| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Section of Hematology and Immunology, University of Perugia, IBiT Foundation, Fondazione IRCCS Biotecnologie nel Trapianto; 2 Institute of Internal Medicine, University of Perugia, Perugia, Italy; 3 Institute of Hematology, University of Bari, Bari, Italy; 4 Institute of Hematology, University of Foggia, Foggia, Italy; 5 Institute of Hematology, Ospedale "Cervello," Palermo, Italy; and 6 Westmead Institute for Cancer Research, University of Sydney, Westmead Hospital, Sydney, Australia
Requests for reprints: Brunangelo Falini, Institute of Hematology, Policlinico, Monteluce, 06122 Perugia, Italy. Phone: 39-075-578-3190; Fax: 39-075-578-3834; E-mail: faliniem{at}unipg.it.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
30% of de novo acute myelogenous leukemia (AML) exhibiting distinctive clinicopathologic (5) and prognostic (811) features carry NPM1 gene mutations that cause aberrant NPM accumulation in leukemic cell cytoplasm (5, 12). For this reason, we named this leukemia "cytoplasmic positive (NPMc+) AML" (5). In NPMc+ AML, NPM1 mutations alter tryptophans 288 and 290 (or 290 alone; ref. 5) and create a new nuclear export signal (NES) motif (13) at the NPM protein COOH terminus. Both abnormalities act in concert (5) to aberrantly localize NPM leukemic mutants in cytoplasm, as easily detected by immunohistochemistry (14, 15). Most of NPM leukemic mutants identified to date (16) lose both tryptophans 288 and 290, which are involved in NPM nucleolar localization (17); the others retain tryptophan 288. Six different mutation-related COOH-terminal NES sequences have been detected (16). Interestingly, COOH-terminal NES sequences and patterns of tryptophan loss are not randomly distributed (12). The L-xxx-V-xx-V-x-L NES motif, the most common in NPM mutants, is always associated with loss of both tryptophans (12). In contrast, NES motif variants (where valine at the NES second position is replaced by leucine, phenylalanine, cysteine, or methionine) are found only when tryptophan 288 is retained (12). Tryptophans 288 and 290 drive NPM into the nucleolus (17), but when tryptophan 288 is retained, immunohistochemistry shows that NPM mutants still localize in cytoplasm (14). Therefore, to get mutants out of the nucleus, the COOH-terminal NES sequence of NPM mutants retaining tryptophan 288 has to counterbalance the tryptophan 288 driving force to the nucleolus. This raises the question about whether variant COOH-terminal NES motifs have stronger nuclear export efficiency than the more common L-xxx-V-xx-V-x-L NES motif.
To assess whether the COOH-terminal NES motifs of NPM mutants differ in their nuclear export efficiency, we studied subcellular expression of different mutants at various concentrations of leptomycin B, a specific inhibitor of Exportin/Crm1 receptor (18, 19), and used a Rev(1.4)-eGFP fusion proteinbased functional nuclear export assay (20) to measure the nuclear export activity of each COOH-terminal NES sequence after isolation from mutated NPM proteins (16). Seeking a functional explanation of nucleolus-restricted expression of wild-type NPM, we also used the same shuttling assay to assess the nuclear export strength of the two physiologic NH2-terminal NES motifs (21, 22) of wild-type NPM.
We found that COOH-terminal NES motifs of NPM mutants vary greatly in their nuclear export strength, suggesting natural selection of most efficient NES motifs in NPM mutants retaining tryptophan 288. This biological association favors maximum NPM mutant accumulation in cytoplasm and could be a critical event in leukemogenesis. Our results also account for the predominant nucleolar localization of wild-type NPM protein.
| Materials and Methods |
|---|
|
|
|---|
Rev(1.4)-eGFP fusion plasmids containing NPM NES motifs. HIV-1 Rev protein shuttles between cytoplasm and nuclear compartments (23). Nuclear export efficiency of NES motifs from wild-type and mutated NPM proteins was measured using a Rev(1.4)-eGFP fusion proteinbased functional nuclear export assay (20). The NES-mutated Rev(1.4)-eGFP and the positive control Rev(1.4)-NES3-eGFP (with the Rev NES reinserted) fusion plasmids were generated by one of the authors (B.H.) at the Westmead Institute for Cancer Research, Westmead Hospital (Sydney, Australia).
