| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Department of Pathology and 2 Jonsson Comprehensive Cancer Center, School of Medicine, University of California at Los Angeles, Los Angeles, California; 3 Research Center for Molecular Endocrinology and WHO CCR, Biocenter Oulu, University of Oulu, Oulu, Finland; and 4 Department of Biological and Environmental Sciences, Division of Biochemistry, University of Helsinki, Helsinki, Finland
Requests for reprints: Linda G. Baum, Department of Pathology and Laboratory Medicine, School of Medicine, University of California at Los Angeles, 10833 LeConte Avenue, Los Angeles, CA 90095-1732. Phone: 310-206-5985; E-mail: lbaum{at}mednet.ucla.edu.
| Abstract |
|---|
|
|
|---|
2,3-sialyltransferase 1 rendered LNCaP cells resistant to galectin-1, showing that specific O-glycans are critical for galectin-1 susceptibility. Loss of galectin-1 susceptibility and synthesis of endogenous galectin-1 has been proposed to promote tumor evasion of immune attack; we found that galectin-1expressing prostate cancer cells killed bound T cells, whereas LNCaP cells that do not express galectin-1 did not kill T cells. Resistance to galectin-1induced apoptosis may directly contribute to the survival of prostate cancer cells as well as promote immune evasion by the tumor. [Cancer Res 2007;67(13):615562] | Introduction |
|---|
|
|
|---|
Altered tumor cell glycosylation as well as changes in expression of glycan-binding lectins by tumor cells and stroma has been described in prostate cancer, the most common cancer in men and the second highest cause of cancer deaths in Western society (3, 4, 917). Changes in prostate cancer cell glycosylation have been proposed to affect prostate cancer cell growth, invasion and metastasis, and progression to androgen independence. For example, prostate-specific antigen (PSA) from cancer patients typically bears increased levels of
2,3-linked sialic acid compared with PSA from patients with benign prostatic hyperplasia (18). Similarly, the tumor cell-surface glycoprotein prostate mucin antigen, which bears abundant O-glycans, is expressed on prostate tumor cells but not on normal prostate cells (19). O-Glycans on prostate cancer cells often bear the Tn antigen (GalNAc-O-Ser/Thr), a glyco-epitope that has been proposed as a target for tumor immunotherapy (20), and the T antigen on O-glycans (Galß1,3GalNAc) plays a role in prostate cancer cell adhesion to endothelium (21).
Several members of the galectin family of lectins are aberrantly expressed in prostate cancer and have been implicated in the process of prostate cancer progression (917, 2126). Galectins are soluble carbohydrate-binding proteins that can remain intracellular, where they regulate cell signaling and cell survival, or can be secreted via a nonclassic pathway to mediate cell-cell and cell-matrix interactions (27). Galectin-8, also known as prostate carcinoma tumor antigen 1, is selectively expressed in prostate carcinoma, compared with normal or benign hyperplastic prostate (16, 17). As galectin-8 modulates cell adhesion to extracellular matrix proteins such as fibronectin, galectin-8 may be involved in tumor cell invasion. Galectin-3 is proposed to have both intracellular and extracellular functions in prostate cancer. Cytoplasmic galectin-3 promotes prostate cancer cell resistance to apoptosis, anchorage-independent growth, and invasion into extracellular matrix, whereas extracellular galectin-3 mediates prostate cell attachment to endothelial cells (912, 2125).
Galectin-1 acts extracellularly to induce apoptosis of normal and transformed T lymphocytes, as well as breast and trophoblast tumor cells (27, 28). Whereas specific types of cell-surface glycosylation are known to create or mask the glycan ligands required for galectin-1induced T-lymphocyte cell death (8, 2931), nothing is known about features of cell-surface glycosylation that regulate epithelial cancer cell susceptibility to galectin-1. Expression of galectin-1 by LNCaP prostate cancer cells, either by treatment with sodium butyrate or transfection with rat galectin-1 cDNA, induced apoptosis of this cell line, although these studies did not examine secretion of galectin-1 by the LNCaP cells, nor were glycan ligands for galectin-1 characterized (26). In contrast, the prostate cancer cell lines DU145 and PC-3 synthesize and secrete abundant galectin-1, implying that these cell lines are resistant to death triggered by galectin-1 (25). Similarly, a PSA LNCaP subclone showed a >25-fold increase in expression of galectin-1 mRNA and increased expression of galectin-1 protein, compared with androgen-dependent PSA+ LNCaP cells (32, 33). Because loss of PSA expression is correlated with progression to a more aggressive tumor, the robust expression of galectin-1 by PSA LNCaP cells suggested a correlation between increasing galectin-1 expression and prostate cancer cell progression. Similarly, Castronovo and colleagues have found that increasing expression of galectin-1 in prostate tumor stroma correlates with tumor aggressiveness and poor prognosis in prostate cancer patients, implying that tumor cell acquisition of resistance to galectin-1induced cell death confers a selective advantage to tumor cells that can evade galectin-1induced cell death (14). Moreover, recent work in a murine melanoma model showed that melanoma expression of galectin-1 induced death of infiltrating T cells, whereas suppression of tumor cell expression of galectin-1 enhanced CD8 T-cell attack of the tumor (34). We have directly shown that galectin-1 in extracellular matrix can kill infiltrating T cells (35). Thus, resistance to galectin-1 apoptosis may enhance prostate cancer cell metastasis as well as evasion of an immune response.
As mentioned above, the specific glycan ligands bound by galectin-1 to trigger cell death have not been identified in prostate cancer cells. In the present study, we identify a specific glycan structure required for galectin-1 to induce death of LNCaP cells. Importantly, this glycan ligand on LNCaP cells that is required for susceptibility to galectin-1induced cell death is the same structure required for T-cell susceptibility to galectin-1 (29, 30); as prostate cancer cells do not express the T-cell glycoprotein receptors that participate in galectin-1induced cell death (CD45, CD43, and CD7; refs. 30, 36, 37), these data indicate that galectin-1induced death of epithelial and mesenchymal cells involves a common saccharide ligand that can be attached to different polypeptide backbones on different cell types. Finally, we find that prostate cancer cells expressing galectin-1 are potent inducers of T-cell apoptosis, supporting the model that galectin-1 expression by tumor cells promotes evasion of an immune response (34, 35, 38).
| Materials and Methods |
|---|
|
|
|---|
Galectin-1 detection. For immunofluorescence microscopy, LNCaP, DU145, and PC-3 were grown for 48 h on glass coverslips until 50% confluent. Cells were fixed with 2% paraformaldehyde in PBS for 30 min on ice, washed with PBS, stained with polyclonal rabbit anti-human galectin-1 antibody (1:500), and bound antibody was detected with fluorescein-conjugated goat anti-rabbit immunoglobulin G (IgG; 1:300; Jackson Immunochemical) exactly as previously described (30). Slides were analyzed using an Axioskop 2 plus microscope and Axiovision 3.1 software (Zeiss).
For immunoblotting, subconfluent monolayers of prostate cells were removed from plates with PBS-EDTA (5 mmol/L). Cells were lysed in lysis buffer (50 mmol/L Tris-Cl, 1% NP40, 5 mmol/L EDTA, 1 mmol/L phenylmethylsulfonyl fluoride, 10 µg/mL aprotinin, 10 µg/mL leupeptin, 150 mmol/L NaCl) for 30 min on ice, samples centrifuged to pellet nuclei, and protein concentrations of the supernatants determined by Bio-Rad Protein Assay (Bio-Rad). Equal amounts of total cell protein (20 µg/lane) were separated by SDS-PAGE and transferred to nitrocellulose membranes; membranes were blocked with 10% nonfat milk and incubated overnight at 4°C with rabbit polyclonal antibody to galectin-1 (1:1,000). Membranes were washed in TBS with 0.5% Tween and incubated with horseradish peroxidaseconjugated goat anti-rabbit reagent (1:1,000; Bio-Rad). Samples were visualized with Hyperfilm enhanced chemiluminescence (Amersham). To detect equal loading, blots were stripped and reprobed with anti-actin (1:5,000; Sigma-Aldrich).
ELISA quantification of cell-surface galectin-1 was done exactly as in ref. 35, with 0.02 x 106 to 2 x 106 of the indicated cells added per well, using antigalectin-1 IgG purified from rabbit polyclonal antiserum to galectin-1. Galectin-1 concentration was determined based on a standard curve using purified recombinant galectin-1.
Galectin-1 prostate cell death assays. Subconfluent monolayers of prostate cell lines grown in 35-mm six-well plates were treated with 20 µmol/L galectin-1 in a final volume of 2-mL PBS with 1.2 mmol/L DTT for 5 h at 37°C. Control samples included cells treated with PBS/1.2 mmol/L DTT only (galectin-1 buffer control) and cells treated with 100 mmol/L lactose for 5 min before galectin-1 to show saccharide-specific galectin-1induced cell death. The supernatant was removed and adherent cells were treated with 2 mL of 0.25% trypsin-EDTA (Life Technologies) and collected with a plastic scraper, resuspended by gentle pipetting in PBS, and labeled by terminal deoxynucleotide dUTP nick end labeling (TUNEL) using the APO-DIRECT kit (PharMingen). Data were acquired on a FACScan flow cytometer (Becton Dickinson) to detect FITC-labeled DNA and analysis was done with CellQuest software. Single cells were discriminated by analysis of DNA width versus DNA area, and only single cells were analyzed for TUNEL labeling.
Flow cytometric analysis of cellular glycosylation. Subconfluent LNCaP cells were treated with 2 mmol/L benzyl-
-N-acetylgalactosamine (benzyl-
-GalNAc) in ethanol, with 25 µmol/L deoxymannojirimycin (DMNJ) dissolved in media (Calbiochem), or with appropriate buffer controls for 72 h at 37°C. Cells were resuspended with PBS-EDTA and washed with PBS. LNCaP cells (1 x 106) were stained with 5 µL (1 mg/mL) of biotin-conjugated peanut agglutinin (PNA) or phytohemagglutinin (PHA) lectins (EY Laboratories) for 30 min on ice. Cells were washed and bound lectin was detected with phycoerythrin-conjugated streptavidin for 20 min on ice. Cells were washed and analyzed by flow cytometry. Data were acquired using a FACScan flow cytometer and analyzed with CellQuest software.
Analysis of glycosyltransferase gene expression in PSA+ and PSA LNCaP cells. Microarray analysis of differentially expressed genes in two LNCaP-derived prostate cancer cell lines was previously described (32). To validate differences in expression of the core 2 ß1,6-N-acetylglucosaminyltransferase (core 2 GnT) in the two cell lines, reverse transcription-PCR (RT-PCR) analysis was done. Briefly, RNA was isolated using Qiagen RNA isolation kit (Qiagen) and RT-PCR was done according to the protocol provided in the SuperScript One-Step RT-PCR with Platinum Taq (Invitrogen) using core 2 GnT forward (GCAATGAGTGCAAACTGGAAG) and core 2 GnT reverse (AATTGCCCGTAATGGTCAGTGTT) primers. Core 2 GnT RT-PCR products were quantified by spectrophotometric analysis (Ultraspec 2000, Pharmacia Biotech) on dilutions done until a linear range of product was observed. Values were normalized by comparison to expression of ß-actin (forward primer GCTCGTCGTCGACAACGGCTC and reverse primer CAAACATGATCTGGGTCATCTTCT).
Expression of ß-galactoside
2,3-sialyltransferase 1 in LNCaP cells. ß-Galactoside
2,3-sialyltransferase 1 (ST3Gal1) cDNA (ref. 39; gift of Dr. James Paulson, The Scripps Research Institute, La Jolla, CA) was subcloned into pcDNA3.1 (Invitrogen; pST3). Subconfluent monolayers of LNCaP cells were grown for 5 days before transfection in Opti-MEM I media (Life Technologies). Each 100-mm dish was transfected with 16.7 µg of pST3 or vector alone (control) in Lipofectin reagent (Life Technologies) following the manufacturer's protocol. Transfected cells were selected by culture in media with G418 (100 µmol/L; Life Technologies) for 3 days.
Prostate cell induction of T-cell death. CEM T cells (106; >98% viable by trypan blue exclusion) in RPMI were added to confluent monolayers of the indicated prostate cell lines for 8 h at 37°C. Plates were vigorously washed by pipetting with PBS or with 0.1 mol/L lactose in PBS to recover T cells. The recovered cells were washed with PBS and assayed by flow cytometric detection of TUNEL labeling (described above) to detect T-cell death. Forward versus side scatter analysis of the cells was used to discriminate T cells from any nonadherent prostate cells that were removed during the wash step; nonadherent prostate cells were <5% of total cells analyzed in all experiments. As a positive control for T-cell death, 106 CEM cells were treated with 20 µmol/L recombinant human galectin-1 or buffer alone. Data were acquired using a FACScan flow cytometer and analyzed with CellQuest software.
| Results |
|---|
|
|
|---|
|
O-Glycans on cellular glycoproteins are required for LNCaP susceptibility to galectin-1induced death. As shown in Fig. 1, galectin-1induced death of LNCaP cells requires galectin-1 binding to saccharide ligands on the cells. Galectin-1 preferentially binds to galactose-terminated saccharide ligands, particularly to lactosamine (Galß1,4GlcNAc) sequences that can be found on N- or O-linked glycans on cell-surface glycoproteins (27, 2931). These lactosamine sequences can be elongated to form polylactosamine structures that are high-avidity ligands for galectin-1. On N-glycans, elongation of polylactosamine sequences is typically initiated by the action of the N-acetylglucosaminyltransferase V enzyme, whereas on O-glycans, elongation of polylactosamine sequences is typically initiated by the action of the core 2 GnT enzyme (29). Because the lactose inhibition data in Fig. 1D showed that galectin-1induced death of LNCaP cells required galectin-1 binding to saccharide ligands on the cell surface, we asked if galectin-1induced death of LNCaP cells required N- or O-glycan structures.
We used inhibitors to modify glycosylation of N- and O-glycans. The inhibitor DMNJ modifies N-glycans by inhibiting mannosidase II, the enzyme that trims high-mannose structures on N-glycans to allow subsequent addition of N-acetylglucosamine residues and elongation of lactosamine sequences (31). Loss of N-acetylglucosamine sequences, particularly on the glycan branch modified by N-acetylglucosaminyltransferase V, can be detected by loss of staining with the plant lectin PHA. As shown in Fig. 2A
, treatment of LNCaP cells with DMNJ markedly reduced PHA staining, indicating the effectiveness of DMNJ treatment in reducing lactosamine addition to N-glycans. To modify O-glycan elongation, we used benzyl-
-GalNAc that can modify O-glycan elongation in two different ways (3941). In cells with low amounts of sialylated O-glycans, benzyl-
-GalNAc blocks elongation of O-glycans beyond the initial GalNAc residue (Fig. 3
), an effect that can be detected by reduced reactivity with the plant lectin PNA. In cells with high levels of sialylated O-glycans, benzyl-
-GalNAc inhibits O-glycan sialylation, resulting in exposure of nonsialylated O-glycans and increased PNA reactivity. As shown in Fig. 2B, treatment of LNCaP cells with benzyl-
-GalNAc resulted in increased PNA binding, indicating that the inhibitor treatment increased exposure of nonsialylated O-glycans on these cells.
|
|
-GalNAc were assessed for sensitivity to galectin-1induced cell death. Treatment with DMNJ had no significant effect on LNCaP cell susceptibility to galectin-1 (Fig. 2C); as DNMJ treatment did not reduce LNCaP susceptibility to galectin-1, complex N-glycans bearing lactosamine sequences are not required for galectin-1induced death of these cells. In contrast, treatment of LNCaP cells with benzyl-
-GalNAc, causing increased exposure of nonsialylated O-glycans, resulted in a dramatic increase in sensitivity to galectin-1induced cell death, with virtually 100% of the cells dying in response to galectin-1 (Fig. 2D). These results indicated that O-glycans on cell-surface glycoproteins regulate LNCaP cell sensitivity to galectin-1induced cell death. Galectin-1resistant PSA LNCaP cells have decreased expression of core 2 GnT. PSA LNCaP cells express abundant galectin-1 and are resistant to galectin-1induced death (32), whereas both PSA+ and PSA LNCaP cells were susceptible to Fas-induced death, indicating that PSA LNCaP cells are not generally resistant to apoptosis.5 This implied that specific differences in expression of glycan ligands between PSA and PSA+ LNCaP cells might be responsible for differential susceptibility to galectin-1induced death. To identify candidate glycosyltransferase genes that would promote susceptibility to galectin-1 in LNCaP cells, we compared patterns of glycosyltransferase gene expression between PSA+ LNCaP and PSA LNCaP clones (32). We examined 120 glycosyltransferase genes in the U95 Affymetrix array, focusing on enzymes that participate in O-glycan synthesis. Of all glycosyltransferases examined, the enzyme with the most profound difference in expression between the PSA+ and PSA LNCaP cells was core 2 GnT, which initiates branched structures on O-glycans (Fig. 3). Core 2 GnT expression was reduced almost 5-fold in PSA LNCaP cells compared with PSA+ LNCaP cells in the microarray analysis (Fig. 4A ). We confirmed reduced expression of core 2 GnT mRNA in PSA LNCaP cells compared with PSA+ LNCaP cells by RT-PCR analysis (Fig. 4B).
|
Blocking O-glycan elongation protects LNCaP cells from galectin-1induced death. To directly address the role of O-glycans in regulating LNCaP susceptibility to galectin-1, we attempted to decrease core 2 GnT expression in LNCaP cells using small interfering RNA. However, despite repeated attempts, we were unable to reduce core 2 GnT enzyme expression below 40% of control; whereas we observed a concomitant reduction in the level of core 2 GnT protein by immunoblotting, this level of reduction of core 2 GnT enzyme activity did not appreciably alter cellular glycosylation as detected by PNA binding, nor did we detect a reduction in susceptibility to galectin-1induced death (data not shown). Thus, as an alternate approach to block O-glycan elongation, we transfected LNCaP cells with cDNA encoding ß-galactoside ST3Gal1 (39). This sialyltransferase competes with core 2 GnT in the Golgi, adding sialic acid to nascent O-glycans and blocking O-glycan elongation (refs. 39, 42; Fig. 3). We have previously found that overexpression of ST3Gal1 is an effective method of blocking O-glycan elongation in T cells (39). As shown in Fig. 5A , expression of ST3Gal1 in LNCaP cells reduced PNA binding to the cells, showing the effectiveness of ST3Gal1 expression in blocking O-glycan elongation. Furthermore, ST3Gal1 expression resulted in a marked reduction in LNCaP cell susceptibility to galectin-1induced cell death (Fig. 5B and C). Cells expressing the ST3Gal1 showed >60% reduction in TUNEL-positive cells following galectin-1 binding, compared with cells transfected with vector alone. These results show that changes in O-glycan expression and degree of O-glycan sialylation regulate LNCaP cell susceptibility to galectin-1induced cell death.
|
50% of T cells adherent to PC-3 cells (Fig. 6C). T cells were directly treated with purified recombinant galectin-1 as a positive control (Fig. 6C). Thus, prostate cancer cells that have acquired resistance to galectin-1induced death can express endogenous galectin-1 that can kill T cells, supporting the model that tumor expression of galectin-1 promotes tumor immune privilege.
|
| Discussion |
|---|
|
|
|---|
Importantly, our group previously found that O-glycans on T cells are critical for susceptibility to galectin-1 (29, 30). In T cells, elongation of O-glycans by core 2 GnT modifies several cell-surface glycoproteins, including CD45 and CD43, required for conferring susceptibility of CD45+ T cells to galectin-1 (30). We have also recently determined that malignant T cells from some patients with cutaneous T-cell lymphoma have aberrant cell-surface glycosylation and are thus resistant to galectin-1induced cell death (8). Specifically, we identified malignant T cells from one patient with a single point mutation in core 2 GnT that abrogated enzyme activity and conferred galectin-1 resistance (46). We found that core 2 GnT is highly expressed in parental PSA+ LNCaP cells that are susceptible to galectin-1induced death and markedly reduced in PSA LNCaP cells that produce abundant galectin-1 and are resistant to galectin-1induced cell death. Thus, we have now found reduced core 2 GnT expression or activity correlating with resistance to galectin-1induced cell death in prostate cancer cells and T lymphoma cells. Whereas the LNCaP cell-surface glycoproteins that can be modified by core 2 GnT are not known, it is clear that LNCaP cells do not express CD45 and CD43, the glycoproteins on T cells that bear core 2 O-glycans and are receptors for galectin-1. Thus, a common O-glycan modification on different polypeptides may regulate susceptibility of both prostate cancer cells and T cells to galectin-1.
Masking glycan ligands by the addition of sialic acid is a common glycosylation change described in many types of cancer. As mentioned above, PSA from prostate cancer patients contains more terminal
2,3-linked sialic acid compared with PSA from patients with benign prostatic hyperplasia (18). As we have previously shown with T cells (39), overexpression of ST3Gal1 was an effective method to block O-glycan elongation on LNCaP cells, as ST3Gal1 competes with several O-glycanmodifying enzymes, including core 2 GnT, in the Golgi (42), and increased ST3Gal1 expression made the LNCaP cells resistant to galectin-1induced death. Increased sialylation of tumor cell glycans may enhance tumor cell adhesion, invasion, and resistance to apoptosis. Conversely, our results imply that reducing sialylation and/or increasing O-glycan branching in tumor cells may be an effective mechanism to enhance tumor cell susceptibility to death induced by endogenous galectin-1.
Whereas several features of the T-cell death pathway triggered by galectin-1 have been described, we know very little about the mechanism of galectin-1induced death of prostate cells. As prostate cells do not express the T-cell glycoprotein receptors CD45, CD43, and CD7 that are involved in galectin-1induced T-cell death, different prostate cell glycoproteins that bear the appropriate glycan ligands and bind galectin-1 may transmit the death signal into prostate cancer cells. In this regard, prostate cell-surface glycoproteins that have functions similar to those of CD45, CD43, and CD7 (i.e., tyrosine phosphatase, association with ezrin/radixin/moesin cytoskeletal linker proteins, and induction of tyrosine and lipid kinase activities, respectively) may be good candidates for the prostate-specific glycoprotein receptors that bind galectin-1 and trigger cell death. Intriguingly, neutral endopeptidase (also known as CD10) is a prostate cell glycoprotein that, like CD43 on T cells, bears O-glycans, associates with ERM linker proteins, and facilitates apoptosis, and CD10 expression decreases during prostate cancer progression (47, 48); our lab is currently investigating the role of CD10 in LNCaP cell susceptibility to galectin-1.
Resistance to galectin-1induced apoptosis would confer an obvious selective advantage to prostate cancer cells; however, why would galectin-1resistant prostate cancer cells make and externalize endogenous galectin-1? As we have shown, PSA LNCaP cells that are resistant to galectin-1induced death synthesize high levels of galectin-1, compared with the galectin-1sensitive PSA+ LNCaP cells (32). As mentioned above, galectin-1 in prostate cancer stroma has been proposed to provide an "immunologic shield" around tumor cells, preventing infiltration of tumor-specific CTLs (14, 35). Indeed, loss of galectin-1 expression by melanoma cells increased CD8 T-cell attack of tumor cells in a murine model (34). In this report, we have directly shown that prostate cancer cells expressing galectin-1, including PSA LNCaP cells and PC-3 cells, induce rapid death of bound T cells, as detected by TUNEL analysis of the T cells, whereas PSA+ LNCaP cells did not kill bound T cells. These data indicate that prostate cancer cells resistant to galectin-1induced death could exploit endogenous galectin-1 to kill infiltrating T cells. Tumor evasion of an immune response contributes substantially to expansion of the primary tumor, outgrowth of residual disease following surgical resection, and survival of metastases; adjunct immunotherapy approaches have included increasing T-cell infiltration into the prostate by triggering tumor cell apoptosis, enhancing tumor antigen presentation, and potentiating T-cell responses by blocking inhibitory CTLA-4 signals (49, 50). As mentioned above, altering tumor cell glycosylation could restore susceptibility to galectin-1 produced by tumor cells as well as tumor-associated stroma and endothelium, to make tumor cells, rather than T cells, targets of galectin-1. In combination with strategies to augment T-cell responses, this approach may enhance the effectiveness of prostate cancer therapy.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank James He, Joseph Hernandez, Shuguang Bi, Luciana Kohatsu, Mabel Pang, and Leland Powell for advice and discussion, and Michael Teitell for critical reading of the manuscript.
| Footnotes |
|---|
Received 12/13/05. Revised 3/30/07. Accepted 4/26/07.
| References |
|---|
|
|
|---|
1,3-fucosyltransferase increases tumor growth of the PC-3 human prostate cancer cell line through enhanced adhesion to prostatic stromal cells. Int J Cancer 2003;107:94957.[CrossRef][Medline]
-N-acetylgalactosamine-O-serine/threonine conjugate vaccine. J Clin Oncol 2003;21:42928.
2,3-sialyltransferase expression correlates with conversion of peanut agglutinin (PNA)+ to PNA phenotype in developing thymocytes. J Biol Chem 1993;268:38014.
-GalNAc inhibits sialylation of O-glycosidic sugar chains on CD44 and enhances experimental metastatic capacity in B16BL6 melanoma cells. Anticancer Res 1996;16:357784.[Medline]
-O-bn in mucosal cell lines: an effect mediated through the intracellular synthesis of complex GalNAc
-O-bn oligosaccharides. Front Biosci 2001;6:D123544.[Medline]
degradation. Cancer Res 2000;60:65906.This article has been cited by other articles:
![]() |
Y. Zhuo, R. Chammas, and S. L. Bellis Sialylation of {beta}1 Integrins Blocks Cell Adhesion to Galectin-3 and Protects Cells against Galectin-3-induced Apoptosis J. Biol. Chem., August 8, 2008; 283(32): 22177 - 22185. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Stowell, Y. Qian, S. Karmakar, N. S. Koyama, M. Dias-Baruffi, H. Leffler, R. P. McEver, and R. D. Cummings Differential Roles of Galectin-1 and Galectin-3 in Regulating Leukocyte Viability and Cytokine Secretion J. Immunol., March 1, 2008; 180(5): 3091 - 3102. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L. J. L. Thijssen, F. Poirier, L. G. Baum, and A. W. Griffioen Galectins in the tumor endothelium: opportunities for combined cancer therapy Blood, October 15, 2007; 110(8): 2819 - 2827. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |