycans and increased PNA reactivity. As shown in Fig. 2B, treatment of LNCaP cells with benzyl-{alpha}-GalNAc resulted in increased PNA binding, indicating that the inhibitor treatment increased exposure of nonsialylated O-glycans on these cells.


Figure 2
View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Altered O-glycan elongation, but not N-glycan elongation, promotes galectin-1–induced death of LNCaP cells. A, LNCaP cells were treated with DMNJ to block N-glycan elongation. Effectiveness of DMNJ treatment is shown by decreased staining with the plant lectin PHA (open histogram) compared with control treated cells (filled histogram). B, LNCaP cells were treated with benzyl-{alpha}-GalNAc, which can compete with sialyltransferases and promote decreased O-glycan sialylation, allowing increased branching of O-glycans. Decreased O-glycan sialylation is shown by increased staining with the plant lectin PNA (open histogram) compared with control treated cells (filled histogram). C, DMNJ treatment did not reduce LNCaP cell susceptibility to galectin-1–induced death, detected by TUNEL staining, showing that branched N-glycans are not required for galectin-1 susceptibility of LNCaP cells. D, benzyl-{alpha}-GalNAc treatment increased LNCaP cell susceptibility to galectin-1–induced death, indicating that increased O-glycan elongation promotes susceptibility to galectin-1 (*, P < 0.001). C and D, columns, mean of triplicate samples from one of three independent experiments; bars, SE.

 

Figure 3
View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Schematic of O-linked glycosylation pathways. The plant lectin PNA binds nonsialylated core 1 O-glycans (Gal-GalNAc). The action of ST3Gal1 caps core 1 O-glycans and prevents synthesis of core 2 O-glycans and extension of polylactosamine (Gal-GlcNAc) sequences that are preferentially recognized by galectin-1. Subsequent to core 2 elongation, terminal sialic acid residues may be added to either or both branches. C2GnT, core 2 GnT.

 
LNCaP cells treated with either DMNJ or benzyl-{alpha}-GalNAc were assessed for sensitivity to galectin-1–induced cell death. Treatment with DMNJ had no significant effect on LNCaP cell susceptibility to galectin-1 (Fig. 2C); as DNMJ treatment did not reduce LNCaP susceptibility to galectin-1, complex N-glycans bearing lactosamine sequences are not required for galectin-1–induced death of these cells. In contrast, treatment of LNCaP cells with benzyl-{alpha}-GalNAc, causing increased exposure of nonsialylated O-glycans, resulted in a dramatic increase in sensitivity to galectin-1–induced cell death, with virtually 100% of the cells dying in response to galectin-1 (Fig. 2D). These results indicated that O-glycans on cell-surface glycoproteins regulate LNCaP cell sensitivity to galectin-1–induced cell death.

Galectin-1–resistant PSA LNCaP cells have decreased expression of core 2 GnT. PSA LNCaP cells express abundant galectin-1 and are resistant to galectin-1–induced death (32), whereas both PSA+ and PSA LNCaP cells were susceptible to Fas-induced death, indicating that PSA LNCaP cells are not generally resistant to apoptosis.5 This implied that specific differences in expression of glycan ligands between PSA and PSA+ LNCaP cells might be responsible for differential susceptibility to galectin-1–induced death. To identify candidate glycosyltransferase genes that would promote susceptibility to galectin-1 in LNCaP cells, we compared patterns of glycosyltransferase gene expression between PSA+ LNCaP and PSA LNCaP clones (32). We examined 120 glycosyltransferase genes in the U95 Affymetrix array, focusing on enzymes that participate in O-glycan synthesis. Of all glycosyltransferases examined, the enzyme with the most profound difference in expression between the PSA+ and PSA LNCaP cells was core 2 GnT, which initiates branched structures on O-glycans (Fig. 3). Core 2 GnT expression was reduced almost 5-fold in PSA LNCaP cells compared with PSA+ LNCaP cells in the microarray analysis (Fig. 4A ). We confirmed reduced expression of core 2 GnT mRNA in PSA LNCaP cells compared with PSA+ LNCaP cells by RT-PCR analysis (Fig. 4B).


