
Cancer Research 67, 7155-7164, August 1, 2007. doi: 10.1158/0008-5472.CAN-06-3392
© 2007 American Association for Cancer Research
Cell, Tumor, and Stem Cell Biology |
p53 Activation in Response to Mitotic Spindle Damage Requires Signaling via BubR1-Mediated Phosphorylation
Geun-Hyoung Ha1,
Kwan-Hyuck Baek1,2,
Hyun-Soo Kim1,
Sook-Jung Jeong1,
Chang-Min Kim2,
Frank McKeon3 and
Chang-Woo Lee1,2
1 Department of Molecular Cell Biology, Center for Molecular Medicine, Samsung Biomedical Research Institute, Sungkyunkwan University School of Medicine, Suwon, Korea; 2 Research Institute, National Cancer Center, Goyang, Gyeonggi, Korea; and 3 Department of Cell Biology, Harvard Medical School, Boston, Massachusetts
Requests for reprints: Chang-Woo Lee, Department of Molecular Cell Biology, Center for Molecular Medicine, Samsung Biomedical Research Institute, Sungkyunkwan University School of Medicine, Suwon 440-746, Korea. Phone: 82-31299-6121; Fax: 82-31299-6269; E-mail: cwlee{at}med.skku.ac.kr.
 |
Abstract
|
|---|
The mitotic spindle checkpoint plays a crucial role in regulating accurate chromosome segregation and preventing the adaptation of multiploid progeny cells. Recent reports have indicated that the induction of p53 by mitotic checkpoint activation is essential for protecting cells from abnormal chromosome ploidization caused by mitotic failure. However, although studies have shown that p53 deficiencies arrest mitosis, compromise apoptosis, and may cause profound aneuploidy, the molecular mechanisms leading to p53 induction following mitotic checkpoint activation remain unknown. Here, we show that the BubR1 mitotic checkpoint kinase interacts with p53 both in vitro and in vivo, with higher levels of interaction in mitotic cells. This interaction contributes to p53 phosphorylation. Silencing of BubR1 expression reduces the phosphorylation and stability of p53, whereas exogenous introduction of BubR1 proteins into BubR1-depleted cells recovers p53 stability. In addition, inhibition of BubR1 expression in the presence of a microtubule inhibitor accelerates chromosomal instability and polyploidy in p53-null cells. These results collectively suggest that p53 activation in response to mitotic spindle damage requires signaling via BubR1-mediated phosphorylation. [Cancer Res 2007;67(15):7155–64]
 |
Introduction
|
|---|
Spindle damage induces prolonged arrest of cellular mitosis, but the cells eventually enter the G1 phase despite failed chromosome segregation and/or cytokinesis. Under normal conditions, these cells undergo a second, p53-dependent cell cycle arrest, and eventually succumb to apoptotic cell death (1–4). However, p53-deficient cells do not undergo this second arrest and eventually adapt and become profoundly polyploid (and eventually aneuploid) in a manner similar to that observed in cells deficient for mitotic checkpoint proteins (2, 5–8). Recent studies have shown that treatment with microtubule inhibitors induces p53 protein expression only after tetraploid cells exit mitotic arrest and progress to interphase (9). Notably, chromosome nondisjunction results in tetraploidization via mitotic failure (10) and p53 has an intrinsic ability to eliminate tetraploid cells (11) that may otherwise proceed to aneuploidy (12). These findings strongly suggest that p53 acts at some point in the postmitotic cell cycle, particularly in cases of mitotic defect. Other studies have shown that microtubule disruption induces prolonged mitotic arrest in association with phosphorylation-induced stabilization of the p53 protein (13). Thus, the induction and/or activation of p53 by mitotic checkpoint activation seems to be essential for protecting cells against the abnormal chromosomal ploidization induced by mitotic defects. Furthermore, these previous findings suggest the existence of functional cross-talk between the mitotic checkpoint and p53-dependent postmitotic controls. Nevertheless, the molecular mechanisms governing p53 activation following prolonged, checkpoint-activated mitotic arrest have not yet been fully elucidated.
During mitotic checkpoint activation, BubR1 and other checkpoint components form an inhibitory ternary complex with an E3 ubiquitin ligase called the anaphase-promoting complex, and its substrate-specific activator, Cdc20. BubR1 monitors the proper attachment of microtubules to kinetochores, and links the regulation of chromosome-spindle attachment to mitotic checkpoint signaling (14–16). Several studies have shown that disruption of BubR1 activity results in a loss of checkpoint control, chromosomal instability (caused by premature anaphase), and/or early onset of malignancy (14, 17–19). We previously showed that BubR1 functions as a potent apoptotic molecule for preventing the adaptation of abnormal, chromosomally unstable mitotic cells (20). Collectively, these observations suggest that BubR1 forms a functional link between prolonged mitotic checkpoint activation and subsequent postmitotic adaptation.
 |
Materials and Methods
|
|---|
Plasmid construction and generation of recombinant adenovirus. The full-length cDNA sequence of the human BubR1 gene has been previously described (14). The cDNA fragments of the BubR1 gene were PCR-amplified and inserted into the pCMV-HA vector to generate pCMV-HA-BubR1 wild-type (WT), 1 to 525 and 526 to 1050. The cDNAs for BubR1 WT, 1 to 525 and 526 to 1050, and two mutant versions of BubR1, K795R and F1022S, were subcloned into the Myc epitope-encoding pcDNA3.1 vector to generate pcDNA-Myc-BubR1 WT, 1 to 525, 526 to 1050, K795R, and F1022S. Glutathione S-transferase (GST) fusion constructs for expression in Escherichia coli were generated by in-frame insertion of PCR fragments encoding BubR1 amino acid residues 1 to 300, 1 to 525, 401 to 700, and 526 to 1050 into the pGEX-KG vector (Pharmacia). The p53 deletion mutant was constructed by in-frame insertion of restriction fragments encoding p53 amino acids 1 to 144 or 143 to 393 into the pGEX-KG vector. The human BubR1 small interfering RNA (siRNA) expression plasmids were created by inserting two sets of siRNA oligonucleotides (5'-gatccccaagggttcagagccatcagttcaagagactgatggctctgaaccctttttttggaaa-3'/5'agcttttccaaaaaaagggttcagagccatcagtctcttgaactgatggctctgaacccttggg-3' and 5'-gatccccggagatcctctacaaagggttcaagagaccctttgtagaggatctcctttttggaaa-3'/5'-agcttttccaaaaaggagatcctctacaaagggtctcttgaaccctttgtagaggatctccggg-3', with the BubR1-targeting region underlined) into the pSuper.Retro.puro and pSuper.puro vectors (Oligoengine), generating the pSuper.Retro.puro-BubR1 siRNA and pSuper-BubR1 siRNA plasmids, respectively. The recombinant adenovirus expressing wild-type BubR1 has been previously described (20).