Double-strand DNA coding for several putative NES motifs from wild-type NPM (NES 4249 and NES 94102) and leukemic mutants at their COOH termini (LxxxVxxVxL, LxxxLxxVxL, LxxxCxxVxL, LxxxFxxVxL, and LxxxMxxVxL and mut6; refs. 16, 21, 22) was obtained by annealing partially complementary synthetic oligonucleotides bearing BamHI-AgeI compatible ends and ligating into BamHI-AgeIdigested Rev(1.4)-eGFP by standard procedures. Oligonucleotides are listed below: Rev(1.4)-NES-4249-eGFP-F, 5'-GATCCATTATCTTTAAGAACGGTCAGTTTAGGA; Rev(1.4)-NES-4249-eGFP-R, 5'-CCGGTCCTAAACTGACCGTTCTTAAAGATAATG; Rev(1.4)-NES-94102-eGFP-F, 5'-GATCCAATAACACCACCAGTGGTCTTAAGGTTGAAA; Rev(1.4)-NES-94102-eGFP-R, 5'-CCGGTTTCAACCTTAAGACCACTGGTGGTGTTATTG; Rev(1.4)-LxxxVxxVxL-eGFP-F, 5'-GATCCAGATCTCTGTCTGGCAGTGGAGGAAGTCTCTTTAAGAAAAAGA; Rev(1.4)-LxxxVxxVxL-eGFP-R, 5'-CCGGTCTTTTTCTTAAAGAGACTTCCTCCACTGCCAGACAGAGATCTG; Rev(1.4)-LxxxLxxVxL-eGFP-F, 5'-GATCCAGATCTCTGGCAGTCTCTTGCCCAAGTCTCTTTAAGAAAAAGA; Rev(1.4)-LxxxLxxVxL-eGFP-R, 5'-CCGGTCTTTTTCTTAAAGAGACTTGGGCAAGAGACTGCCAGAGATCTG; Rev(1.4)-LxxxCxxVxL-eGFP-F, 5'-GATCCAGATCTCTGGCAGTGCTGCTCCCAAGTCTCTTTAAGAAAAAGA; Rev(1.4)-LxxxCxxVxL-eGFP-R, 5'-CCGGTCTTTTTCTTAAAGAGACTTGGGAGCAGCACTGCCAGAGATCTG; Rev(1.4)-LxxxFxxVxL-eGFP-F, 5'-GATCCAGATCTCTGGCAGTGCTTCGCCCAAGTCTCTTTAAGAAAAAGA; Rev(1.4)-LxxxFxxVxL-eGFP-R, 5'-CCGGTCTTTTTCTTAAAGAGACTTGGGCGAAGCACTGCCAGAGATCTG; Rev(1.4)-LxxxMxxVxL-eGFP-F, 5'-GATCCAGATCTCTGGCAGTCCATGGAGGAAGTCTCTTTAAGAAAAAGA; Rev(1.4)-LxxxMxxVxL-eGFP-R, 5'-CCGGTCTTTTTCTTAAAGAGACTTCCTCCATGGACTGCCAGAGATCTG; Rev(1.4)-Mut6-eGFP-F, 5'-GATCCAGATCTCTGGCAAGATTTCTTAAATCGTCTCTTTAAGAAAATAGTTACA; Rev(1.4)-Mut6-eGFP-R, 5'-CCGGTGTAACTATTTTCTTAAAGAGACGATTTAAGAAATCTTGCCAGAGATCTG.
Cell cultures and transfection procedures. NIH-3T3 murine fibroblasts were cultured in DMEM supplemented with 10% bovine calf serum, 1% glutamine, and antibiotics. For transfection purposes, cells were seeded overnight on glass coverslips and transfected using Lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. After 24-h incubation, before any treatment, cells were incubated with 10 µg/mL cycloheximide (Merck Biosciences Ltd.) for 30 min. Leptomycin B (Merck Biosciences), a specific Crm1 inhibitor (19), was added at 20 ng/mL final concentration for standard assays and at doses ranging from 0.1 to 10 ng/mL for dose finding experiments (see below), always for 5 h; actinomycin D (Sigma-Aldrich) was added at 5 ng/mL final concentration for 3 h where indicated.
Immunofluorescence analysis. For immunofluorescence and confocal microscope studies, transfected and treated cells (see above) grown on glass coverslips were rinsed in PBS and fixed in 4% paraformaldehyde, pH 7.4 (10 min). Nuclei were counterstained with propidium iodide when necessary. Confocal analysis was done as previously described (24). Briefly, images were collected with a Zeiss LSM 510 confocal microscope (Carl Zeiss) using 488-nm (for eGFP) and 543-nm (for propidium iodide) laser lines for excitation. Acousto-optic tunable filtercontrolled tuning of laser lines, pinhole diameters, and light collection configuration were optimized to obtain best signal-to-noise ratio and to avoid fluorescence crossover. LSM 510 software regulated the microscope; images were transferred to an SGI Octane workstation (Silicon Graphics) for further processing. Slices were reconstructed three-dimensionally using the shadow technique or isosurface analysis with Imaris software (Bitplane).
NES scoring system. A cell scoring method evaluated export activity of each NES inserted in pRev (1.4)-eGFP. Cells were observed with an Olympus AX70 epifluorescence microscope (Olympus) equipped with a 100x/1.4 numerical aperture oil immersion objective and a MNIBA optical filter cube (excitation, 470495 nm; dichroic mirror, 505 nm; emission, 510550 nm). A minimum of 200 cells for each slide were examined by two "blinded" independent observers. Cells with or without cytoplasmic fluorescence were counted and their percentage calculated using GraphPad Prism 4 software (GraphPad Software). Three experiments were done. Data showed good intertest reproducibility. The same slides were examined with a confocal microscope according to the above procedure. Confocal slices were projected on the Z axis using the maximum intensity method with the Imaris software (Bitplane); images were recorded and further processed with ImageJ (NIH).
| Results |
|---|
|
|
|---|
80% of NPMc+ AML cases. All NPM mutants carrying the most common COOH-terminal NES motif LxxxVxxVxL lack both tryptophans (Table 1
; NES variant 1). W288 retention, although rarely observed in patients (<5%), occurred in 14 of 37 (37.8%) of NPM leukemic mutant sequences (Table 1). All NPM mutants retaining W288 displayed one of the five rare COOH-terminal NES motifs (Table 1; NES variants 2 to 6).
|
|
Low doses of leptomycin B reveal different sensitivity of NPM leukemic mutants to Crm1 inhibition. We investigated whether the COOH-terminal NES motifs of NPM leukemic mutants carrying one (W290) or two (W288 and W290) mutated tryptophans vary in functional activity. NIH-3T3 cells were transfected with mutants carrying the NES of interest and incubated with low doses of leptomycin B to highlight differences in export efficiency of the different COOH-terminal NPM NES motifs. Leptomycin B incubation was done in NIH-3T3 cells transfected with NPM mutant A (containing the LxxxVxxVxL COOH-terminal NES motif and no tryptophans) or NPM mutant E (containing the LxxxLxxVxL COOH-terminal NES motif plus tryptophan 288). At conventional doses of leptomycin B (1020 ng/mL), all NPM leukemic mutants completely relocated in the nucleus. We reasoned that a lower dose could reach a Crm1 inhibition threshold and, if different mutant NES sequences have different nuclear export efficiency, the NPM mutant nuclear relocation patterns would differ. Titration experiments showed that, at a dose of 0.5 ng/mL, NPM mutant A was almost completely nuclear (Fig. 2, top ) whereas NPM mutant E still showed marked cytoplasmic positivity (Fig. 2, middle). As expected, similar numbers of NPM cytoplasmic positive cells were observed with mutant eGFP-NPMmE-W288C (Fig. 2, bottom).
|
NPM leukemic mutants retaining W288 carry COOH-terminal NES motifs which are stronger than LxxxVxxVxL. To investigate the activity of both physiologic (NH2-terminal) and mutation-induced (COOH-terminal) NES motifs of NPM systematically and without interfering factors, we conducted a nuclear export assay on isolated NPM NES sequences cloned into the Rev(1.4)-eGFP fusion protein (Fig. 3A ). Because this construct contains a nuclear localization signal but lacks a NES motif, the recombinant Rev(1.4)-eGFP fusion protein produced in cells localizes in the nucleus (nucleoplasm and nucleoli). Inserting a functional NES between Rev(1.4) and eGFP protein restores shuttling activity, which is measured by immunofluorescence microscope analysis. This construct formed the basis of a functional shuttling assay designed to investigate the activity of each different NPM COOH-terminal NES motif. Actinomycin D, a RNA polymerase inhibitor, was used as an enhancer for detecting weak NES sequences because it increases nucleoplasmic availability of some nucleolar proteins (20, 25).