Figure 4
View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. PSA LNCaP cells have decreased expression of core 2 GnT compared with PSA+ LNCaP cells. A, relative expression of representative glycosyltransferases detected on the U95 Affymetrix array between parental PSA+ LNCaP cells (black columns; set to 1.0 for comparison) and a PSA LNCaP subclone (white columns). Whereas expression of several GlcNAc and GalNAc transferases was increased in PSA versus PSA+ cells, PSA LNCaP cells showed almost 5-fold less core 2 GnT expression compared with PSA+ LNCaP cells. B, validation of decreased core 2 GnT expression in PSA LNCaP cells versus parental PSA+ LNCaP cells. RT-PCR shows robust expression of core 2 GnT in PSA+ LNCaP cells compared with PSA LNCaP cells. C, semiquantitative RT-PCR analysis of core 2 GnT expression in PSA+ (black column) and PSA (white column; set to 1.0 for comparison) LNCaP cells.

 
Core 2 GnT activity creates branched O-glycans bearing lactosamine sequences recognized by galectin-1 (Fig. 3). Our data indicated that O-glycans participate in galectin-1–induced death of LNCaP cells (Fig. 2C), suggesting that the reduction in core 2 GnT expression in PSA LNCaP cells could render the cells resistant to galectin-1–induced cell death. Intriguingly, our group has previously shown that core 2 GnT expression also renders T cells susceptible to galectin-1–induced cell death (29, 30), indicating that galectin-1 susceptibility of various cell types may be controlled at the level of cell-surface glycosylation by common glycosyltransferase enzymes that add the same glycan ligands to different polypeptides on different cell types.

Blocking O-glycan elongation protects LNCaP cells from galectin-1–induced death. To directly address the role of O-glycans in regulating LNCaP susceptibility to galectin-1, we attempted to decrease core 2 GnT expression in LNCaP cells using small interfering RNA. However, despite repeated attempts, we were unable to reduce core 2 GnT enzyme expression below 40% of control; whereas we observed a concomitant reduction in the level of core 2 GnT protein by immunoblotting, this level of reduction of core 2 GnT enzyme activity did not appreciably alter cellular glycosylation as detected by PNA binding, nor did we detect a reduction in susceptibility to galectin-1–induced death (data not shown). Thus, as an alternate approach to block O-glycan elongation, we transfected LNCaP cells with cDNA encoding ß-galactoside ST3Gal1 (39). This sialyltransferase competes with core 2 GnT in the Golgi, adding sialic acid to nascent O-glycans and blocking O-glycan elongation (refs. 39, 42; Fig. 3). We have previously found that overexpression of ST3Gal1 is an effective method of blocking O-glycan elongation in T cells (39). As shown in Fig. 5A , expression of ST3Gal1 in LNCaP cells reduced PNA binding to the cells, showing the effectiveness of ST3Gal1 expression in blocking O-glycan elongation. Furthermore, ST3Gal1 expression resulted in a marked reduction in LNCaP cell susceptibility to galectin-1–induced cell death (Fig. 5B and C). Cells expressing the ST3Gal1 showed >60% reduction in TUNEL-positive cells following galectin-1 binding, compared with cells transfected with vector alone. These results show that changes in O-glycan expression and degree of O-glycan sialylation regulate LNCaP cell susceptibility to galectin-1–induced cell death.


Figure 5
View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Sialylation of O-glycans protects LNCaP cells from galectin-1–induced cell death. A, expression of ST3Gal1 reduced PNA binding sites on the surface of LNCaP cells. PNA binding to LNCaP cells transfected with vector alone (LNCaP-pC) or with ST3Gal1 (LNCaP-pST3) is reported as mean phycoerythrin (PE) fluorescence intensity of cells treated with control reagents or PNA-biotin. B, expression of ST3Gal1 reduces susceptibility of LNCaP cells to galectin-1–induced death, detected by TUNEL (X axis). Thick line, galectin-1 treatment; thin line, galectin-1 in the presence of lactose to block binding; filled histogram, buffer control treated cells. C, quantification of cell death triggered by galectin-1 binding of LNCaP cells transfected with vector alone, or transfected with ST3Gal1, determined as percentage of TUNEL-positive cells (*, P < 0.002). Open columns, buffer control; filled columns, galectin-1 treated; hatched columns, galectin-1 plus lactose. Columns, mean of triplicate samples from one of four replicate experiments; bars, SE.

 
Galectin-1–resistant prostate cancer cells express galectin-1 and kill adherent T cells. Galectin-1 expression increases with epithelial cancer progression in prostate, ovarian, and squamous cell carcinomas (13, 14, 43, 44). Moreover, increased galectin-1 expression in human squamous cell carcinomas and in a mouse melanoma model resulted in decreased T-cell infiltration into the tumors (34, 44), indicating that galectin-1 expression by tumor cells that are resistant to galectin-1–induced death would enable tumor cells to evade immune attack. To ask if expression of galectin-1 by PSA LNCaP cells and PC-3 cells enabled prostate cells to kill adherent T cells, we added human CEM T cells to monolayers of PSA+ LNCaP, PSA LNCaP, or PC-3 cells. After 8 h, T cells were removed from the prostate cell monolayers and T-cell death was assessed by TUNEL. Flow cytometric analysis of forward versus side scatter of nonadherent cells was used to discriminate T cells from nonadherent prostate cells. There was minimal TUNEL labeling of CEM cells adherent to PSA+ LNCaP cells that do not express galectin-1 (Fig. 6B ). In contrast, we observed a distinct population of TUNEL-positive T cells after binding to PSA LNCaP cells that express galectin-1. Similarly, we observed robust TUNEL staining of ~50% of T cells adherent to PC-3 cells (Fig. 6C). T cells were directly treated with purified recombinant galectin-1 as a positive control (Fig. 6C). Thus, prostate cancer cells that have acquired resistance to galectin-1–induced death can express endogenous galectin-1 that can kill T cells, supporting the model that tumor expression of galectin-1 promotes tumor immune privilege.


Figure 6
View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Prostate cells expressing cell-surface galectin-1 kill human CEM T cells. A, an example of forward versus side scatter analysis used to discriminate CEM T cells (left) from LNCaP cells (center); a 1:1 mixture of both cell types confirmed that two distinct populations could be discriminated (right). In all T-cell death experiments on prostate cell monolayers, nonadherent prostate cells represented <5% of the total cells analyzed. B, CEM T cells that are susceptible to galectin-1–induced death were added for 8 h to confluent monolayers of the parental PSA+ LNCaP cells that do not express endogenous galectin-1, or to PSA LNCaP cells that express abundant endogenous galectin-1. CEM T cells were removed and analyzed for cell death by TUNEL staining (X axis). PSA+ LNCaP (left) cells induced minimal TUNEL staining of CEM T cells (thin line) compared with PSA LNCaP cells (right) that triggered death of a significant population of T cells. Filled histograms, CEM T cells treated identically but added to plastic dishes in the absence of prostate cell monolayers. C, quantification of TUNEL labeling of CEM T cells treated with 20 µmol/L recombinant human galectin-1 or buffer control (open columns), or bound to the indicated prostate cancer cells (filled columns). *, P < 0.05; **, P < 0.001. Columns, mean of triplicate samples from one of five replicate experiments; bars, SE.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Galectin-1 can kill lymphoid and epithelial tumor cells and has the potential to synergize with other cell death–inducing agents to enhance killing of a variety of tumor cell types (27, 28, 45). Whereas glycan ligands on T cells recognized by galectin-1 have been identified, little is known about galectin-1 recognition of specific glycans on epithelial neoplasms such as breast and prostate cancer. In this report, we have shown that O-glycans on LNCaP prostate cancer cells are essential for triggering galectin-1–induced cell death, and that masking of these O-glycans by sialic acid, by overexpressing the ST3Gal1 sialyltranferase enzyme, renders the cells resistant to galectin-1. Whereas ST3Gal1 expression in LNCaP cells did not completely mask all O-glycans because we still detected some PNA binding to the cells (Fig. 5A), ST3Gal1 expression reduced susceptibility of LNCaP by >60%. This suggests that critical O-glycans bound by galectin-1 to trigger cell death were preferentially modified by ST3Gal1.

Importantly, our group previously found that O-glycans on T cells are critical for susceptibility to galectin-1 (29, 30). In T cells, elongation of O-glycans by core 2 GnT modifies several cell-surface glycoproteins, including CD45 and CD43, required for conferring susceptibility of CD45+ T cells to galectin-1 (30). We have also recently determined that malignant T cells from some patients with cutaneous T-cell lymphoma have aberrant cell-surface glycosylation and are thus resistant to galectin-1–induced cell death (8). Specifically, we identified malignant T cells from one patient with a single point mutation in core 2 GnT that abrogated enzyme activity and conferred galectin-1 resistance (46). We found that core 2 GnT is highly expressed in parental PSA+ LNCaP cells that are susceptible to galectin-1–induced death and markedly reduced in PSA LNCaP cells that produce abundant galectin-1 and are resistant to galectin-1–induced cell death. Thus, we have now found reduced core 2 GnT expression or activity correlating with resistance to galectin-1–induced cell death in prostate cancer cells and T lymphoma cells. Whereas the LNCaP cell-surface glycoproteins that can be modified by core 2 GnT are not known, it is clear that LNCaP cells do not express CD45 and CD43, the glycoproteins on T cells that bear core 2 O-glycans and are receptors for galectin-1. Thus, a common O-glycan modification on different polypeptides may regulate susceptibility of both prostate cancer cells and T cells to galectin-1.

Masking glycan ligands by the addition of sialic acid is a common glycosylation change described in many types of cancer. As mentioned above, PSA from prostate cancer patients contains more terminal {alpha}2,3-linked sialic acid compared with PSA from patients with benign prostatic hyperplasia (18). As we have previously shown with T cells (39), overexpression of ST3Gal1 was an effective method to block O-glycan elongation on LNCaP cells, as ST3Gal1 competes with several O-glycan–modifying enzymes, including core 2 GnT, in the Golgi (42), and increased ST3Gal1 expression made the LNCaP cells resistant to galectin-1–induced death. Increased sialylation of tumor cell glycans may enhance tumor cell adhesion, invasion, and resistance to apoptosis. Conversely, our results imply that reducing sialylation and/or increasing O-glycan branching in tumor cells may be an effective mechanism to enhance tumor cell susceptibility to death induced by endogenous galectin-1.

Whereas several features of the T-cell death pathway triggered by galectin-1 have been described, we know very little about the mechanism of galectin-1–induced death of prostate cells. As prostate cells do not express the T-cell glycoprotein receptors CD45, CD43, and CD7 that are involved in galectin-1–induced T-cell death, different prostate cell glycoproteins that bear the appropriate glycan ligands and bind galectin-1 may transmit the death signal into prostate cancer cells. In this regard, prostate cell-surface glycoproteins that have functions similar to those of CD45, CD43, and CD7 (i.e., tyrosine phosphatase, association with ezrin/radixin/moesin cytoskeletal linker proteins, and induction of tyrosine and lipid kinase activities, respectively) may be good candidates for the prostate-specific glycoprotein receptors that bind galectin-1 and trigger cell death. Intriguingly, neutral endopeptidase (also known as CD10) is a prostate cell glycoprotein that, like CD43 on T cells, bears O-glycans, associates with ERM linker proteins, and facilitates apoptosis, and CD10 expression decreases during prostate cancer progression (47, 48); our lab is currently investigating the role of CD10 in LNCaP cell susceptibility to galectin-1.

Resistance to galectin-1–induced apoptosis would confer an obvious selective advantage to prostate cancer cells; however, why would galectin-1–resistant prostate cancer cells make and externalize endogenous galectin-1? As we have shown, PSA LNCaP cells that are resistant to galectin-1–induced death synthesize high levels of galectin-1, compared with the galectin-1–sensitive PSA+ LNCaP cells (32). As mentioned above, galectin-1 in prostate cancer stroma has been proposed to provide an "immunologic shield" around tumor cells, preventing infiltration of tumor-specific CTLs (14, 35). Indeed, loss of galectin-1 expression by melanoma cells increased CD8 T-cell attack of tumor cells in a murine model (34). In this report, we have directly shown that prostate cancer cells expressing galectin-1, including PSA LNCaP cells and PC-3 cells, induce rapid death of bound T cells, as detected by TUNEL analysis of the T cells, whereas PSA+ LNCaP cells did not kill bound T cells. These data indicate that prostate cancer cells resistant to galectin-1–induced death could exploit endogenous galectin-1 to kill infiltrating T cells. Tumor evasion of an immune response contributes substantially to expansion of the primary tumor, outgrowth of residual disease following surgical resection, and survival of metastases; adjunct immunotherapy approaches have included increasing T-cell infiltration into the prostate by triggering tumor cell apoptosis, enhancing tumor antigen presentation, and potentiating T-cell responses by blocking inhibitory CTLA-4 signals (49, 50). As mentioned above, altering tumor cell glycosylation could restore susceptibility to galectin-1 produced by tumor cells as well as tumor-associated stroma and endothelium, to make tumor cells, rather than T cells, targets of galectin-1. In combination with strategies to augment T-cell responses, this approach may enhance the effectiveness of prostate cancer therapy.


    Acknowledgments
 
Grant support: NIH Training grants T32CA09056 (H.F. Valenzuela) and T32CA09120 (K.E. Pace), the Academy of Finland and the Sigrid Juselius Foundation (Finland) grants (P. Vihko), and Cancer Research Institute award 01103591 and Department of Defense award DAMD 17-02-1-0022 (L.G. Baum).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank James He, Joseph Hernandez, Shuguang Bi, Luciana Kohatsu, Mabel Pang, and Leland Powell for advice and discussion, and Michael Teitell for critical reading of the manuscript.


    Footnotes
 
5 P. Cabrera and L. Baum, unpublished data. Back

Received 12/13/05. Revised 3/30/07. Accepted 4/26/07.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ono M, Hakomori S. Glycosylation defining cancer cell motility and invasiveness. Glycoconj J 2004;20:71–8.[CrossRef][Medline]
  2. Fuster MM, Esko JD. The sweet and sour of cancer: glycans as novel therapeutic targets. Nat Rev Cancer 2005;5:526–42.[CrossRef][Medline]
  3. Kano Y, Mashiko T, Danbara M, et al. Changes in serum IgG oligosaccharide chains with prostate cancer progression. Anticancer Res 2004;24:3135–9.[Abstract/Free Full Text]
  4. Suriano R, Ghosh SK, Ashok BT, et al. Differences in glycosylation patterns of heat shock protein, gp96: implications for prostate cancer prevention. Cancer Res 2005;65:6466–75.[Abstract/Free Full Text]
  5. Inaba Y, Ohyama C, Kato T, et al. Gene transfer of {alpha}1,3-fucosyltransferase increases tumor growth of the PC-3 human prostate cancer cell line through enhanced adhesion to prostatic stromal cells. Int J Cancer 2003;107:949–57.[CrossRef][Medline]
  6. Wang L, Mitoma J, Tsuchiya N, et al. An A/G polymorphism of core 2 branching enzyme gene is associated with prostate cancer. Biochem Biophys Res Commun 2005;331:958–63.[CrossRef][Medline]
  7. Hagisawa S, Ohyama C, Takahashi T, et al. Expression of core 2 ß1,6-N-acetyl-glucosaminyltransferase facilitates prostate cancer progression. Glycobiology 2005;15:1016–24.[Abstract/Free Full Text]
  8. Roberts AA, Amano M, Felton C, et al. Galectin-1-mediated apoptosis in mycosis fungoides: the roles of CD7 and cell surface glycosylation. Mod Pathol 2003;16:543–51.[CrossRef][Medline]
  9. Oka N, Takenaka Y, Raz A. Galectins and urological cancer. J Cell Biochem 2004;91:118–24.[CrossRef][Medline]
  10. Tanenaka Y, Fukumori T, Raz A. Galectin-3 and metastasis. Glycoconj J 2004;19:543–9.[CrossRef][Medline]
  11. Ellerhorst J, Troncoso P, Xu XC, Lee J, Lotan R. Galectin-1 and galectin-3 expression in human prostate tissue and prostate cancer. Urol Res 1999;27:362–7.[CrossRef][Medline]
  12. Pacis RA, Pilat MJ, Pienta KJ, et al. Decreased galectin-3 expression in prostate cancer. Prostate 2000;44:118–23.[CrossRef][Medline]
  13. Clausse N, van den Brule F, Waltregny D, Garnier F, Castronovo V. Galectin-1 expression in prostate tumor-associated capillary endothelial cells is increased by prostate carcinoma cells and modulates heterotypic cell-cell adhesion. Angiogenesis 1999;3:317–25.[CrossRef][Medline]
  14. Van den Brule FA, Waltregny D, Castronovo V. Increased expression of galectin-1 in carcinoma-associated stroma predicts poor outcome in prostate carcinoma patients. J Pathol 2001;193:80–7.[CrossRef][Medline]
  15. Andersen H, Jensen ON, Moiseeva EP, Eriksen EF. A proteome study of secreted prostatic factors affecting osteoblastic activity: galectin-1 is involved in differentiation of human bone marrow stromal cells. J Bone Miner Res 2003;18:195–203.[CrossRef][Medline]
  16. Zick Y, Eisenstein M, Goren RA, Hadari YR, Levy Y, Ronen D. Role of galectin-8 as a modulator of cell adhesion and cell growth. Glycoconj J 2004;19:517–26.[CrossRef][Medline]
  17. Gopalkrishnan RV, Roberts T, Tuli S, Kang D, Christiansen KA, Fischer PB. Molecular characterization of prostate carcinoma tumor antigen-1, PCTA-1, a human galectin-8 related gene. Oncogene 2000;19:4405–16.[CrossRef][Medline]
  18. Peracaula R, Tabares, G, Royle L, et al. Altered glycosylation pattern allows the distinction between prostate-specific antigen (PSA) from normal and tumor origins. Glycobiology 2003;13:457–70.[Abstract/Free Full Text]
  19. Beckett ML, Wright GL. Characterization of a prostate carcinoma mucin-like antigen (PMA). Int J Cancer 1995;62:703–10.[Medline]
  20. Slovin SF, Ragupathi G, Musselli C, et al. Fully synthetic carbohydrate-based vaccines in biochemically relapsed prostate cancer: clinical trial results with {alpha}-N-acetylgalactosamine-O-serine/threonine conjugate vaccine. J Clin Oncol 2003;21:4292–8.[Abstract/Free Full Text]
  21. Glinsky VV, Glinsky GV, Rittenhouse-Olson K, et al. The role of Thomsen-Friedenreich antigen in adhesion of human breast and prostate cancer cells to the endothelium. Cancer Res 2001;61:4851–7.[Abstract/Free Full Text]
  22. Nakahara S, Oka N, Raz A. On the role of galectin-3 in cancer apoptosis. Apoptosis 2005;10:267–75.[CrossRef][Medline]
  23. Califice S, Castronovo V, Bracke M, van den Brule F. Dual activities of galectin-3 in human prostate cancer: tumor suppression of nuclear galectin-3 vs tumor promotion of cytoplasmic galectin-3. Oncogene 2004;23:7527–36.[CrossRef][Medline]
  24. Ellerhorst J, Stephens LC, Nguyen T, Xu XC. Effects of galectin-3 expression on growth and tumorigenicity of the prostate cancer cell line LNCaP. Prostate 2002;50:64–70.[CrossRef][Medline]
  25. Ellerhorst J, Nguyen T, Cooper DN, Lotan D, Lotan R. Differential expression of endogenous galectin-1 and galectin-3 in human prostate cancer cell lines and effects of overexpressing galectin-1 on cell phenotype. Int J Oncol 1999;14:217–24.[Medline]
  26. Ellerhorst J, Nguyen T, Cooper DN, Estrov Y, Lotan D, Lotan R. Induction of differentiation and apoptosis in the prostate cancer cell line LNCaP by sodium butyrate and galectin-1. Int J Oncol 1999;14:225–32.[Medline]
  27. Hernandez JD, Baum LG. Ah, sweet mystery of death! Galectins and control of cell fate. Glycobiology 2002;12:127–36R.[CrossRef]
  28. Weist I, Seliger C, Walzel H, Friese K, Jeschke U. Induction of apoptosis in human breast cancer and trophoblast tumor cells by galectin-1. Anticancer Res 2005;25:1575–80.[Abstract/Free Full Text]
  29. Galvan M, Tsuboi S, Fukuda M, Baum LG. Expression of a specific glycosyltransferase enzyme regulates T cell death mediated by galectin-1. J Biol Chem 2000;275:16730–7.[Abstract/Free Full Text]
  30. Nguyen JT, Evans DP, Galvan M, et al. CD45 modulates galectin-1-induced T cell death: regulation by expression of core 2 O-glycans. J Immunol 2001;167:5697–707.[Abstract/Free Full Text]
  31. Amano M, Galvan M, He J, Baum LG. The ST6Gal I sialyltransferase selectively modifies N-glycans on CD45 to negatively regulate galectin-1-induced CD45 clustering, phosphatase modulation, and T cell death. J Biol Chem 2003;278:7469–75.[Abstract/Free Full Text]
  32. Vaarala MH, Porvari K, Kyllonen A, Vihko P. Differentially expressed genes in two LNCaP prostate cancer cell lines reflecting changes during prostate cancer progression. Lab Invest 2000;80:1259–68.[Medline]
  33. Harkonen P, Torn S, Kurkela R, et al. Sex hormone metabolism in prostate cancer cells during transition to an androgen-independent state. J Clin Endocrinol Metab 2003;88:705–12.[Abstract/Free Full Text]
  34. Rubinstein N, Alvarez M, Zwirner NW, et al. Targeted inhibition of galectin-1 gene expression in tumor cells results in heightened T cell-mediated rejection; a potential mechanism of tumor-immune privilege. Cancer Cell 2004;5:241–51.[CrossRef][Medline]
  35. He J, Baum LG. Presentation of galectin-1 by extracellular matrix triggers T cell death. J Biol Chem 2004;279:4705–12.[Abstract/Free Full Text]
  36. Pace KE, Lee C, Stewart PL, Baum LG. Restricted receptor segregation into membrane microdomains occurs on human T cells during apoptosis induced by galectin-1. J Immunol 1999;163:3801–11.[Abstract/Free Full Text]
  37. Pace KE, Hahn HP, Pang M, Nguyen JT, Baum LG. CD7 delivers a pro-apoptotic signal during galectin-1-induced T cell death. J Immunol 2000;165:2331–4.[Abstract/Free Full Text]
  38. Perillo NL, Marcus M, Baum LG. Galectins: versatile modulators of cell adhesion, cell proliferation, and cell death. J Mol Med 1998;76:402–12.[CrossRef][Medline]
  39. Gillespie W, Paulson JC, Kelm S, Pang M, Baum LG. Regulation of {alpha}2,3-sialyltransferase expression correlates with conversion of peanut agglutinin (PNA)+ to PNA– phenotype in developing thymocytes. J Biol Chem 1993;268:3801–4.[Abstract/Free Full Text]
  40. Nakano T, Matsui T, Ota T. Benzyl-{alpha}-GalNAc inhibits sialylation of O-glycosidic sugar chains on CD44 and enhances experimental metastatic capacity in B16BL6 melanoma cells. Anticancer Res 1996;16:3577–84.[Medline]
  41. Gouyer V, Leteurtre E, Zanetta JP, Lesuffleur T, Delannoy P, Huet G. Inhibition of the glycosylation and alteration in the intracellular trafficking of mucins and other glycoproteins by GalNAc{alpha}-O-bn in mucosal cell lines: an effect mediated through the intracellular synthesis of complex GalNAc{alpha}-O-bn oligosaccharides. Front Biosci 2001;6:D1235–44.[Medline]
  42. Priatel JJ, Chui D, Hiraoka N, et al. The ST3Gal-I sialyltransferase controls CD8+ T lymphocyte homeostasis by modulating O-glycan biosynthesis. Immunity 2000;12:273–83.[CrossRef][Medline]
  43. van den Brule F, Califice S, Garnier F, Fernandez PL, Berchuk A, Castronovo V. Galectin-1 accumulation in the ovary carcinoma peritumoral stroma is induced by ovary carcinoma cells and affects both cancer cell proliferation and adhesion to laminin-1 and fibronectin. Lab Invest 2003;83:377–86.[Medline]
  44. Le QT, Shi G, Cao H, et al. Galectin-1: a link between tumor hypoxia and tumor immune privilege. J Clin Oncol 2005;23:8932–41.[Abstract/Free Full Text]
  45. Matarrese P, Tinari A, Mormone E, et al. Galectin-1 sensitizes resting human T lymphocytes to Fas (CD95)-mediated cell death via mitochondrial hyperpolarization, budding, and fission. J Biol Chem 2005;280:6969–85.[Abstract/Free Full Text]
  46. Cabrera PV, Amano M, Mitoma J, et al. Haploinsufficiency of C2GnT-I glycosyltransferase renders T lymphoma cells resistant to cell death. Blood 2006;108:2399–406.[Abstract/Free Full Text]
  47. Vida TA, Hersh LB. Glycosylation variants of endopeptidase-24.11 ("enkephalinase"). Neuropeptides 1992;21:245–55.[CrossRef][Medline]
  48. Sumitomo M, Shen R, Goldberg JS, Dai J, Navarro D, Nanus DM. Neutral endopeptidase promotes phorbol ester-induced apoptosis in prostate cancer cells by inhibiting neuropeptide-induced protein kinase C{delta} degradation. Cancer Res 2000;60:6590–6.[Abstract/Free Full Text]
  49. Dalgleish A, Whelan M. Novel immunotherapeutic approaches to prostate cancer. Curr Opin Mol Ther 2005;7:30–4.[Medline]
  50. Hurwitz AA, Foster BA, Kwon ED, et al. Combination immunotherapy of primary prostate cancer in a transgenic mouse model using CTLA-4 blockade. Cancer Res 2000;60:2444–8.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Y. Zhuo, R. Chammas, and S. L. Bellis
Sialylation of {beta}1 Integrins Blocks Cell Adhesion to Galectin-3 and Protects Cells against Galectin-3-induced Apoptosis
J. Biol. Chem., August 8, 2008; 283(32): 22177 - 22185.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. R. Stowell, Y. Qian, S. Karmakar, N. S. Koyama, M. Dias-Baruffi, H. Leffler, R. P. McEver, and R. D. Cummings
Differential Roles of Galectin-1 and Galectin-3 in Regulating Leukocyte Viability and Cytokine Secretion
J. Immunol., March 1, 2008; 180(5): 3091 - 3102.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
V. L. J. L. Thijssen, F. Poirier, L. G. Baum, and A. W. Griffioen
Galectins in the tumor endothelium: opportunities for combined cancer therapy
Blood, October 15, 2007; 110(8): 2819 - 2827.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Valenzuela, H. F.
Right arrow Articles by Baum, L. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Valenzuela, H. F.
Right arrow Articles by Baum, L. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online