Cancer Research Meeting Calendar  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 67, 6163, July 1, 2007. doi: 10.1158/0008-5472.CAN-06-3348
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lange, K.
Right arrow Articles by Orend, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lange, K.
Right arrow Articles by Orend, G.

Cell, Tumor, and Stem Cell Biology

Endothelin Receptor Type B Counteracts Tenascin-C–Induced Endothelin Receptor Type A–Dependent Focal Adhesion and Actin Stress Fiber Disorganization

Katrin Lange1, Martial Kammerer1, Monika E. Hegi3,4, Stefan Grotegut1, Antje Dittmann1, Wentao Huang1, Erika Fluri1, George W. Yip5, Martin Götte6, Christian Ruiz2 and Gertraud Orend1

1 Center for Biomedicine, Department of Clinical and Biological Sciences and 2 Institute of Pathology, University of Basel, Basel, Switzerland; 3 Laboratory of Tumor Biology and Genetics, Neurosurgery, University Hospital Lausanne, Lausanne, Switzerland; 4 National Center of Competence in Research (NCCR) in Molecular Oncology, Swiss Institute for Experimental Cancer Research, Epalinges sur Lausanne, Switzerland; 5 Department of Anatomy, Yong Loo Lin School of Medicine, National University of Singapore, Singapore, Singapore; and 6 Department of Obstetrics and Gynecology, Münster University Hospital, Münster, Germany

Requests for reprints: Gertraud Orend, Center for Biomedicine, Department of Clinical and Biological Sciences, University of Basel, Mattenstrasse 28, 4058 Basel, Switzerland. Phone: 41-61-267-35-41; Fax: 41-61-267-35-66; E-mail: gertraud.orend{at}unibas.ch.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tenascin-C, an extracellular matrix molecule of the tumor-specific microenvironment, counteracts the tumor cell proliferation–suppressing effect of fibronectin by blocking the integrin {alpha}5ß1/syndecan-4 complex. This causes cell rounding and stimulates tumor cell proliferation. Tenascin-C also stimulates endothelin receptor type A (EDNRA) expression. Here, we investigated whether signaling through endothelin receptors affects tenascin-C–induced cell rounding. We observed that endothelin receptor type B (EDNRB) activation inhibited cell rounding by tenascin-C and induced spreading by restoring expression and function of focal adhesion kinase (FAK), paxillin, RhoA, and tropomyosin-1 (TM1) via activation of epidermal growth factor receptor, phospholipase C, c-Jun NH2-terminal kinase, and the phosphatidylinositol 3-kinase pathway. In contrast to EDNRB, signaling through EDNRA induced cell rounding, which correlated with FAK inhibition and TM1 and RhoA protein destabilization in the presence of tenascin-C. This occurred in a mitogen-activated protein kinase/extracellular signal-regulated kinase kinase–dependent manner. Thus, tumorigenesis might be enhanced by tenascin-C involving EDNRA signaling. Inhibition of tenascin-C in combination with blocking both endothelin receptors could present a strategy for sensitization of cancer and endothelial cells toward anoikis. [Cancer Res 2007;67(13):6163–73]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cancer is a product of the tumor-host microenvironment, where mutual stimulation of tumor and stromal cells induces tumor formation and progression into malignant metastasizing cancers. The adhesion modulatory extracellular matrix molecule tenascin-C is one factor in the tumor-specific microenvironment that is highly expressed in most solid tumors. Tenascin-C actions promote malignant transformation, uncontrolled proliferation, metastasis, angiogenesis, and escape from tumor immunosurveillance. Tenascin-C acts very early during malignant transformation as well as throughout tumor progression through distinct effects on various cell types within a tumor (1). We and others have previously shown that tenascin-C inhibits the tumorigenesis-suppressing activity of integrin {alpha}5ß1-mediated cell adhesion to fibronectin by blocking syndecan-4 (2, 3) and downstream RhoA (4) and focal adhesion kinase (FAK; refs. 2, 5, 6) activation. This in turn triggers tumor cell proliferation, presumably by overriding the G0 and G1-S cell cycle checkpoints (7). Moreover, tenascin-C can activate a variety of oncogenic signaling pathways, such as epidermal growth factor receptor (EGFR; refs. 8, 9), extracellular signal-regulated kinase (ERK)/mitogen-activated protein kinase (MAPK), and Wnt, and can down-regulate the tumor suppressor–like molecule tropomyosin-1 (TM1; ref. 10).

Endothelins (ET1, ET2, and ET3) and their G protein–coupled receptors endothelin receptor (EDNR) subtypes A and B were originally found to be involved in the regulation of blood pressure (11). Endothelin receptor signaling plays an important role during embryonic development and in physiologic processes, such as neurotransmission, renal function, and regulation of cell proliferation (12). EDNRB signaling has a promigratory and proliferative effect on microvascular endothelial cells (13). Signaling through EDNRA also stimulated angiogenesis particularly by induction of vascular endothelial growth factor (14, 15). ET1 activates phospholipase C (PLC) ß, thus increasing intracellular calcium ion levels and activation of protein kinase C. It also activates phosphatidylinositol 3-kinase (PI3K), c-Jun NH2-terminal kinase (JNK), ERK/MAPK, and EGFR signaling. Moreover, ET1-induced signaling leads to activation of FAK and paxillin (16). Because signaling by EDNRA and EDNRB plays an important role in endothelial cell proliferation and survival, blocking these receptors provides a promising approach in clinical treatment of systemic pulmonary hypertension and chronic heart failure (17). Inhibition of endothelin receptor signaling may also be useful in cancer therapy because inhibition of EDNRB with a selective pentapeptidic antagonist (BQ788) inhibited growth of human melanoma cells in cell culture and in the nude mouse (18). In advanced prostate cancer, treatment with an EDNRA-selective inhibitor (ABT-627) delayed disease progression in patients with hormone-refractory prostate cancer (19).

We showed that tenascin-C induces expression of EDNRA. This was accompanied by enhanced phosphorylation of ERK1/2 and induction of c-Fos (10), all downstream targets of EDNRA. Here, we investigated the possibility that EDNRA signaling contributes to the tenascin-C–induced cell phenotype. We show that EDNRA signaling induced cell rounding in the presence of tenascin-C. This occurred by blocking FAK and paxillin activation and inhibiting RhoA and TM1 protein stability in a MAPK/ERK kinase (MEK)-dependent manner. In contrast to EDNRA, signaling by EDNRB counteracted cell rounding by tenascin-C and stimulated cell spreading on a fibronectin/tenascin-C (FN/TN-C) substratum in an EGFR-, PLC-, JNK-, and PI3K-dependent but MEK-independent manner. In the absence of syndecan-4 activation, EDNRB signaling restored focal adhesion assembly by activating FAK and paxillin and reorganized the actin cytoskeletal by normalizing RhoA and TM1 expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Construction and purification of his-tagged human tenascin-C. The cDNA encoding human tenascin-C (HxBL.pBS) encompassing all alternative fibronectin type III repeats (20) was subcloned into the pCEP-Pu vector (21). A COOH-terminal his-tag (six additional his residues) was introduced by PCR with primer PhTN-C R-2 (CGGGATCCTAATGATGATGATGATGATGATGTGCCCGTTTGCGCCT). A three-piece ligation of NotI/NdeI, a NdeI/6his-BamHI and a NotI/BamHI vector fragments, gave rise to pCEP-huTNC-his. The construct was confirmed by restriction enzyme analysis, PCR, and partial sequencing. After transfection of pCEP-huTNC-his into HEK293-EBNA1 cells [American Type Culture Collection (ATCC)], human tenascin-C expression and secretion were determined by immunoblotting with the monoclonal antibody B28.13 (22). For large-scale production of recombinant human tenascin-C, 293:pCEP-huTNC-his cells were grown to confluency in the presence of 2.5 µg/mL puromycin (Sigma) in DMEM and 10% FCS. For collection of conditioned medium, cells were washed with PBS before growth in serum-free DMEM without puromycin for 2 days. Cells were recovered in DMEM supplemented with 10% FCS and 2.5 µg/mL puromycin for 1 day before transfer to serum-free medium. This cycle was repeated up to eight times with no reduction in yield during prolonged culture. Proteins from conditioned medium were ammonium sulfate precipitated and dialyzed against PBS/0.01%Tween 20 before chromatography on a gelatin-agarose column (Sigma). The eluate was passed over a nickel column (ProBond resin, Invitrogen), and bound tenascin-C was eluted with 300 mmol/L imidazole (Sigma), 250 mmol/L sodium phosphate (pH 7.4), 450 mmol/L NaCl, and 0.01% Tween 20 and dialyzed against PBS/0.01% Tween 20. The purity and absence of contamination by fibronectin was determined by GelCode staining and immunoblotting. The biological activity of recombinant human tenascin-C was compared with the chicken tenascin-C used previously (2). In cell adhesion assays, T98G cells were plated for different times onto pure tenascin-C, fibronectin, or mixed fibronectin and fibronectin/fibronectin type III repeat 13 (FNIII13) substrata containing human or chicken tenascin-C. As with chicken tenascin-C (2), cells did not spread on FN/TN-C unless syndecan-4 was activated with FNIII13. To test whether addition of a his-tag at the COOH terminus of tenascin-C interfered with heparin binding to the fibrinogen globe, heparin binding of chicken and human tenascin-C was compared by ELISA. No differences were detected (data not shown).

Cell plating, inhibitor studies, and preparation of cell lysates. Human T98G glioblastoma, J82 urinary bladder carcinoma, and MDA-MB435 breast carcinoma cells (ATCC) were grown in DMEM supplemented with antibiotics and 10% FCS (Sigma). Cells were transferred into DMEM and 10% FCS 24 h before the experiment and serum starved for 18 h. Cells were trypsinized and replated after inhibition of trypsin with 100 ng/mL trypsin inhibitor (Sigma) in serum-free DMEM onto 10-cm2 dishes (Falcon Becton Dickinson) coated with equimolar amounts of fibronectin and tenascin-C (1 µg/cm2). Finally, 1% heat-inactivated bovine serum albumin (BSA; Serva) was used to block the uncoated surface before UV sterilization for 15 min in a sterile bench. Because the inhibitors were dissolved in DMSO and DMSO interfered with cell spreading on fibronectin, cells were plated on the different substrata in serum-free medium 1 or 12 h before incubation with 100 ng/mL EGF, 20 nmol/L ET1, 20 nmol/L ET3, conditioned medium (taken from 48-h serum-free cultures of T98G cells), or inhibitor PKI166 (2 µmol/L; Novartis), UO126 (25 µmol/L; Calbiochem), wortmannin (20 µmol/L), SP600125 (20 mmol/L), U73122 (20 nmol/L), BQ123 (100 nmol/L), and BQ788 (100 nmol/L; Sigma) for 4 h followed by lysis in sample buffer [250 mmol/L Tris-HCl (pH 7.0), 10% SDS, 50% glycerol, bromphenol blue, 100 mmol/L DTT].

Immunoblotting. Equal amounts of protein were separated in 8% self-made or 4% to 12% precast Bis-Tris-glycine gels (Invitrogen, Novex), transferred onto polyvinylidene difluoride nylon membrane (Immobilon-P, Millipore), and stained with 0.2% Ponceau-S (Sigma) in 7.5% trichloroacetic acid for confirmation of equal protein loading before blocking the membrane in 10% horse serum (or 1% BSA), TBS, and 1% Tween 20. For immunoblotting, the following mouse monoclonal antibodies against TM1, TM2, and TM3 (TM311, 1:1,000; Sigma); vinculin (hVIN-1, 1:1,000; Sigma); {alpha}-tubulin (Ab-1, 1:5,000; Oncogene); RhoA (26C4, 1:1,000; Santa Cruz Biotechnology, Inc.); phosphorylated ERK1/2 (P-ERK1/2; 1:1,000; Cell Signaling); FAK and P-Y397-FAK (1:1,000; BD Biosciences); rabbit polyclonal antibodies, paxillin, and P-Y118-paxillin (1:1,000; Abcam); and ERK1/2 (1:1,000; Cell Signaling), P-S910-FAK (1:1,000; Biosource), and secondary horseradish peroxidase–coupled antibodies (Amersham) were used. Binding of antibodies was detected with enhanced chemiluminescence plus (Amersham).

Real-time reverse transcription-PCR. Total RNA was isolated from three independent plates using the RNeasy Mini kit (Qiagen) and RNase-free DNase set (Qiagen) following the manufacturer's instructions. From 0.5 to 1 µg of total RNA, single-strand cDNA was generated by using the SuperScript III First-Strand Synthesis Super Mix (Invitrogen) with random hexamers. Expression of the respective gene was detected by quantitative reverse transcription-PCR (RT-PCR) on an ABI Prism 7000 Taqman using SYBR Green PCR MasterMix (Applied Biosystems) with the following primers (5' to 3'): glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ATCTTCTTTTGCGTCGCCAG (forward) and AATCCGTTGACTCCGACCTTC (reverse); tenascin-C, TGCCCATATCTCAGGGCTAC (forward) and GATGCCATCCAGGAAACTGT (reverse); EDNRA, GCCATATTTTAGGACAGGTAAAATAACA (forward) and AACACACAAAAGGGCAGTACTTCTT (reverse; ref. 10); EDNRB, TCACCTAAAGCAGAGACGGGAA (forward) and AGGACCAGGCAAAAGACGG (reverse); {alpha}TM (TPM1), GCACCGAAGATGAACTGGACAA (forward) and CATCGGTGGCCTTTTTCTCTG (reverse); ßTM (TPM2), CCAACAACTTGAAATCCCTGG (forward) and CTTTGGTGGAATACTTGTCCGC (reverse); and RhoA, GCAGGTAGAGTTGGCTTTATGG (forward) and CTTGTGTGCTCATCATTCCGA (reverse; ref. 23). Primers were designed with the ABI Primer Express software (Applied Biosystems). Relative expression of the respective gene was determined after normalization to GAPDH and calculated with the following formula: relative expression level = 2{Delta}{Delta}CT.

Immunofluorescence. Cells were serum starved before plating on fibronectin and FN/TN-C for the indicated time points in serum-free medium plus ET1 or ET3. Cells were fixed in 4% paraformaldehyde and stained with the indicated primary and secondary FITC-labeled antibodies or with TRITC-labeled phalloidin (Sigma). Images were captured using a Nikon Diaphot300 (Nikon video microscope with OpenLab program) with 40x and 100x objectives for immunofluorescence and a Leica Leitz DMIL microscope with a 10x objective for phase contrast.

Tissue microarrays and immunohistochemistry. Tissue microarrays (TMA) with 190 glioblastoma and 158 gliomas WHO grade I to III have been constructed from archived paraffin blocks as described (24). Expression of tropomyosin and tenascin-C in gliomas grades I, II, and IV was determined by immunohistochemistry with antibody TM311 (dilution, 1:3,500) and B28.13 (22), respectively, as described before (10). The staining was scored semiquantitatively in a range of 0 to 3, independently by two researchers.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Kinetics of EDNRA induction by tenascin-C. We previously described that a tenascin-C–containing fibronectin substratum triggered EDNRA expression in T98G cells 12 h after contact with the substratum both at RNA and protein level (10). Here, we investigated the kinetics of EDNRA induction by tenascin-C with real-time RT-PCR. EDNRA RNA levels did not vary between cells plated on fibronectin or FN/TN-C at 1 and 3 h (Fig. 1A ). However, a slight and 2.7-fold increase was observed after 5 and 19 h, respectively, in cells plated on FN/TN-C. We also determined expression of EDNRB and found that, in contrast to EDNRA, RNA levels of EDNRB were low and did not change at any of the time points mentioned above (data not shown). Thus, in contrast to EDNRB, expression of EDNRA is strongly induced by tenascin-C at RNA and protein level.


Figure 1
View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Kinetics of EDNRA expression and restoration of cell adhesion by ET1 on FN/TN-C. A, expression of EDNRA was determined by real-time-RT-PCR in T98G cells on plating on fibronectin and FN/TN-C and after RNA preparation at the indicated time points. Expression of EDNRA on FN/TN-C is expressed as fold difference in comparison with fibronectin alone. GAPDH expression was used for normalization. T98G cells were plated for 4 h on fibronectin and on FN/TN-C in the presence and absence of ET1 before documentation of cell adhesion (B), lysis and immunoblotting for FAK, RhoA, TM1, and ERK1/2 (D), or immunofluorescent staining for polymerized actin (arrow) with TRITC-phalloidin and for focal adhesions (arrow) with an anti-vinculin antibody (C). Control: serum-free medium.

 
ET1 signaling restores cell adhesion on a FN/TN-C substratum. To examine whether EDNR signaling affects tenascin-C–induced cell rounding, we determined cell spreading of T98G cells on fibronectin in the presence and absence of tenascin-C on stimulation with the EDNR ligand ET1 in serum-free medium. As previously observed, we confirmed that cells did not spread on FN/TN-C. But stimulation with ET1 restored cell spreading on the FN/TN-C substratum (Fig. 1B). This was accompanied by actin stress fiber and focal adhesion formation 1, 4, and 12 h after plating of the cells (Fig. 1C; Supplementary Fig. S1).

To determine how ET1 inhibited tenascin-C–induced cell rounding, the expression and function of tenascin-C target molecules was assayed. T98G cells were grown for 4 h on fibronectin or FN/TN-C in the presence or absence of ET1. Cell extracts were then analyzed by immunoblotting for FAK, active FAK (P-Y397-FAK), RhoA, and TM1. Autophosphorylation of FAK at Y397 and expression of RhoA and TM1 were largely reduced in serum-free medium in the presence of tenascin-C. However, on stimulation with ET1, expression of P-Y397-FAK, RhoA, and TM1 was restored to levels observed on fibronectin alone. On fibronectin, ET1 also accelerated spreading and enhanced phosphorylation of FAK (Fig. 1D).

ET1 inhibits tenascin-C signaling through activation of EDNRB. T98G cells express two ET1 receptors: EDNRA (Fig. 1A) and EDNRB (25). To examine EDNR-specific effects, we analyzed cell adhesion on FN/TN-C in the presence of specific inhibitors for EDNRA (BQ123) and EDNRB (BQ788) on stimulation with ET1. T98G cells were plated for 1 or 12 h on fibronectin or FN/TN-C before addition of ET1 and the respective EDNR inhibitor. Cells were then analyzed for adhesion followed by lysis and immunoblotting. As shown in Fig. 2A , inhibition of EDNRB with BQ788 caused cell rounding, thus blocking ET1-induced cell spreading on FN/TN-C 5 h (data not shown) and 16 h after plating. Inhibition of EDNRB by BQ788 also blocked restoration of autophosphorylation of FAK and reexpression of RhoA and TM1 on FN/TN-C at 5 and 16 h (Fig. 2B). In contrast, the EDNRA-specific inhibitor BQ123 did not block restoration of cell spreading by ET1. Inhibition of EDNRA through BQ123 did also not affect FAK phosphorylation and RhoA and TM1 reexpression induced by ET1.


Figure 2
View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. EDNRB activation inhibits cell rounding on FN/TN-C. T98G cells were plated on fibronectin (data not shown) and FN/TN-C in serum-free medium for 1 h (B and C) and 12 h (A and B) before addition of ET1 in the presence and absence of the EDNRA and EDNRB inhibitors BQ123 and BQ788, respectively, for another 4 h. A, documentation of cell adhesion. B and C, immunoblotting for the indicated molecules. Control: serum-free medium plus DMSO.

 
To confirm that signaling specifically through EDNRB inhibits tenascin-C–induced cell rounding, T98G cells were stimulated with ET3, an EDNRB ligand that has several fold higher affinity for EDNRB than for EDNRA (11). Subsequently, cell adhesion was determined before lysis and immunoblotting. ET3 also stimulated cell spreading and formation of focal adhesions and actin stress fibers in the presence of tenascin-C (Fig. 1C). Moreover, spreading was EDNRB dependent because it was blocked with BQ788 (Supplementary Fig. S2A). As for ET1, activation of EDNRB with ET3 restored TM1 and RhoA expression and autophosphorylation of FAK in the presence of tenascin-C (Supplementary Fig. S2B).

ET1 restores cell spreading by mediating focal adhesion assembly. EDNRB signaling leads to cell matrix adhesion and appearance of numerous focal contacts even in the presence of tenascin-C (Fig. 1C). To investigate in more detail how EDNRB signaling could enhance focal adhesion assembly, we examined whether FAK was phosphorylated at S910, a site that is involved in binding of FAK to paxillin (26, 27). Whereas P-S910-FAK levels were low on FN/TN-C, phosphorylation of FAK at S910 returned to levels as on fibronectin on stimulation with ET1 (Fig. 2C). Next, we examined whether FAK was functional in phosphorylating paxillin at Y118, one of its cognate phosphorylation sites (28), after stimulation with ET1. In cells plated on FN/TN-C in the absence of ET1, phosphorylation at Y118 in paxillin was abolished (Fig. 2C). In contrast, cells plated on FN/TN-C in the presence of ET1 showed high levels of phosphorylated paxillin (Fig. 2C). Altogether, these data show that ET1 signaling through EDNRB restored FAK and paxillin activities in the presence of tenascin-C.

Activation of EDNRB induces cell spreading in an EGFR-, PLC-, PI3K-, and JNK-dependent manner. We next investigated by which pathway EDNRB inhibits tenascin-C–mediated cell rounding. Because EDNR signaling activates EGFR, we addressed whether EDNRB-induced cell spreading on FN/TN-C involves EGFR function. Cells were plated on FN/TN-C for 5 h together with ET1 and the inhibitor PKI166, which prevents autophosphorylation of EGFR (29). Cell adhesion was documented before lysis and immunoblotting. Inhibition of EGFR by PKI166 completely blocked cell spreading by ET1/EDNRB (Fig. 3A ). Moreover, as shown in Fig. 3B, PKI166 efficiently blocked ERK1/2 phosphorylation and ET1-induced TM1 and RhoA expression in the presence of tenascin-C. However, ET1-induced autophosphorylation of FAK was not affected by PKI166 (Fig. 3B). Thus, ET1 restores TM1 and RhoA protein expression in the presence of tenascin-C through activation of EGFR. In contrast, activation of FAK by EDNRB is independent of EGFR signaling, but FAK activation alone is not sufficient to mediate cell spreading.


Figure 3
View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. EDNRB activation induces cell spreading dependent on EGFR, PLC, PI3K, and JNK. T98G cells were plated on fibronectin or FN/TN-C for 1 h in serum-free medium before addition of ET1 and DMSO in the presence or absence of the respective inhibitors. A, documentation of cell adhesion. B to E, immunoblotting. Control: see Fig. 2.

 
ET1-treated cells were allowed to adhere on FN/TN-C in the presence of inhibitors for PLC, MEK, PI3K, and JNK. Inhibition of PLC with U73122 blocked ET1-induced cell spreading on FN/TN-C (Fig. 3A), which correlated with low levels of phosphorylated FAK, TM1, and RhoA (Fig. 3C). Examining MEK and PI3K downstream of EGFR and PLC revealed that the MEK inhibitor UO126 did not affect ET1-induced cell spreading on the tenascin-C substratum. This was in contrast to the PI3K inhibitor wortmannin that diminished cell spreading (Fig. 3A). Cell rounding by wortmannin correlated with largely reduced RhoA and TM1 levels and lack of FAK autophosphorylation in the presence of ET1 on FN/TN-C (Fig. 3D). These data suggest that EDNRB-induced cell spreading on FN/TN-C depends on EGFR, PLC, and PI3K but does not involve the MEK pathway.

Next, we examined whether JNK, a downstream effector of EDNR and EGFR signaling, is involved in cell spreading on FN/TN-C on activation of EDNRB. Inhibition of JNK with SP600125 not only prevented ET1-induced cell spreading (Fig. 3A) but also blocked FAK autophosphorylation and TM1 reexpression in the presence of tenascin-C, which was in contrast to RhoA, the expression of which was not altered on JNK inhibition (Fig. 3E). Altogether, these data suggest that EDNRB activation counteracts tenascin-C–induced cell rounding through EGFR and downstream PLC, JNK, and PI3K and that all three molecules, FAK, RhoA, and TM1, need to be active to allow cell spreading on FN/TN-C.

Inhibition of EDNRA induces cell spreading in the presence of tenascin-C. Because plating cells on a tenascin-C–containing substratum leads to increased expression of EDNRA, we asked whether EDNRA signaling could induce cell rounding in cells plated on FN/TN-C. We determined cell adhesion in the presence of both EDNR inhibitors at a time point when EDNRA expression was induced by tenascin-C. T98G cells were plated in serum-free medium for 12 h before addition of ET1 and the respective inhibitor for an additional 30 min (Supplementary Fig. S3) or 4 h (Fig. 4 ). We observed that, although cells were round 12 h after plating on FN/TN-C, they spread with ET1 in the presence of both inhibitors (Fig. 4A). Because inhibition of EDNRB by BQ788 prevented cell spreading (Fig. 2A), restoration of cell spreading under these conditions was due to inhibition of EDNRA. Already 30 min on addition of exogenous ET1, T98G cells were spread on FN/TN-C (Supplementary Fig. S3A). Thus, inhibition of EDNRA rapidly overcomes cell rounding on FN/TN-C. Simultaneous inhibition of both EDNRs in the absence of exogenously added ET1 also induced cell spreading, suggesting that EDNRA is active in the absence of exogenously provided ET1 (Fig. 4A; Supplementary Fig. S3A). EDNRA is presumably activated in T98G cells on FN/TN-C by secreted endothelins (25).7 To prove this possibility, cells on FN/TN-C were stimulated with conditioned medium derived from 48-h serum-free cultures of T98G cells. Cells remained round on the FN/TN-C substratum with conditioned medium but spread under these conditions on inhibition of EDNRA with BQ123 (Fig. 4A). Immunoblotting revealed that FAK autophosphorylation and expression of RhoA and TM1 were restored at 30 min (Supplementary Fig. S3B) and 4 h (Fig. 4B) on blocking of EDNRA. In addition, inhibition of both endothelin receptors enhanced ERK1/2 phosphorylation on FN/TN-C, which was in contrast to the control with very low P-ERK1/2 levels. To examine whether activation of EDNRA by tenascin-C causes rounding in MDA-MB435 breast carcinoma and J82 urinary bladder carcinoma cells that express EDNRA as determined by real-time RT-PCR,6 we determined adhesion of these cells on fibronectin and FN/TN-C on treatment with BQ123. As for T98G, these cells did not spread on FN/TN-C and inhibition of EDNRA with BQ123 restored cell spreading on FN/TN-C (Supplementary Fig. S4A). Thus, activation of EDNRA mediates rounding of all three cell lines by tenascin-C.


Figure 4
View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. EDNRA-induced cell rounding on FN/TN-C is MEK dependent. T98G cells were plated for 12 h (A and B) or 1 h (C and D) on fibronectin or FN/TN-C in serum-free medium before addition of conditioned medium (CM) from 48-h serum-free cultures, ET1, DMSO, BQ123, BQ788, and UO126. A and C, documentation of cell adhesion. B and D, immunoblotting for the indicated molecules.

 
EDNRA-specific cell rounding by tenascin-C is MEK dependent. We wanted to know whether the MAPK pathway, which blocks expression of TM1 (30, 31), is involved in EDNRA-stimulated inhibition of TM1 expression by tenascin-C. Therefore, cells plated onto FN/TN-C were stimulated with ET1 in the presence of the EDNRB inhibitor BQ788, which allows to determine signaling in response to EDNRA activation. Inhibition of the MEK pathway by UO126 restored cell spreading in combination with BQ788 (Fig. 4C). Thus, MEK is downstream of EDNRA. UO126 also normalized TM1 and RhoA expression and FAK autophosphorylation on FN/TN-C to levels as on fibronectin on treatment with ET1 and BQ788 (Fig. 4D). Thus, activation of MEK through EDNRA contributes to tenascin-C–induced cell rounding on fibronectin by blocking FAK activation and RhoA and TM1 expression.

Regulation of TM1 and RhoA RNA and protein levels on FN/TN-C. To determine whether tenascin-C affects RNA levels of {alpha}TM (coding for TM2 and TM3), ßTM (coding for TM1), and RhoA, a real-time RT-PCR experiment was done on RNA prepared from cells that were grown in the presence or absence of tenascin-C for different time points. In T98G cells, RNA levels of {alpha}TM started to drop at 5 h and remained about 40% to 50% below those on fibronectin after 19 h on FN/TN-C (Fig. 5A ). A similar observation was made for J82 cells (Supplementary Fig. S5B). This was in contrast to earlier time points (1 and 3 h) where no substratum-specific differences in {alpha}TM expression were observed in T98G cells (Fig. 5A). Similarly, ßTM and RhoA RNA levels were not down-regulated on FN/TN-C in comparison with fibronectin at any time point (Fig. 5B and C). These results show that RNA levels of {alpha}TM, ßTM, and RhoA are not reduced in the presence of tenascin-C at early time points.


Figure 5
View larger version (10K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Regulation of {alpha}TM, TM1, and RhoA RNA and protein levels on FN/TN-C. T98G cells were plated on fibronectin or FN/TN-C for the indicated time points (A–C) and 5 h (D) in serum-free medium (A–C), EGF, and ALLN (D) before RNA extraction and real-time RT-PCR (A–C) and lysis and immunoblotting (D).

 
Next, we examined TM1 and RhoA protein stability on FN/TN-C and observed that TM1 and RhoA protein levels were restored on FN/TN-C to levels as observed on fibronectin on treatment with the proteasome and calpain inhibitor ALLN (Fig. 5D). In contrast, phosphorylation of FAK was not restored with ALLN and this observation correlated with the inability of cells to spread on FN/TN-C under these conditions (Table 1 ).


View this table:
[in this window]
[in a new window]

 
Table 1. Summary of cellular signaling in response to tenascin-C on modulation of EDNRA and EDNRB activation

 
Because {alpha}TM levels dropped significantly after 19 h, and BQ123 restored TM1 expression on FN/TN-C, we examined whether EDNRA signaling contributed to reduced {alpha}TM RNA levels in T98G and J82 cells. But inhibition of EDNRA by BQ123 only slightly increased {alpha}TM levels on FN/TN-C in both cell lines (Supplementary Fig. S5). In summary, our data suggest that enhanced proteolysis of TM1 and RhoA is the major mechanism by which EDNRA negatively regulates expression of RhoA and TM1 on FN/TN-C.

Expression of tenascin-C and EDNRA in cancer tissue. Next, we compared gene expression levels of tenascin-C and EDNRA in 80 glioblastoma and 4 nontumoral brain tissues (GeneChip U133Plus, Affymetrix;8 ref. 32) and by systematically evaluating gene expression changes using the Oncomine 3.1 platform (33). Tenascin-C and EDNRA mRNA expression revealed some correlation in glioblastoma (Pearson correlation = 0.47) with high expression in gliomas and low expression in nontumoral brain tissue (Fig. 6A ; Supplementary Table S1). This is compatible with the notion that tenascin-C might have some role in EDNRA regulation in glioblastoma. Moreover, the majority of glioblastoma exhibited also a high expression of EDNRB (Fig. 6A; Supplementary Table S1) with EDNRA and EDNRB showing a negative correlation (Pearson correlation = –0.25; Fig. 6A). On protein level, as determined by immunohistochemistry on TMAs, tropomyosin expression displayed different staining patterns. Tumor tissue was homogenously positive or negative for TM1-3 whereas staining of aberrant blood vessels was prominent in most tumors (Fig. 6B). There was neither a correlation of TM1-3 protein expression with tumor grade (P = 0.09, Fisher's exact test) nor TM1-3 expression with tenascin-C protein expression (P = 0.09, Fisher's exact test) in glioblastoma. These observations suggest that other factors than tenascin-C influence tropomyosin expression in gliomas under steady-state conditions in a cell type–specific manner.


Figure 6
View larger version (60K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Expression of tenascin-C, EDNR, and tropomyosin in gliomas. A, gene expression of tenascin-C (TNC) and potential mediators as ordered by sorting points into neighborhoods (SPIN) analysis (32) for 80 glioblastoma. The ordering of points is iteratively permutated in search of a linear ordering. Expression is represented in a color scale (log2) as determined on GeneChip 133Plus2. B, four representative examples of immunohistochemical staining for TM1-3 of a glioma TMA.

 
Searching the Oncomine database for a potential linked expression of tenascin-C and EDNRA in other human cancers revealed a high tenascin-C expression and increased EDNRA expression in malignant pancreatic ductal carcinoma, seminoma, bladder carcinoma, and breast carcinoma and in metastatic ovarian carcinoma (Supplementary Fig. S6; Supplementary Table S1). On the contrary, a lowered tenascin-C expression in metastatic prostate and a subset of colon carcinoma correlated with reduced EDNRA expression. These observations are compatible with a potential regulation of EDNRA by tenascin-C in these cancers. EDNRB and {alpha}TM were also increased in glioma, ovarian carcinoma, breast carcinoma, seminoma, and pancreatic ductal carcinoma (Supplementary Table S1), which also matches with a potential regulation of {alpha}TM by EDNRB in these cancers.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previously, we and others showed that the function of FAK (2, 5), RhoA (4), and TM1 (10) is compromised in cells grown on FN/TN-C. This occurred in a syndecan-4–dependent manner because activation of syndecan-4 restored cell spreading and FAK activation in the presence of tenascin-C (Fig. 7A ; refs. 2, 5). Here, we observed that tenascin-C does not only interfere with RhoA activation (4) but also with RhoA protein stability. Moreover, we showed a complex repression of TM1 by tenascin-C. Although TM1 protein levels were reduced by tenascin-C, RNA levels were not lowered by tenascin-C at any time point up to 19 h. In contrast, TM1 protein stability is largely reduced by tenascin-C because inhibition with ALLN restored TM1 protein levels on FN/TN-C. After 19 h, RNA levels of {alpha}TM coding for TM2 and TM3, which are less expressed in T98G cells, significantly dropped. Reduced {alpha}TM levels might contribute to reduced TM1 expression because TM1 forms heterodimers with TM2 and TM3.


Figure 7
View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 7. Tenascin-C induces EDNRA signaling that is counteracted by EDNRB. A, on activation of integrin {alpha}5ß1 and syndecan-4 by fibronectin, cells activate FAK and RhoA upstream of TM1, which leads to actin polymerization and filament stabilization and subsequent cell spreading. PKC{alpha}, protein kinase C{alpha}. B, tenascin-C induces EDNRA expression and EDNRA-induced MEK-dependent signaling causes enhanced proteolysis of TM1 and RhoA. This leads to cell rounding on a FN/TN-C substratum. In contrast to EDNRA, signaling by EDNRB (induced by ET1 or ET3) restores FAK and paxillin phosphorylation and downstream stabilization of TM1 and RhoA and subsequently leads to cell spreading on FN/TN-C. This involves EGFR, PLC, PI3K, JNK, and other not yet identified downstream signaling molecules. EDNRB signaling might activate EGFR indirectly, presumably due to enhanced maturation of pro-EGF (40). It is remarkable that EDNRB-induced cell spreading on FN/TN-C occurs independent on activation of syndecan-4 by fibronectin.

 
Our results show that inhibition of FAK, RhoA, and TM1 is responsible for cell rounding by tenascin-C. To override the cell spreading block by tenascin-C, the function of all three molecules, FAK, RhoA, and TM1, needs to be restored (Fig. 7B; Table 1). This can be accomplished by activation of EDNRB, which induces cell spreading on FN/TN-C presumably due to FAK and paxillin activation and RhoA and TM1 protein stabilization. EDNRB-induced cell spreading on FN/TN-C was specific because it could be blocked with BQ788, a specific inhibitor of EDNRB (18) that is used in treatment of pulmonary hypertension (17). Restoration of expression and function of FAK, RhoA, and TM1 by EDNRB signaling involved EGFR, PLC, PI3K, and JNK because specific inhibitors for these enzymes blocked EDNRB-specific cell spreading and reexpression of the tenascin-C target molecules.

We observed that activation of paxillin, an important component of integrin (28), syndecan-4 (34), and ET1 (11) signaling, plays a key role in EDNRB-induced cell spreading on FN/TN-C because EDNRB signaling induced phosphorylation of paxillin at Y118, one of its cognate phosphorylation sites for FAK (28), in the presence of tenascin-C. Whereas phosphorylation of FAK at S910 and of paxillin at Y118 was absent or very low in the presence of tenascin-C in serum-free medium, EDNRB signaling restored phosphorylation in FAK and paxillin. We conclude that phosphorylation of FAK at S910 is involved in restoration of cell spreading on FN/TN-C presumably by phosphorylating paxillin. Localization of paxillin into focal adhesions is dependent on syndecan-4, which involves binding of syndesmos to syndecan-4 and paxillin (34). Tenascin-C impairs syndecan-4 activation by fibronectin (2) and prevents localization of paxillin into focal adhesions (5). Now, we showed that EDNRB activation restores focal adhesion formation on the FN/TN-C substratum. This suggests that EDNRB signaling restores paxillin function on a FN/TN-C substratum through bypassing the requirement for syndecan-4 for the recruitment of paxillin into focal adhesions (Fig. 7B).

Tenascin-C stimulated EDNRA expression (10). By using the clinically relevant EDNRA-specific inhibitor BQ123 (17), we observed that inhibition of EDNRA restored cell spreading, which suggests that signaling through EDNRA mediated cell rounding on FN/TN-C. Similar to T98G glioblastoma cells, activation of EDNRA in MDA-MB435 breast carcinoma and J82 urinary bladder carcinoma cells also supported cell rounding by tenascin-C that could be blocked with BQ123. Whereas endogenously expressed ET1 activated EDNRA, exogenously added ET1 at a high concentration of 20 nmol/L also activated EDNRB. Thus, on activation of both receptors, signaling by EDNRB dominated over signaling by EDNRA in T98G and in MDA-MB435 and J82 cells. Different affinities of EDNRA and EDNRB for the ligand, as has been reported by others (35), can explain our observation that activation of EDNRB as well as inhibition of EDNRA restored cell spreading on FN/TN-C.

Because activation of EDNRA (our data) and MEK down-regulates TM1 expression (30, 31, 36), we examined whether EDNRA-associated cell rounding on FN/TN-C was dependent on MAPK signaling. Indeed, inhibition of MEK with UO126 blocked EDNRA-specific cell rounding on FN/TN-C and caused restoration of FAK phosphorylation and stabilization of RhoA and TM1. Our data link TM1 and RhoA protein instability to EDNRA (Table 1).

Tenascin-C induced EDNRA expression later than 5 h after plating, suggesting that EDNRA signaling is important for tenascin-C–induced cell rounding on fibronectin at later time points. This could present a mechanism to enhance or maintain tenascin-C–induced cell rounding. Whether this involves syndecan-4 is unknown. A potential link of EDNRA to syndecan-4 in causing cell rounding by tenascin-C is supported by our observation that ligation of syndecan-4 is sufficient to restore cell spreading on fibronectin and to attenuate tumor cell proliferation in the presence of tenascin-C (2). Moreover, activation of EDNRA did not induce cell rounding in cells that were spread on fibronectin, where syndecan-4 is engaged as coreceptor in integrin signaling. We speculate that, in situations where syndecan-4 is not working as coreceptor for integrin signaling, syndecan-4 might acquire other functions (e.g., promoting EDNRA signaling), resulting in cell rounding in the presence of tenascin-C.

Tenascin-C and endothelin receptors are instrumental in neural crest cell (NCC) migration during embryonic development because NCC migration was blocked in chicken embryos that were treated with tenascin-C antisense morpholinos (37). The homozygous knockouts of EDNRA and EDNRB are embryonic lethal (38) and EDNRA and EDNRB signaling is crucial in NCC migration (39). Our data provide a functional link between tenascin-C, EDNRA, and NCC migration. Tenascin-C may promote NCC migration along tenascin-C–rich cues by stimulating EDNRA signaling.

Our results suggest that responses toward tenascin-C largely depend on the growth factor receptor status of a cell. EDNRA supports cell rounding by tenascin-C through concomitant repression of RhoA and TM1. Our report is the first to link EDNRA with MEK signaling and cell rounding on a FN/TN-C substratum and enhanced proteolysis of RhoA and TM1. Moreover, similar expression of tenascin-C and EDNRA in eight human cancers is compatible with tenascin-C playing a role in regulation of EDNRA in vivo. In contrast to EDNRA, we found that EDNRB blocks cell rounding by tenascin-C through activation of FAK and normalizing expression of RhoA and TM1. We linked EDNRB, EGFR, PLC, PI3K, and JNK to cell spreading in the presence of tenascin-C. Moreover, EDNRB signaling seems to antagonize signaling through EDNRA. A potential interdependence of the two signaling pathways has been reported; inhibition of EDNRA with BQ123 significantly enhanced EDNRB-induced proliferation of endothelial cells (13). An increased EDNRB and {alpha}TM expression found in five human cancers supports the possibility that EDNRB signaling could be involved in {alpha}TM regulation in a steady-state situation. More detailed information is required to unravel potential interrelations between tenascin-C, EDNRA, EDNRB, and tropomyosin in invasive human cancer tissue.

In summary, we presented a detailed mechanism by which tenascin-C causes cell rounding through EDNRA and how cells modulate the antiadhesive properties of tenascin-C through EDNRB and presumably other signaling. This is the first study to reveal that cell responses toward tenascin-C are modulated by growth factor signaling. More information is required about signaling pathways that support or counteract tenascin-C actions in vivo to use this knowledge for prediction of tumor malignancy.


    Acknowledgments
 
Grant support: Swiss National Science Foundation grant 3100A0-102145/1 (G. Orend), Novartis Stiftung für Medizinisch-Biologische Forschung (G. Orend), Association for International Cancer Research (G. Orend), Swiss Cancer League grant OCS-01419-08-2003 (G. Orend), Swiss National Science Foundation grant 3100A0-108266/1 (M.E. Hegi), Münster University Hospital grant IMFGÖ120415 (M. Götte), and National Medical Research Council, Singapore (G.W. Yip). Work from A. Dittmann was part of her bachelor thesis in biotechnology at the University of Mannheim, Germany.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Harold Erickson and Pia Wülfing for providing human tenascin-C cDNA and breast cancer material, respectively; Marie-France Hamou and E.S. Yong for technical assistance; Eytan Domany for sharing the SPIN software; and Francois Lehembre and Matthias Chiquet for critically reading the manuscript.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

7 M. Kammerer and G. Orend, unpublished data. Back

8 A. Murat et al. Stem cell-related "self renewal signature" and high EGFR expression are associated wtih resistance to chemoradiotherapy in glioblastoma. A Translational Research Study of the EORTC Brain Tumor Group and the University of Lausanne Medical Center, submitted for publication Back

Received 9/12/06. Revised 2/27/07. Accepted 3/29/07.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Orend G, Chiquet-Ehrismann R. Tenascin-C induced signaling in cancer. Cancer Lett 2006;244:143–63.[CrossRef][Medline]
  2. Huang W, Chiquet-Ehrismann R, Moyano JV, Garcia-Pardo A, Orend G. Interference of tenascin-C with syndecan-4 binding to fibronectin blocks cell adhesion and stimulates tumor cell proliferation. Cancer Res 2001;61:8586–94.[Abstract/Free Full Text]
  3. Midwood KS, Valenick LV, Hsia HC, Schwarzbauer JE. Coregulation of fibronectin signaling and matrix contraction by tenascin-C and syndecan-4. Mol Biol Cell 2004;15:5670–7.[Abstract/Free Full Text]
  4. Wenk MB, Midwood KS, Schwarzbauer JE. Tenascin-C suppresses Rho activation. J Cell Biol 2000;150:913–20.[Abstract/Free Full Text]
  5. Orend G, Huang W, Olayioye MA, Hynes NE, Chiquet-Ehrismann R. Tenascin-C blocks cell cycle progression of anchorage-dependent fibroblasts on fibronectin through inhibition of syndecan-4. Oncogene 2003;22:3917–26.[CrossRef][Medline]
  6. Midwood KS, Schwarzbauer JE. Tenascin-C modulates matrix contraction via focal adhesion kinase- and Rho-mediated signaling pathways. Mol Biol Cell 2002;13:3601–13.[Abstract/Free Full Text]
  7. Orend G. Potential oncogenic action of tenascin-C in tumorigenesis. Int J Biochem Cell Biol 2005;37:1066–83.[CrossRef][Medline]
  8. Swindle CS, Tran KT, Johnson TD, et al. Epidermal growth factor (EGF)-like repeats of human tenascin-C as ligands for EGF receptor. J Cell Biol 2001;154:459–68.[Abstract/Free Full Text]
  9. Jones PL, Crack J, Rabinovitch M. Regulation of tenascin-C, a vascular smooth muscle cell survival factor that interacts with the {alpha}vß3 integrin to promote epidermal growth factor receptor phosphorylation and growth. J Cell Biol 1997;139:279–93.[Abstract/Free Full Text]
  10. Ruiz C, Huang W, Hegi ME, et al. Growth promoting signaling by tenascin-C. Cancer Res 2004;64:7377–85.[Abstract/Free Full Text]
  11. Bagnato A, Catt KJ. Endothelins as autocrine regulators of tumor cell growth. Trends Endocrinol Metab 1998;9:378–83.[CrossRef][Medline]
  12. Masaki T. Historical review: endothelin. Trends Pharmacol Sci 2004;25:219–24.[CrossRef][Medline]
  13. Morbidelli L, Orlando C, Maggi CA, Ledda F, Ziche M. Proliferation and migration of endothelial cells is promoted by endothelins via activation of ETB receptors. Am J Physiol 1995;269:H686–95.[Medline]
  14. Salani D, Di Castro V, Nicotra MR, et al. Role of endothelin-1 in neovascularization of ovarian carcinoma. Am J Pathol 2000;157:1537–47.[Abstract/Free Full Text]
  15. Alberts GF, Peifley KA, Johns A, Kleha JF, Winkles JA. Constitutive endothelin-1 overexpression promotes smooth muscle cell proliferation via an external autocrine loop. J Biol Chem 1994;269:10112–8.[Abstract/Free Full Text]
  16. Bagnato A, Spinella F, Rosano L. Emerging role of the endothelin axis in ovarian tumor progression. Endocr Relat Cancer 2005;12:761–72.[Abstract/Free Full Text]
  17. Munter K, Kirchengast M. The role of endothelin receptor antagonists in cardiovascular pharmacotherapy. Expert Opin Emerg Drugs 2001;6:3–11.[Medline]
  18. Lahav R, Heffner G, Patterson PH. An endothelin receptor B antagonist inhibits growth and induces cell death in human melanoma cells in vitro and in vivo. Proc Natl Acad Sci U S A 1999;96:11496–500.[Abstract/Free Full Text]
  19. Carducci MA, Padley RJ, Breul J, et al. Effect of endothelin-A receptor blockade with atrasentan on tumor progression in men with hormone-refractory prostate cancer: a randomized, phase II, placebo-controlled trial. J Clin Oncol 2003;21:679–89.[Abstract/Free Full Text]
  20. Aukhil I, Joshi P, Yan Y, Erickson HP. Cell- and heparin-binding domains of the hexabrachion arm identified by tenascin expression proteins. J Biol Chem 1993;268:2542–53.[Abstract/Free Full Text]
  21. Kohfeldt E, Maurer P, Vannahme C, Timpl R. Properties of the extracellular calcium binding module of the proteoglycan testican. FEBS Lett 1997;414:557–61.[CrossRef][Medline]
  22. Wagner S, Hofstetter W, Chiquet M, et al. Early osteoarthritic changes of human femoral head cartilage subsequent to femoro-acetabular impingement. Osteoarthritis Cartilage 2003;11:508–18.[CrossRef][Medline]
  23. Sauzeau V, Rolli-Derkinderen M, Marionneau C, Loirand G, Pacaud P. RhoA expression is controlled by nitric oxide through cGMP-dependent protein kinase activation. J Biol Chem 2003;278:9472–80.[Abstract/Free Full Text]
  24. Godard S, Getz G, Delorenzi M, et al. Classification of human astrocytic gliomas on the basis of gene expression: a correlated group of genes with angiogenic activity emerges as a strong predictor of subtypes. Cancer Res 2003;63:6613–25.[Abstract/Free Full Text]
  25. Sone M, Takahashi K, Totsune K, et al. Expression of endothelin-1 and endothelin receptors in cultured human glioblastoma cells. J Cardiovasc Pharmacol 2000;36:S390–2.[CrossRef][Medline]
  26. Liu ZX, Yu CF, Nickel C, Thomas S, Cantley LG. Hepatocyte growth factor induces ERK-dependent paxillin phosphorylation and regulates paxillin-focal adhesion kinase association. J Biol Chem 2002;277:10452–8.[Abstract/Free Full Text]
  27. Ishibe S, Joly D, Zhu X, Cantley LG. Phosphorylation-dependent paxillin-ERK association mediates hepatocyte growth factor-stimulated epithelial morphogenesis. Mol Cell 2003;12:1275–85.[CrossRef][Medline]
  28. Brown MC, Turner CE. Paxillin: adapting to change. Physiol Rev 2004;84:1315–39.[Abstract/Free Full Text]
  29. Bruns CJ, Solorzano CC, Harbison MT, et al. Blockade of the epidermal growth factor receptor signaling by a novel tyrosine kinase inhibitor leads to apoptosis of endothelial cells and therapy of human pancreatic carcinoma. Cancer Res 2000;60:2926–35.[Abstract/Free Full Text]
  30. Janssen RA, Kim PN, Mier JW, Morrison DK. Overexpression of kinase suppressor of Ras upregulates the high-molecular-weight tropomyosin isoforms in ras-transformed NIH 3T3 fibroblasts. Mol Cell Biol 2003;23:1786–97.[Abstract/Free Full Text]
  31. Pawlak G, Helfman DM. MEK mediates v-Src-induced disruption of the actin cytoskeleton via inactivation of the Rho-ROCK-LIM kinase pathway. J Biol Chem 2002;277:26927–33.[Abstract/Free Full Text]
  32. Tsafrir D, Tsafrir I, Ein-Dor L, Zuk O, Notterman DA, Domany E. Sorting points into neighborhoods (SPIN): data analysis and visualization by ordering distance matrices. Bioinformatics 2005;21:2301–8.[Abstract/Free Full Text]
  33. Rhodes DR, Yu J, Shanker K, et al. ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia 2004;6:1–6.[Medline]
  34. Denhez F, Wilcox-Adelman SA, Baciu PC, et al. Syndesmos, a syndecan-4 cytoplasmic domain interactor, binds to the focal adhesion adaptor proteins paxillin and Hic-5. J Biol Chem 2002;277:12270–4.[Abstract/Free Full Text]
  35. Harada N, Himeno A, Shigematsu K, Sumikawa K, Niwa M. Endothelin-1 binding to endothelin receptors in the rat anterior pituitary gland: possible formation of an ETA-ETB receptor heterodimer. Cell Mol Neurobiol 2002;22:207–26.[CrossRef][Medline]
  36. Pawlak G, McGarvey TW, Nguyen TB, et al. Alterations in tropomyosin isoform expression in human transitional cell carcinoma of the urinary bladder. Int J Cancer 2004;110:368–73.[CrossRef][Medline]
  37. Tucker RP. Abnormal neural crest cell migration after the in vivo knockdown of tenascin-C expression with morpholino antisense oligonucleotides. Dev Dyn 2001;222:115–9.[CrossRef][Medline]
  38. Berthiaume N, Yanagisawa M, Labonte J, D'Orleans-Juste P. Heterozygous knock-out of ET(B) receptors induces BQ-123-sensitive hypertension in the mouse. Hypertension 2000;36:1002–7.[Abstract/Free Full Text]
  39. Maschhoff KL, Baldwin HS. Molecular determinants of neural crest migration. Am J Med Genet 2000;97:280–8.[CrossRef][Medline]
  40. Daub H, Weiss FU, Wallasch C, Ullrich A. Role of transactivation of the EGF receptor in signalling by G-protein-coupled receptors. Nature 1996;379:557–60.[CrossRef][Medline]



This article has been cited by other articles:


Home page
DevelopmentHome page
N. R. Druckenbrod and M. L. Epstein
Age-dependent changes in the gut environment restrict the invasion of the hindgut by enteric neural progenitors
Development, September 15, 2009; 136(18): 3195 - 3203.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. A. Breau, A. Dahmani, F. Broders-Bondon, J.-P. Thiery, and S. Dufour
{beta}1 integrins are required for the invasion of the caecum and proximal hindgut by enteric neural crest cells
Development, August 15, 2009; 136(16): 2791 - 2801.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A.-M. Tokes, A. M. Szasz, A. Farkas, A. I. Toth, M. Dank, L. Harsanyi, B. A. Molnar, I. A. Molnar, Z. Laszlo, Z. Rusz, et al.
Stromal Matrix Protein Expression Following Preoperative Systemic Therapy in Breast Cancer
Clin. Cancer Res., January 15, 2009; 15(2): 731 - 739.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Lange, M. Kammerer, F. Saupe, M. E. Hegi, S. Grotegut, E. Fluri, and G. Orend
Combined Lysophosphatidic Acid/Platelet-Derived Growth Factor Signaling Triggers Glioma Cell Migration in a Tenascin-C Microenvironment
Cancer Res., September 1, 2008; 68(17): 6942 - 6952.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Gotte, D. Spillmann, G. W. Yip, E. Versteeg, F. G. Echtermeyer, T. H. van Kuppevelt, and L. Kiesel
Changes in heparan sulfate are associated with delayed wound repair, altered cell migration, adhesion and contractility in the galactosyltransferase I (ss4GalT-7) deficient form of Ehlers-Danlos syndrome
Hum. Mol. Genet., April 1, 2008; 17(7): 996 - 1009.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Degen, F. Brellier, R. Kain, C. Ruiz, L. Terracciano, G. Orend, and R. Chiquet-Ehrismann
Tenascin-W Is a Novel Marker for Activated Tumor Stroma in Low-grade Human Breast Cancer and Influences Cell Behavior
Cancer Res., October 1, 2007; 67(19): 9169 - 9179.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lange, K.
Right arrow Articles by Orend, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lange, K.
Right arrow Articles by Orend, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online