Cell lines and establishment of stable knock-down cells. HeLa cells were purchased from the American Type Culture Collection and grown in DMEM containing 10% fetal bovine serum (FBS; Hyclone). The p53-null HCT116 (HCT116-p53KO) cells were kindly provided by Bert Vogelstein. The HCT116, HCT116-p53KO, HCT116-BubR1KD, and HCT116-p53KO/BubR1KD cells were grown in McCoy's supplemented medium (Life Technologies) containing 10% FBS. The stable BubR1KD cell lines were generated by transfecting the HCT116 and HCT116-p53KO cells with either pSuper-BubR1 siRNA or the empty pSuper.Retro.puro vector. Colonies showing resistance to puromycin (10 µg/mL) were clonally isolated, and immunoblotting and immunofluorescence assays with an anti-BubR1 antibody (BD Biosciences PharMingen) were used to screen for the suppression of BubR1 expression.
In vitro binding assays and immunoprecipitation. For the GST pull-down assays, the fusion proteins were adsorbed onto glutathione-protein A/G-Sepharose beads (Amersham Biosciences) and incubated with whole-cell extracts (4 mg) from asynchronized or nocodazole-treated HeLa or HCT116 cells. The bound proteins were analyzed by SDS-PAGE, and either p53 or BubR1 were detected by immunoblotting with the corresponding antibody. The in vitro–translated BubR1 protein was produced using a TNT-coupled transcription/translation kit (Promega). For immunoprecipitation, asynchronized or nocodazole-treated HeLa cells were lysed in an immunoprecipitation buffer [50 mmol/L Tris-HCl (pH 7.5), 150 mmol/L NaCl, 1% NP40, 1 mmol/L EDTA, 1 mmol/L phenylmethylsulfonyl fluoride (PMSF), and 1 mmol/L DTT] containing a protease inhibitor cocktail (Sigma). Each cell extract was incubated with antibodies against BubR1 or p53, or normal IgG (control) for 2 h at 4°C, followed by incubation with protein A/G-Sepharose beads for an additional 2 h. The beads were pelleted, washed four times with immunoprecipitation buffer, and analyzed by immunoblotting.
In vitro kinase assays. The cell lysates were incubated with either monoclonal anti-BubR1 antibody or normal mouse IgG, followed by an additional incubation with protein A/G-Sepharose beads. The beads were washed twice with a kinase buffer [100 mmol/L Tris-HCl (pH 7.5), 2 mmol/L EDTA (pH 8), 20 mmol/L MgCl2, 10 mmol/L MnCl2, 1 mmol/L DTT, 1 mmol/L PMSF, and protease inhibitor cocktail], and reacted with 4 µg of purified GST or GST-p53 in the presence of 10 µCi of [
32P]ATP at 37°C for 30 min. The BubR1 immunocomplexes described above were incubated with either GST or GST-p53 in the presence of 50 mmol/L of unlabeled ATP. The phosphorylation of p53 was detected by immunoblotting with antibodies specific to p53 phosphorylated at Ser15, Ser20, and Ser46. The immunoprecipitated HA- and Myc-tagged BubR1 proteins were washed with kinase buffer and then incubated with GST-p53 in the presence of 10 µCi of [
32P]ATP. The GST-p53 proteins were resolved by SDS-PAGE and visualized by autoradiography.
Synchronization and cell cycle analysis. Synchronized populations were generated by treating the control HCT116 and HCT116-BubR1KD cells with nocodazole (200 ng/mL) for 12 h, and then releasing them into normal culture medium in the presence or absence of cycloheximide (50 µg/mL). The cells were harvested at various times after synchronization, and processed for immunoblotting analysis. For flow cytometric analyses, control HCT116 and HCT116-BubR1KD cells were treated with 300 ng/mL of nocodazole, harvested at various times posttreatment, and then fixed and stained with propidium iodide for flow cytometric analysis. The DNA contents of 10,000 cells per sample were analyzed on a Becton Dickinson FACScan cytometer using the CellQuest and WinMDI2.8 software packages.
Immunoblotting analysis and immunofluorescence. For immunoblot analysis, the cells were synchronized as described above or left asynchronized, harvested by scraping, and then washed twice in cold PBS and lysed in a lysis buffer [50 mmol/L Tris-HCl (pH 7.5), 150 mmol/L NaCl, 1% NP40, 1 mmol/L PMSF, 1 mmol/L DTT] containing a protease inhibitor cocktail. Equal amounts of protein (quantified by Bio-Rad assay) from each sample were run on an SDS-PAGE gel, transferred to a nitrocellulose filter, blocked, and analyzed with anti-BubR1 (BD Biosciences PharMingen), anti-Bub3 (BD Biosciences PharMingen), anti-p53 (Santa Cruz Technology), anti-MDM2, (Santa Cruz Technology), anti-Actin (Sigma), anti-phospho p53 Ser15, Thr18, Ser20, Ser46, and Ser392 (Cell Signaling Technology), or anti-HA (Roche) antibodies. For immunofluorescence, the cells were cultured on 18-mm coverslips and fixed in 5% formaldehyde for 10 min. The fixed cells were washed, permeabilized in PBS containing 0.1% Triton X-100, and incubated with the appropriate primary antibody at room temperature for 2 h. The cells were then washed and further incubated for 1 h with goat anti-mouse IgG conjugated with either FITC or Cy5. The cells were washed, stained with Hoechst dye for visualization of DNA, and viewed under a confocal microscope (Zeiss 510 Meta).
Live cell imaging. To estimate the duration of mitosis, cells were transfected with an expression plasmid encoding H2B-GFP for visualization of chromosomes, and then imaged in
T 0.15 mm dishes in McCoy's supplemented medium containing 10% FBS. Every 2 min for 2 h, 0.5-s exposures were acquired using a 20x NA0.75 objective on an LSM500 META confocal microscope (Carl Zeiss).
 |
Results
|
|---|
BubR1 interacts with p53 in vitro and in vivo. To elucidate how BubR1 monitors mitotic and/or postmitotic cell cycle regulation, we used a complex proteomics approach to screen for novel BubR1-interacting proteins. Briefly, we extracted total cellular proteins from HeLa cells, immunoprecipitated these proteins with anti-BubR1 antibody, and analyzed the resulting immunocomplexes by two-dimensional gel electrophoresis followed by mass spectrometry (data not shown). Subsequent matrix-assisted laser desorption ionization-time of flight analysis led to the identification of several BubR1-interacting molecules, including p53.
To begin assessing the importance of this putative p53-BubR1 interaction, we first confirmed its existence by generating a full-length p53/GST fusion protein, and then used immunoblotting to detect the p53-BubR1 interaction in the in vitro–translated extract (Fig. 1A, lanes 1–3
). Pull-down assays revealed that GST-p53 did in fact bind to BubR1. Similarly, we generated a full-length BubR1/GST fusion protein and examined the interaction between GST-BubR1 and purified His-p53 (Fig. 1A, lanes 4–6), which again revealed that BubR1 and p53 were present in the complex formed in vitro. Consistent with these findings, immunoprecipitation with anti-BubR1 antibody and subsequent immunoblotting with an anti-p53 antibody (or the reverse experiment) showed that BubR1 and p53 form a complex in vivo (Fig. 1B). To define the domains responsible for this BubR1-p53 interaction, we incubated a series of GST-BubR1 and GST-p53 deletion mutants with extracts from HeLa cells expressing wild-type BubR1 or p53. As shown in Fig. 1C, a fragment consisting of the BubR1 NH2-terminal homology domain (amino acids 1–300), which is required for the kinetochore localization of BubR1, formed a complex with p53, whereas the central and COOH-terminal regions of BubR1 did not. Similarly, a fragment containing the NH2-terminal end of p53 (amino acids 1–143), which is required for transcriptional activity and MDM2 binding, interacted with BubR1, whereas amino acids 144 to 393 of p53, containing the DNA-binding and oligomerization motifs, did not (Fig. 1D). In a positive control experiment, we confirmed that BubR1 and p53 interacted with their well-defined binding partners, Bub3 and MDM2, respectively, under these experimental conditions (Fig. 1C and D).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 1. BubR1 interacts with p53 in vitro and in vivo. A, in vitro–translated BubR1 (IVT-BubR1) was incubated with beads binding either GST or GST-p53 (full-length). After binding, beads were resolved by SDS-PAGE and analyzed by immunoblotting using anti-BubR1 antibody (lanes 1–3). Purified His-p53 protein was incubated with beads binding GST-BubR1 (full-length). The beads were resolved by SDS-PAGE and analyzed by immunoblotting using anti-p53 antibody (lanes 4–6). B, HCT116 cell lysates were immunoprecipitated with normal IgG (control) or anti-BubR1 (top) or anti-p53 (bottom) antibody, and immunoprecipitates were immunoblotted with anti-p53 (top) or anti-BubR1 (bottom) antibody. C, structural schematic of BubR1, including its NH2-terminal homology and Bub3-binding, Cdc20-binding, and kinase domains. HeLa cell lysates were incubated with beads bound with GST alone or with a series of BubR1 deletion mutants fused to GST. Bound proteins were resolved and immunoblotted with anti-p53 or anti-Bub3 antibody (positive control). D, a structural schematic of p53, including its transactivation domain (TAD) and its MDM2-binding, DNA-binding, oligomerization, and securin-binding domain. HeLa cell lysates were incubated with beads bound with GST alone or with a series of p53 deletion mutants fused to GST. After binding, beads were resolved and immunoblotted with anti-BubR1 or anti-MDM2 antibody (positive control).
|
|
To determine whether the BubR1-p53 interaction was regulated in a cell cycle–dependent manner, we treated asynchronized HeLa cells with the microtubule-inhibiting agent nocodazole for 14 h (to generate synchronized cells), and then released cells into the cell cycle for 2 h (to generate postreleased cells). As shown in Fig. 2A
, flow cytometry analysis revealed that a larger proportion of treated cells were in the M phase, and that the phosphorylations of both BubR1 and histone H3, as mitotic markers, were rapidly elevated in these cells (Fig. 2B); moreover, this response has been shown to be required for checkpoint control (14, 15). Next, we assessed the relationship between the cell cycle and the BubR1-p53 interaction by incubating GST-p53(1–143) or GST-p53(144–393) with endogenous BubR1, and found that the interaction between GST-p53(1–143) and BubR1 was significantly higher in synchronized cells than in asynchronized or postreleased cells (Fig. 2C). To confirm this result, we immunoprecipitated endogenous p53 from asynchronized, synchronized, and postreleased cell lysates using anti-p53 antibody, and immunoblotted the immunocomplexes obtained with anti-BubR1 antibody. Consistent with the above results, we observed an increased interaction between BubR1 and p53 in synchronized cells (Fig. 2D), indicating that this interaction occurs in a mitotic cell cycle–dependent manner, with high levels of interaction in cells arrested in mitosis and relatively low levels in cells that had exited mitosis arrest.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 2. BubR1-p53 interaction may occur in a cell cycle–dependent manner. A and B, HeLa cells were treated with nocodazole (Noco; 100 ng/mL) for 14 h and then released into the cell cycle for 2 h (Noco/Release). Cells were harvested, stained with propidium iodide, and analyzed by flow cytometry to determine their DNA contents. Asyn, asynchronized cells (A). Lysates from asynchronized or synchronized HeLa cells were analyzed by immunoblotting using anti-BubR1, anti–phospho-H3 (P-H3), or anti-actin antibody (B). C, lysates were prepared as described in (A) and (B), incubated with GST, GST-p53(1–143), or GST-p53(144–393), and bound BubR1 was detected by immunoblotting. D, HeLa cell lysates (4 mg) were immunoprecipitated with normal IgG or anti-p53 antibody. Immunoprecipitates were immunoblotted with anti-BubR1 or anti-p53 antibody (control). Arrowheads, hyperphosphorylated (top) and hypophosphorylated (bottom) forms of BubR1 polypeptides.
|
|
BubR1 kinase contributes to phosphorylation of p53. To examine whether the BubR1-p53 interaction leads to p53 phosphorylation, protein lysates from control and nocodazole-treated HeLa cells were immunoblotted with antibodies specific for p53 phosphorylated at residues Ser9, Ser15, Ser20, Ser46, or Ser392. Interestingly, nocodazole treatment for 16 h increased total p53 protein levels and the phosphorylations of p53 at Ser15 and Ser46, whereas the phosphorylation levels at Ser9, Ser20, and Ser392 were unaltered (Fig. 3A
; Supplemental Fig. S1). Consistent with previous reports (8, 13, 21), our results suggest that p53 is phosphorylated and activated in response to late-stage mitotic spindle damage. Therefore, to determine whether the observed increase in phospho-p53 was due to BubR1 activity, we did in vitro BubR1 kinase assays using GST-p53 as a substrate. Immunoprecipitation of BubR1 from HeLa cells followed by incubation with [
32P]ATP and GST-p53 or GST alone revealed that the BubR1 immunocomplexes clearly phosphorylated GST-p53 but not GST alone (Fig. 3B, lanes 3 and 4). Similarly, when lysates from nocodazole-treated HCT116 cells expressing HA-tagged wild-type BubR1 (HA-BubR1WT), HA-BubR1(1–525), or HA-BubR1(526–1050) were immunoprecipitated with an anti-HA antibody and further incubated with GST-p53, immunoprecipitated BubR1WT phosphorylated GST-p53, whereas BubR1(1–525) and BubR1(526–1050) did not (Fig. 3B, lanes 5–7, top).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 3. BubR1 is capable of phosphorylating p53. A, nocodazole treatment, which induces spindle damage, triggers p53 phosphorylation during the later stages of mitosis. Lysates from nocodazole-treated HeLa cells were analyzed by immunoblotting with residue-specific phospho-p53 antibodies against Ser9, Ser15, Ser46, or Ser392, or with an anti-actin antibody (loading control). B, HeLa cell lysates were immunoprecipitated with an anti-BubR1 antibody, and the resulting immunocomplexes were incubated with either purified GST or GST-p53 in the presence of [ 32P]ATP. GST proteins were resolved by SDS-PAGE and visualized by Coomassie blue staining (lanes 1 and 2) or autoradiography (lanes 3 and 4). Immunoprecipitates were detected with an anti-BubR1 antibody (bottom). Mitotic HeLa cells transfected with HA-BubR1WT, HA-BubR1(1–525), or HA-BubR1(526–1050) were treated with 200 ng/mL of nocodazole and immunoprecipitated with anti-HA antibody, and then the immunoprecipitates were incubated with GST-p53 in the presence of [ 32P]ATP. GST-p53 was resolved and visualized as described above (lanes 5–7, top). *, nonspecific bands. HA-tagged BubR1 proteins were detected with an anti-HA antibody (lanes 5–7, bottom). C, nocodazole-treated HeLa cells were lysed and immunoprecipitated with anti-BubR1 or anti-IgG (control) antibodies, and the resulting immunoprecipitates were incubated with either purified GST or GST-p53 in the presence of unlabeled ATP. Bound p53 proteins were resolved by SDS-PAGE and detected using antibodies against p53 phosphorylated at specific residues (Ser15, Ser20, and Ser15). GST proteins were resolved by SDS-PAGE and visualized by Ponceau staining (bottom). Arrowhead, degraded form of the p53 polypeptide. D, HeLa cells were treated as follows: synchronized by double thymidine block and released for 2 h (Thy-DB), nocodazole treatment for 14 h (NR0), and nocodazole treatment and postrelease into the cell cycle for 3 h (NR3), 5 h (NR5), or 6 h (NR6). Cell lysates were immunoprecipitated with an anti-BubR1 antibody or normal IgG, and the resulting immunocomplexes were incubated with GST-p53 fusion proteins in the presence of [ 32P]ATP (lanes 1–12). HeLa cells were transfected with the Myc-BubR1WT, Myc-BubR1(1–525), Myc-BubR1(526–1050), Myc-BubR1K795R, or Myc-BubR1F1022S expression plasmids. Immunoprecipitation and phosphorylation analyses were done as described above. *, phosphorylated GST-p53 proteins. Myc-tagged BubR1 proteins were detected with an anti-Myc antibody (lanes 13–18, bottom).
|
|
Next, we examined whether the spindle damage–induced phosphorylations of p53 at Ser15 and Ser46 were mediated by BubR1. In nocodazole-treated HeLa cell extracts subjected to immunoprecipitation with anti-BubR1 antibodies or normal IgG (control) followed by incubation of the immunocomplexes with GST-p53 or GST alone and unlabeled ATP, the BubR1 immunocomplexes showed a strong signal with antibodies against p53 phosphorylated at Ser15 and Ser46, but not Ser20 (Fig. 3C), indicating that BubR1 was capable of phosphorylating p53 in vitro. Furthermore, we compared the phosphorylation of p53 by BubR1 at different stages of the cell cycle. HeLa cells synchronized by either thymidine-double block/postrelease (Thy-DB, G2 phase), nocodazole treatment (NR0, M phase) or nocodazole treatment/postrelease (NR5, exit of mitosis) were immunoprecipitated with anti-BubR1 antibodies or preimmune IgG (negative control). The resulting BubR1 immunocomplexes were incubated with [
32P]ATP and purified GST-p53 fusion proteins (Fig. 3D, lanes 1–6). Phosphorylation of the GST-p53 proteins by the BubR1 immunocomplexes was detected in samples from all three types of cell lysates, with higher levels clearly present in lysates prepared from nocodazole-treated cells (Fig. 3D, compare lanes 4 and 5 and lane 6). Furthermore, phosphorylation analysis using BubR1 immunoprecipitated from nocodazole-synchronized and postrelease cells at different time intervals revealed that the levels of radiolabeled GST-p53 protein gradually decreased as cells advanced from mitotic arrest to interphase (Fig. 3D, compare lanes 10 and 11 and lane 12), indicating that increased phosphorylation of p53 by BubR1 is likely to be a consequence of the increased interaction of p53 and BubR1 during mitosis. To further show that the phosphorylation of p53 requires active BubR1, we introduced point substitutions in the lysine and phenylalanine residues in the catalytic kinase domain of BubR1 potentially essential for phosphorylation reactions (K795R and F1022S, respectively), and expressed these mutants from a Myc-tagged mammalian expression construct. The mutant BubR1 proteins showed significantly reduced autophosphorylation and kinase activities (refs. 14, 20; data not shown). We then transfected cells with the K795R, F1022S, or wild-type Myc-tagged BubR1 constructs, along with constructs encoding amino acids 1 to 525 and 526 to 1050 as negative controls (Fig. 3D, lanes 13–18). Importantly, the K795R and F1022S point substitutions in BubR1 significantly reduced the phosphorylation of p53 compared with that by BubR1WT, strongly suggesting that the activity of BubR1 kinase is important for the phosphorylation of p53.
BubR1 regulates the stability of p53 via phosphorylation. We tested the effect of BubR1 on the stability and activity of p53 by transfecting HeLa cells with siRNA against BubR1 or luciferase (negative control). Interestingly, cells transfected with the BubR1 siRNA (which substantially depleted BubR1 protein levels) contained markedly lower levels of p53 (Fig. 4A
). Next, we generated stable BubR1 knock-down (BubR1KD) cells by transfecting HCT116 cells with siRNA against BubR1. The expression of BubR1 in these cells was
70% lower than that in control cells (Fig. 4B). We then compared p53 levels between HCT116 parental and HCT116-BubR1KD cells by treating cells with nocodazole for 12 h (which induced p53 phosphorylation) and then releasing them into the cell cycle (Fig. 4C, lanes 1–18). At the indicated time points, cells were harvested and immunoblotted with antibodies specific for p53 phosphorylated at Ser9 (negative control), Ser15, and Ser46. Interestingly, whereas phosphorylation was markedly evident at residues Ser15 and Ser46 in the parental HCT116 cells, the corresponding levels were very low in HCT116-BubR1KD cells (Fig. 4C, lanes 1–18). To further examine the stability of p53, we released HCT116 parental and HCT116-BubR1KD cells from nocodazole, exposed the cells to the protein translation inhibitor, cycloheximide, and then monitored the levels of p53 phosphorylation over time by immunoblotting and subsequent image analysis (Fig. 4C, lanes 19–36). Exposure to cycloheximide for 60 min decreased the levels of p53 phosphorylation at residues Ser15 and Ser46 by almost 80% in HCT116-BubR1KD cells, whereas steady state levels were observed in parental cells. Moreover, the level of phosphorylation at p53 residue Ser15 in HCT116-BubR1KD cells at 60 min posttreatment was similar to that in parental HCT116 cells at 180 min posttreatment. At 120 min posttreatment, HCT116-BubR1KD cells showed almost no detectable phosphorylation at residues Ser15 and Ser46, whereas both phospho-p53 proteins were stably detected in parental cells. These results were confirmed by examining two additional independent BubR1KD clones (data not shown). Together, these data strongly suggest that BubR1 regulates the stability of p53 via phosphorylation. Finally, to investigate whether p53 destabilization by targeted inhibition of BubR1 expression could be compromised by the introduction of exogenous BubR1 protein, we transfected HCT116 cells with control pSuper or the pSuper-BubR1 siRNA plasmid and further infected the cells with a recombinant adenovirus expressing LacZ (rAd-LacZ; control) or wild-type BubR1 (rAd-BubR1; Fig. 4D). We found that infection of rAd-BubR1 significantly restored p53 levels in BubR1 siRNA-transfected HCT116 cells, whereas infection with the control rAd-LacZ did not. In addition, immunofluorescence analyses at the single cell level confirmed that significantly less p53 was present in BubR1 knock-down cells compared with BubR1-competent parental cells (Supplemental Fig. S2). To rule out the possibility that the reduced levels of BubR1 expression in the knock-down cells was unrelated to BubR1-mediated checkpoint signaling, we treated HCT116 parental and HCT116-BubR1KD cells with nocodazole, and harvested the cells at various time points for flow cytometry (Fig. 5A
). Consistent with previous reports (14, 20), the frequency of aneuploid/polyploid cells was dramatically higher in BubR1KD cells than in BubR1-competent control cells, indicating that the levels of BubR1 protein in the knock-down cells seemed to correlate with decreased BubR1-mediated mitotic checkpoint function. Taken together, these data strongly suggest that BubR1 regulates the protein stability of p53.

View larger version (45K):
[in this window]
[in a new window]
|
Figure 4. BubR1 contributes to p53 stability via phosphorylation. A, HeLa cells were transiently transfected with 5 µg of either control luciferase siRNA or BubR1-targeting siRNA. Transfected cells were harvested for immunoblotting using anti-BubR1, anti-p53, or anti-actin antibodies. B, BubR1 knock-down (HCT116-BubR1KD) cells were established from HCT116 parental cells (control), as described in Materials and Methods. HCT116 and HCT116-BubR1KD cells were stained with anti-hBubR1 antibodies (green), and DNA was visualized using Hoechst dye (blue). C, HCT116 and HCT116-BubR1KD cells were treated with nocodazole for 12 h and released into the cell cycle (top). Cells were harvested at the indicated times for immunoblotting with anti-BubR1, anti-p53 (DO-1), anti-phospho-p53 at Ser15, Ser15, or Ser46, and anti-actin antibodies (lanes 1–18). HCT116 and HCT116-BubR1KD cells were treated with nocodazole for 12 h, treated with cycloheximide, and then released into the cell cycle (bottom). Cells were harvested at the indicated times for immunoblotting with anti-BubR1, anti-p53 (DO-1), anti–phospho-p53 at Ser9, Ser15, or Ser46, and anti-actin antibodies (lanes 19–36). D, HCT116 cells were transfected with the control pSuper (pS) or pSuper-BubR1 siRNA (pS-BubR1 siRNA) vectors and cultured for 18 h. Transfected cells were infected with rAd-LacZ or rAd-BubR1 at 2 x 106 plaque-forming units/mL, as described previously (20). After incubation for an additional 36 h, the cells were harvested and processed for immunoblotting with anti-BubR1, anti-p53 (DO-1), and anti-actin antibodies.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
Figure 5. Partial inhibition of BubR1 expression accelerates chromosomal instability and polyploidy in p53-null cells. A, HCT116, HCT116-p53KO, and HCT116-BubR1KD cells were synchronized by nocodazole (300 ng/mL) and harvested at the indicated times for flow cytometric analysis. Mitotic and polyploid cells were distinguished by DNA contents of 4N and 8N, respectively. B, HCT116, HCT116-p53KO, HCT116-BubR1KD, and HCT116-p53KO/BubR1KD cells were synchronized with a lower concentration of nocodazole (100 ng/mL) and harvested at the indicated times for flow cytometry.
|
|
Inhibition of BubR1 expression accelerates chromosomal instability and polyploidy in p53-null cells. It is generally believed that a partial loss of checkpoint function was not inherently lethal, and that chromosome missegregation during mitosis causes chromosome damage and other mitotic defects. Thus, as our established BubR1 knock-down cells showed
70% BubR1 expression compared with parental cells, they could be considered to reflect a partial inactivation of the mitotic checkpoint. It is also believed that more than half of the human cancers show alterations in the expression and/or sequence of the p53 gene. Therefore, to investigate the effect of BubR1 depletion on the frequency of polyploidy in p53-null cells, we developed BubR1/p53 double knock-down/knock-out cells (HCT116-p53KO/BubR1KD), using our BubR1KD cells and p53-null cells (HCT116-p53KO). Initially, we synchronized HCT116, HCT116-p53KO, and HCT116-BubR1KD cells using nocodazole and then subjected them to flow cytometric analysis. Consistent with previous reports (1, 3–7), HCT116-p53KO cells subjected to mitotic spindle damage showed increased polyploid cell populations (8N) and decreased apoptotic cell death, whereas parental cells avoided polyploidy by exiting mitotic arrest and undergoing apoptosis (Fig. 5A). These phenotypes are very similar to those seen in HCT116-BubR1KD cells (Fig. 5A). Next, HCT116, HCT116-p53KO, HCT116-BubR1KD, and HCT116-p53KO/BubR1KD cells were exposed to a reduced concentration of nocodazole that was sufficient to arrest cells in mitosis but was insufficient to induce widespread polyploidy or apoptosis (Fig. 5B). Our results revealed that nocodazole-treated parental cells accumulated primarily in the mitotic phase (4N), with relatively small proportions of apoptotic and polyploid cells observed in these samples. Under the conditions used, HCT116-p53KO and HCT116-BubR1KD cells also accumulated in the mitotic phase; apoptosis was significantly less prevalent in p53-null cells compared with parental cells, whereas polyploidy was slightly but significantly more prevalent in BubR1-depleted cells compared with parental cells. Interestingly, HCT116-p53KO/BubR1KD cells showed a dramatic reduction in the mitotic cell population and a marked increase in the polyploid cell population relative to HCT116-p53KO and HCT116-BubR1KD cells. Moreover, the prevalence of polyploidy in HCT116-p53KO/BubR1KD cells (
60%) was much higher than that seen in HCT116-p53KO (
5%) or HCT116-BubR1KD (
20%) cells after 60 to 72 h of nocodazole treatment. Thus, under conditions of prolonged mitotic arrest due to treatment with a microtubule inhibitor, coinhibition of BubR1 and p53 induced marked chromosomal instability and polyploidy.
To examine the effect of BubR1 and p53 knock-down/knock-out on the normal timing of mitotic progression, HCT116, HCT116-p53KO, HCT116-BubR1KD, and HCT116-p53KO/BubR1KD cells were synchronized at the boundary between the G1 and S phases, using a double thymidine block. Following release from the G1 or S phases in the absence of microtubule inhibitors, cells were harvested at various time points and analyzed by flow cytometry. As shown in Fig. 6A
, in the presence of a functional spindle, cells depleted of both BubR1 and p53 (HCT116-p53KO/BubR1KD) did not differ significantly from p53-null cells (HCT116-p53KO) in terms of progression through the S and G2 phases, mitosis, or exit from mitosis. Next, we examined the effect of BubR1 and/or p53 inhibition on mitotic cell cycle progression at the single cell level, using time-lapse photomicroscopy of HCT116, HCT116-p53KO, HCT116-BubR1KD, and HCT116-p53KO/BubR1KD cells transfected with an expression plasmid encoding an H2B-GFP fusion protein for the visualization of chromosomes. As each cell entered mitosis, nuclear envelop breakdown was set as time zero, and the relative times for the individual cell types to complete chromosome separation were determined (Fig. 6B and C). In HCT116-p53KO cells, the time to completion of chromosome separation was 54.4 (±6.3) min, which was very similar to that of control HCT116 cells, 53.7 (±7.9) min. In contrast, HCT116-BubR1KD cells showed a significantly faster exit from the mitotic cell cycle, at 41.5 (±4.6) min. However, further inhibition of BubR1 in p53-null cells (HCT116-p53KO/BubR1KD) did not seem to additionally retard or accelerate the duration of mitosis in the presence of a functional spindle.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 6. Effect of BubR1 and p53 knock-down/knock-out on the normal timing of mitosis progression. A, HCT116, HCT116-p53KO, HCT116-BubR1KD, and HCT116-p53KO/BubR1KD cells were synchronized at the G1-S boundary by double thymidine block (Thy-DB), and then released. At the indicated times, cells were stained with propidium iodide and analyzed by flow cytometry. Asyn, asynchronized cells. B and C, HCT116, HCT116-p53KO, HCT116-BubR1KD, and HCT116-p53KO/BubR1KD cells were transfected with an expression plasmid encoding the H2B-GFP fusion protein, cultured and imaged by time-lapse photomicroscopy during mitotic progression. Nuclear envelope breakdown (NEB) was designated time zero. Times from NEB to complete chromosome separation were measured. Representative time-lapse images of parental HCT116 cells expressing H2B-GFP (B). Mitotic progression data from randomly selected HCT116, HCT116-p53KO, HCT116-BubR1KD, and HCT116-p53KO/BubR1KD cells (C). Bars, the average mitotic duration in each cell line.
|
|
In summary, our results indicate that BubR1 interacts with, phosphorylates, and stabilizes p53, and further provide evidence that p53 activation induced by mitotic spindle damage is a response to BubR1-mediated signaling.
 |
Discussion
|
|---|
Normal cells harboring competent BubR1 and p53 proteins undergo prolonged mitosis arrest in response to spindle damage, and then subsequently exit mitosis and undergo apoptosis. Defects in BubR1 not only augment the development of aneuploidy, but also compromise spindle damage–induced apoptotic cell death. Similarly, p53-deficient cells do not undergo apoptosis, instead proceeding to aneuploidy. Although a recent study showed that prolonged mitotic arrest triggered by microtubule disruption could stabilize p53 by phosphorylation, in a pattern distinct from that seen in response to DNA damage (13), the molecular mechanisms underlying this effect are unknown. Additionally, although it is known that numerous kinases regulate the phosphorylation of p53, and the phosphorylation status of p53 is known to affect its stability, sequence-specific DNA binding and protein interaction affinity with target proteins, the mechanism by which these kinases trigger phosphorylation of p53 during mitosis are unknown. In this work, we found that the BubR1 mitotic checkpoint kinase interacts with p53 and contributes to p53 stabilization via phosphorylation. Silencing of BubR1 expression reduces this phosphorylation and consequently decreases the stability of p53, and this effect can be recovered by the introduction of exogenous BubR1 protein. These results collectively indicate that the p53 response to mitotic spindle damage is probably dependent on BubR1-mediated signaling, and that a functional cross-talk exists between BubR1 and p53 at the potential level of postmitotic regulation.
BubR1 protein and phosphorylation levels are higher in cells subjected to mitotic spindle damage compared with cells undergoing normal mitotic progression (14). Because BubR1 in unattached kinetochores exhibits a higher degree of phosphorylation than its soluble counterpart (22), we hypothesized that BubR1 hyperphosphorylation might contribute to stabilizing and/or activating p53 via phosphorylation. Interestingly, two kinase-insufficient mutants of BubR1 (BubR1K795R and F1022S) yielded significantly reduced levels of p53 phosphorylation. Moreover, BubR1-mediated phosphorylation of p53 was also reduced in cells exiting from mitosis following recovery from spindle damage. These observations strongly support our notion that the induction of p53 following mitotic checkpoint activation requires signaling via BubR1-mediated phosphorylation. Furthermore, the functional cross-talk between BubR1 and p53 is likely to be an important factor in the determination of subsequent postmitotic consequences, such as adaptation or apoptosis.
Two mitotic kinases, Aurora-A and polo-like kinase 1 (Plk1), regulate the mitotic cell cycle by controlling chromosome segregation, spindle assembly, and commitment to mitosis (23, 24). Aurora-A and Plk1 physically bind to and phosphorylate p53 (25, 26). Interestingly, whereas mitotic spindle damage induces phosphorylation and activation of p53, the phosphorylation events induced by Aurora-A and Plk1 actually reduce the activity of p53. Moreover, because Aurora-A and Plk1 are overexpressed in many human cancer cells (27–29), whereas BubR1 tends to be down-regulated in cancer cells (20), it is possible that BubR1 antagonizes the inhibitory effects of Aurora-A or Plk1 on p53. Although it is likely that p53 is also phosphorylated and activated by additional kinases that are induced by mitotic spindle damage, our present results suggest that p53 activation in response to mitotic spindle damage requires signaling via BubR1-mediated phosphorylation.
Because p53 degradation predominantly involves MDM2-mediated ubiquitination (30), we tested whether the stability of p53 was regulated by a mitotic spindle damage–induced functional interaction between BubR1 and MDM2. We transfected HeLa cells with siRNA targeting BubR1 and examined the levels of MDM2. In contrast to the dramatic p53 decrease observed after BubR1 siRNA knock-down, we did not observe any significant change in the MDM2 levels of these cells (Supplemental Fig. S3A). Furthermore, no significant interaction between BubR1 and MDM2 was detected in mammalian two-hybrid (Supplemental Fig. S3B) and immunoprecipitation (data not shown) experiments under conditions that yielded reproducible interactions between these two proteins in our experimental system. These results indicate that the destabilization of p53 observed in BubR1-depleted cells was independent of the MDM2-mediated ubiquitination pathway (Supplemental Fig. S3 and S4). However, in interphase cells, BubR1 could theoretically stabilize p53 by outcompeting its negative regulator, MDM2, because the BubR1-binding domain of p53 overlaps with the MDM2-binding domain (Fig. 1D). In addition, it is theoretically possible that BubR1 might transcriptionally and/or translationally regulate p53 expression. Importantly, this study showed that total p53 and p53 phosphorylated at Ser15 and Ser46 all accumulated to high levels in parental cells following mitotic spindle damage (Fig. 4C), and then gradually decreased as the cells progressed through the cell cycle to interphase. In addition, our kinase analyses revealed that kinase-insufficient BubR1 mutants were associated with significantly reduced phosphorylation of p53 (Fig. 2D), and BubR1-mediated phosphorylation of p53 was reduced in interphase cells or cells exiting from mitosis following spindle damage (Fig. 2D). Together, these findings strongly suggest that the effects of BubR1 on p53 exogenously expressed in mitotic cells was likely due to posttranslational modification of p53 rather than transcriptional control in the transcriptionally inactive mitotic cells.
Our additional investigation into the effect of BubR1 depletion on the frequency of polyploidy in p53-null cells in response to spindle damage revealed that cells depleted of both BubR1 and p53 showed significantly more aneuploidy/polyploidy than p53-null cells and BubR1-depleted cells (Fig. 5A and B). However, in the presence of a functional spindle, cells depleted of both BubR1 and p53 showed no significant differences from p53-null cells in terms of progression through the S and G2 phases, mitosis, or exit from mitosis (Fig. 5). These findings imply that BubR1 knock-down in p53-null cells augments the chromosomal instability and polyploidy induced by spindle damage. We recently reported that the sustained inactivation and/or down-regulation of BubR1 prevented the induction of apoptosis that normally follows postmitotic adaptation (20). Therefore, the findings of the present study provide evidence that p53 induction by mitotic checkpoint activation is a component of the BubR1-mediated checkpoint signaling pathway.
Taken together, our results strongly suggest that BubR1 interacts with and phosphorylates p53, thus contributing to the stabilization of p53. This functional cross-talk between BubR1 and p53 may represent a new molecular insight into how p53 is activated in response to spindle damage.
 |
Acknowledgments
|
|---|
Grant support: Research grants from the Korea Research Foundation (KRF-2005-042-E00020 and KRF-2005-041-C00452) and the Korea Science and Engineering Foundation through the Rheumatism Research Center (RII-2002-098-05003, 2006).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Bert Vogelstein (Johns Hopkins University, Baltimore, MD) for p53-null HCT116 cells, Jong Sun Kang (Mt. Sinai School of Medicine, New York, NY) for comments on the manuscript, and Hye-Young Park and Hyun-Jin Shin for technical assistance and materials.
 |
Footnotes
|
|---|
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).
Received 9/13/06.
Revised 4/10/07.
Accepted 5/25/07.
 |
References
|
|---|
- Minn AJ, Boise LH, Thompson CB. Expression of Bcl-xL and loss of p53 can cooperate to overcome a cell cycle checkpoint induced by mitotic spindle damage. Genes Dev 1996;10:2621–31.[Abstract/Free Full Text]
- Lanni JS, Jacks T. Characterization of the p53-dependent postmitotic checkpoint following spindle disruption. Mol Cell Biol 1998;18:1055–64.[Abstract/Free Full Text]
- Michel LS, Liberal V, Chatterjee A, et al. MAD2 haplo-insufficiency causes premature anaphase and chromosome instability in mammalian cells. Nature 2001;409:355–9.[CrossRef][Medline]
- Vogel C, Kienitz A, Hofmann I, Muller R, Bastians H. Crosstalk of the mitotic spindle assembly checkpoint with p53 to prevent polyploidy. Oncogene 2004;23:6845–53.[CrossRef][Medline]
- Cross SM, Sanchez CA, Morgan CA, et al. A p53-dependent mouse spindle checkpoint. Science 1995;267:1353–6.[Abstract/Free Full Text]
- Gualberto A, Aldape K, Kozakiewicz K, Tlsty TD. An oncogenic form of p53 confers a dominant, gain-of-function phenotype that disrupts spindle checkpoint control. Proc Natl Acad Sci U S A 1998;95:5166–71.[Abstract/Free Full Text]
- Ciciarello M. p53 displacement from centrosomes and p53-mediated G1 arrest following transient inhibition of the mitotic spindle. J Biol Chem 2001;276:19205–13.[Abstract/Free Full Text]
- Tritarelli A, Oricchio E, Ciciarello M, et al. p53 localization at centrosomes during mitosis and postmitotic checkpoint are ATM-dependent and require serine 15 phosphorylation. Mol Biol Cell 2004;15:3751–7.[Abstract/Free Full Text]
- Andreassen PR, Lohez OD, Lacroix FB, Margolis RL. Tetraploid state induces p53-dependent arrest of nontransformed mammalian cells in G1. Mol Biol Cell 2001;12:1315–28.[Abstract/Free Full Text]
- Shi Q, King RW. Chromosome nondisjunction yields tetraploid rather than aneuploid cells in human cell lines. Nature 2005;437:1038–42.[CrossRef][Medline]
- Fujiwara T, Bandi M, Nitta M, et al. Cytokinesis failure generating tetraploids promotes tumorigenesis in p53-null cells. Nature 2005;437:1043–7.[CrossRef][Medline]
- Margolis RL, Lohez OD, Andreassen PR. G1 tetraploidy checkpoint and the suppression of tumorigenesis. J Cell Biochem 2004;88:673–83.[CrossRef]
- Stewart ZA, Tang LJ, Pietenpol JA. Increased p53 phosphorylation after microtubule disruption is mediated in a microtubule inhibitor- and cell-specific manner. Oncogene 2001;20:113–24.[CrossRef][Medline]
- Taylor SS, Ha E, McKeon F. The human homologue of Bub3 is required for kinetochore localization of Bub1 and a Mad3/Bub1-related protein kinase. J Cell Biol 1998;142:1–11.[Abstract/Free Full Text]
- Mao Y, Abrieu A, Cleveland DW. Activating and silencing the mitotic checkpoint through CENP-E-dependent activation/inactivation of BubR1. Cell 2003;114:87–98.[CrossRef][Medline]
- Lampson MA, Kapoor TM. The human mitotic checkpoint protein BubR1 regulates chromosome-spindle attachments. Nat Cell Biol 2005;7:93–8.[CrossRef][Medline]
- Cahill DP, Lengauer C, Yu J, et al. Mutations of mitotic checkpoint genes in human cancers. Nature 1998;392:300–3.[CrossRef][Medline]
- Dai W, Wang Q, Liu T, et al. Slippage of mitotic arrest and enhanced tumor development in mice with BubR1 haploinsufficiency. Cancer Res 2004;64:440–5.[Abstract/Free Full Text]
- Baker DJ, Jeganathan KB, Cameron JD, et al. BubR1 insufficiency causes early onset of aging-associated phenotypes and infertility in mice. Nat Genet 2004;36:744–9.[CrossRef][Medline]
- Shin HJ, Baek KH, Jeon AH, et al. Dual roles of human BubR1, a mitotic checkpoint kinase, in the monitoring of chromosomal instability. Cancer Cell 2003;4:483–97.[CrossRef][Medline]
- Saito S, Yamaguchi H, Higashimoto Y, et al. Phosphorylation site interdependence of human p53 post-translational modifications in response to stress. J Biol Chem 2003;278:37536–44.[Abstract/Free Full Text]
- Chen RH. BubR1 is essential for kinetochore localization of other spindle checkpoint proteins and its phosphorylation requires Mad1. J Cell Biol 2002;158:487–96.[Abstract/Free Full Text]
- Nigg EA. Mitotic kinases as regulators of cell division and its checkpoints. Nat Rev Mol Cell Biol 2001;2:21–32.[CrossRef][Medline]
- Marumoto T, Zhang D, Saya H. Aurora-A—a guardian of poles. Nat Rev Cancer 2005;5:42–50.[CrossRef][Medline]
- Ando K, Ozaki T, Yamamoto H, et al. Polo-like kinase 1 (Plk1) inhibits p53 function by physical interaction and phosphorylation. J Biol Chem 2004;279:25549–61.[Abstract/Free Full Text]
- Katayama H, Sasai K, Kawai H, et al. Phosphorylation by aurora kinase A induces Mdm2-mediated destabilization and inhibition of p53. Nat Genet 2004;36:55–62.[CrossRef][Medline]
- Bischoff JR, Anderson L, Zhu Y, et al. A homologue of Drosophila aurora kinase is oncogenic and amplified in human colorectal cancers. EMBO J 1998;17:3052–65.[CrossRef][Medline]
- Zhou H, Kuang J, Zhong L, et al. Tumour amplified kinase STK15/BTAK induces centrosome amplification, aneuploidy and transformation. Nat Genet 1998;20:189–93.[CrossRef][Medline]
- Knecht R, Elez R, Oechler M, et al. Prognostic significance of polo-like kinase (PLK) expression in squamous cell carcinomas of the head and neck. Cancer Res 1999;59:2794–7.[Abstract/Free Full Text]
- Brooks CL, Gu W. p53 Ubiquitination: Mdm2 and Beyond. Mol Cell 2006;21:307–15.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
X. Cheng, Z. Shen, J. Yang, S.-H. Lu, and Y. Cui
ECRG2 Disruption Leads to Centrosome Amplification and Spindle Checkpoint Defects Contributing Chromosome Instability
J. Biol. Chem.,
February 29, 2008;
283(9):
5888 - 5898.
[Abstract]
[Full Text]
[PDF]
|
 |
|