|
The NH2-terminal NES motifs of NPM wild-type protein [i.e., amino acids 4249 (21) and amino acids 94102 (22)] displayed weak nuclear export efficiency. When transfected in NIH-3T3 cells, plasmids pRev(1.4)-NES-4249 and pRev(1.4)-NES-94102 encoded for fusion proteins which remained in the nucleus in most cells, both in basal conditions and after actinomycin D (Fig. 3B and C). The low nuclear export rate of these physiologic NES of NPM wild-type protein, in combination with signals driving NPM into the nucleoli (COOH-terminal tryptophans), provides a reasonable explanation for NPM nucleolus-restricted localization.
Significant functional export differences emerged in the six mutated NPM COOH-terminal NES motifs we investigated. Fusion proteins containing the most common NES motif LxxxVxxVxL (Rev-LxxxVxxVxL-eGFP) were nuclear in most transfected cells in basal conditions and produced cytoplasmic staining on actinomycin D incubation in
40% of transfected cells (Fig. 3B and C). These findings indicate that NPM COOH-terminal LxxxVxxVxL is a functional NES motif with intrinsically weak activity. Therefore, NPM mutant A cytoplasmic localization depends on accumulated weak activity by the physiologic NES at the NH2 terminus and the additional NES at the COOH terminus.
All NES motifs of NPM leukemic mutants retaining W288 produced a clear cytoplasmic staining in most transfected cells in basal conditions (Fig. 3B and C) and after actinomycin D incubation, indicating that these NES sequences exert stronger nuclear export efficiency than the LxxxVxxVxL NES. Leptomycin B incubation relocated all Rev(1.4)-NPM-NES-eGFP fusion proteins into the nucleus, confirming that protein export is NES dependent and Crm1 mediated (not shown).
These results show that NPM COOH-terminal LxxxVxxVxL is a functional NES motif with rather weak activity and that NPM leukemic mutants retaining W288 carry COOH-terminal NES motifs with stronger nuclear export efficiency.
A weak COOH-terminal NES motif and retention of tryptophan 288 is an unlikely combination. NPM leukemic mutants carrying a weak COOH-terminal NES motif and a tryptophan at position 288 have never been detected in primary AML samples (16). To investigate the consequences of a weak COOH-terminal NES motif combined with tryptophan 288 retention on NPM nucleocytoplasmic traffic, we used two artificial NPM leukemic mutants: (a) mutant A where tryptophan 288 was reintroduced (eGFP-NPMmA-C288W), and (b) mutant E (which normally retains W288) where the strong variant LxxxLxxVxL NES motif was replaced with the common weak LxxxVxxVxL NES (eGFP-NPMmE-LxxxVxxVxL). On transfection in NIH-3T3 cells, the bulk of both artificial proteins localized in the nucleoplasm and nucleoli and displayed greatly reduced cytoplasmic export as compared with the original NPM leukemic mutants A and E (Fig. 4 ).
|
| Discussion |
|---|
|
|
|---|
Functional leucine-rich NES sequences commonly provide the signal for driving a protein out of the nucleus (26). NES motifs display a high natural variability in export activity (20, 27), which is probably related to differences in Crm1 affinity. The nuclear export efficiency of a NES motif represents a critical factor in intracellular localization of any shuttling protein. Others include the nuclear import rate, protein-protein (28, 29) or protein-nucleic acid interactions which lead to retention in cytoplasm or nucleus.
To assess how the balance between import and export signals dictates the restricted nucleolar distribution of the NPM wild-type protein (7), we used a Rev(1.4)-based shuttling assay (20) that gave us the possibility to quantify the efficiency of each of the two physiologic NES motifs of wild-type NPM [residues 94102 (22) and residues 4249 (21)] in a cellular system without confounding factors (e.g., other NES motifs in the same protein or changes in subcellular localization due to interactions with other proteins). Using this functional assay, we found that the two NES of NPM wild type exert weak nuclear export efficiency. This finding suggests that these NES cannot counterbalance the strength of the bipartite nuclear localization signal in the mid portion of NPM, which is responsible for nuclear import (30), and the force of the COOH-terminal tryptophans, which targets NPM to nucleolus (17, 30). Consequently, NPM wild type predominantly localizes in the nucleolus (Fig. 5, left ). Although phosphorylation at threonine 95 (which physiologically regulates NPM NES 94102 activity; ref. 22) probably does not occur in our artificial Rev(1.4)-based functional assay, our results support the theory of NES motif weakness (31) and fit with the observation that the least active NES motifs (20) belong to proteins that have specific nuclear functions, such as the transcriptional modulators p53 and activating protein-2. Our results also imply that the NES signal(s) needs to reach threshold activity for efficient protein export to cytoplasm.
|
Interestingly, no NPM leukemic mutant combining a weak NES motif (L-xxx-V-xx-V-x-L) with W288 retention has ever been detected in NPMc+ AML patients (16). Artificial NPM mutants combining these two features (NPMmA-W288C and NPMmE-LVVL) are not efficiently exported into cytoplasm and accumulate in nucleoli and nucleoplasm. Added to different strength NES motifs, these observations point to an NPM mutant selection process. Mutant accumulation in cytoplasm seems to be a mandatory consequence of the mutation and possibly a critical event in leukemogenesis because only mutants that are efficiently exported into cytoplasm will probably give rise to a leukemic clone. Thus, NPM leukemic mutants seem to be "born to be exported." The finding that extremely rare variants of NPM1 mutations occurring at exons other than exon 12 (33, 34) also result in additional NES and NPM mutant cytoplasmic dislocation further supports this view. NPM mutants have been shown to delocalize wild-type NPM and p14ARFinto nucleoplasm and cytoplasm (12, 35), thus perhaps altering their functions (36). However, how altered NPM traffic contributes to leukemogenesis still remains an unsolved question.
Our results provide a rationale basis for immunohistochemical detection of cytoplasmic NPM being fully predictive of all types of NPM1 mutations (14, 15). Finally, the findings presented in this article have a potential therapeutic effect because, if small molecules are to be designed to interfere with abnormal mutant traffic, all the complex structural and functional alterations that occur at the COOH termini of NPM mutants will need to be considered.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Dr. G.A. Boyd for editorial assistance and Claudia Tibidò for secretarial assistance.
| Footnotes |
|---|
Conflict of interest: B. Falini and C. Mecucci applied for a patent on clinical use of NPM mutants and have a financial interest in the patent.
Received 12/ 1/06. Revised 4/ 4/07. Accepted 5/ 2/07.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Haferlach, C. Mecucci, S. Schnittger, A. Kohlmann, M. Mancini, A. Cuneo, N. Testoni, G. Rege-Cambrin, A. Santucci, M. Vignetti, et al. AML with mutated NPM1 carrying a normal or aberrant karyotype show overlapping biologic, pathologic, immunophenotypic, and prognostic features Blood, October 1, 2009; 114(14): 3024 - 3032. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. Grummitt, F. M. Townsley, C. M. Johnson, A. J. Warren, and M. Bycroft Structural Consequences of Nucleophosmin Mutations in Acute Myeloid Leukemia J. Biol. Chem., August 22, 2008; 283(34): 23326 - 23332. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Liso, F. Castiglione, A. Cappuccio, F. Stracci, R. F. Schlenk, S. Amadori, C. Thiede, S. Schnittger, P. J.M. Valk, K. Dohner, et al. A one-mutation mathematical model can explain the age incidence of acute myeloid leukemia with mutated nucleophosmin (NPM1) Haematologica, August 1, 2008; 93(8): 1219 - 1226. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Falini, M. P. Martelli, C. Mecucci, A. Liso, N. Bolli, B. Bigerna, A. Pucciarini, S. Pileri, G. Meloni, M. F. Martelli, et al. Cytoplasmic mutated nucleophosmin is stable in primary leukemic cells and in a xenotransplant model of NPMc+ acute myeloid leukemia in SCID mice Haematologica, May 1, 2008; 93(5): 775 - 779. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Falini, C. Mecucci, G. Saglio, F. L. Coco, D. Diverio, P. Brown, F. Pane, M. Mancini, M. P. Martelli, S. Pileri, et al. NPM1 mutations and cytoplasmic nucleophosmin are mutually exclusive of recurrent genetic abnormalities: a comparative analysis of 2562 patients with acute myeloid leukemia Haematologica, March 1, 2008; 93(3): 439 - 442. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |