| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology, and Genetics |
Department of Biochemistry and Microbiology, Loma Linda University School of Medicine, Loma Linda, California
Requests for reprints: Penelope J. Duerksen-Hughes, Department of Biochemistry and Microbiology, 121 Mortensen Hall, Loma Linda University School of Medicine, Loma Linda, CA 92354. Phone: 909-558-4300, ext. 81361; Fax: 909-558-0177; E-mail: pdhughes{at}llu.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
However, p53 is not indispensable for the induction of apoptosis (4, 5). This has clinical relevance, as more than half of human tumors lack wild-type p53. Therefore, if apoptosis is to be induced in these cells, p53-independent pathways must be engaged. This is particularly true in cervical carcinoma cases caused by human papillomavirus (HPV) 16 infection, as the viral E6 protein effectively eliminates cellular p53 by accelerating its proteolysis (6). E6-expressing cells, therefore, can function as a model system for discovering and studying p53-independent, DNA damage–triggered apoptotic pathways.
In contrast to the well-established role of transcriptional regulation, alternative splicing is only now emerging as an important mechanism for regulating gene function. It has been estimated that at least 74% of multi-exon genes are alternatively spliced (7), and these isoforms frequently have opposing functions. This may have a significant effect on a variety of cell processes, including apoptosis (8).
There is now ample evidence that aberrations of alternative splicing are widespread in tumors (9). Although the relationship between changes in splicing and tumor progression has not yet been well-defined, condition-dependent splicing alterations in such genes as FAS, RBM9, CD44, hnRNPA/B, APLP2, and MYL6 were found in breast cancer cells by using splicing-sensitive microarrays (10). Despite growing interest in splicing regulation and the discovery of a large number of genes involved in pre–RNA splicing, the mechanisms governing this process are not well-understood (11). It is believed that alternative splicing activity is regulated by the combinatorial actions of a fairly large number of regulatory factors, including two families of proteins that generally function in an antagonistic manner, heterogeneous ribonucleoproteins and SR (serine/arginine-rich) proteins (12).
SR proteins participate in both constitutive and alternative splicing. Although they seem to be functionally redundant in constitutive splicing, a growing body of evidence shows that they have distinctive and not fully overlapping functions in alternative splicing. Each particular SR protein is able to bind to a specific splicing enhancer and activate splicing of weak splicing sites, leading to altered splicing patterns of target genes (12).
In this report, we have investigated the early response of the osteosarcoma U2OSE64b (E6-expressing) and colon carcinoma HCT116 p53–/– cell lines to DNA damage caused by the genotoxic drug mitomycin C. The results from this study provide strong evidence that alternative splicing activity can be involved in regulating the stress response in the absence of the classical p53-dependent pathways.
| Materials and Methods |
|---|
|
|
|---|
Measurement of mitomycin C cytotoxicity. To measure cell survival following mitomycin C treatment, cells in exponential growth were exposed to mitomycin C (Roche) at the concentrations noted for the individual experiments. After incubation for the indicated time, the number of viable cells was quantified by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay as described earlier (14). Three independent experiments were each conducted in triplicate and significance was analyzed by Student's t test.
Immunoblot analysis. Proteins were extracted from cells (106) in 100 µL of Laemmli's buffer. Lysates were sonicated and protein concentration was determined by the DC protein assay (Bio-Rad). Lysates (15 µg) were separated on SDS-polyacrylamide gels and transferred onto Immobilon P membranes (Millipore). Membranes were probed with primary antibodies directed against p53 (NCL-p53-DO7; Novocastra), poly(ADP-ribose) polymerase-1 (PARP-1; Ab-2; EMD Biosciences), phosphorylated Chk1 (phospho-Chk1-Ser345; Cell Signaling Technology), ß-actin (Sigma), or pan-SR (1H4; American Type Culture Collection). After washing, membranes were incubated with the appropriate horseradish peroxidase–conjugated secondary antibodies (Sigma), and bands were detected using the SuperSignal West Substrate System (Pierce). Densitometry measurements were done using the ChemImager Imaging System and processed with the AlphaEase software package (Alpha Innotech).
Semiquantitative reverse transcriptase-PCR. Reverse transcriptase-PCR (RT-PCR) analysis was used to estimate transcript levels in total RNA samples isolated from cell cultures. Ten micrograms of total RNA was used as a template for cDNA synthesis with SuperScript III reverse transcriptase and an oligo(dT) primer according to the manufacturer's instructions (Invitrogen). The cDNA obtained was normalized by PCR with primers specific to cofilin1 (CFL1), a gene that showed no change in expression in microarray experiments (CCTTCCCAAACTGCTTTTGAT and CTGGTCCTGCTTCCATGAGTA). Serial dilutions of the normalized cDNA samples were used to find the linear range of amplification for gene-specific DNA fragments. PCR was done at 94°C for 30 s, at 57°C for 30 s, and at 72°C for 1 min for 35 cycles using Taq DNA polymerase and the recommended protocol (NEB). For the SRFS6 gene, primers were CAGGTCGAGTTCCAGAGATTA and TCAAACTGCAATTTCAACTCA. CD44-specific primers were taken from ref. (15).
Expression profiling by microarray analysis. Total RNA was extracted using Trizol Reagent (Invitrogen) and additionally purified using the RNeasy kit (Qiagen) according to the manufacturer's instructions. RNA samples from three independent replicates for each time point were further processed and hybridized to Affymetrix Human Genome U133A and U133B expression arrays according to standard recommended protocols (Affymetrix) at the DNA MicroArray Facility, University of California (Irvine, CA). To extract and analyze microarray data, we used the Microarray Suite 5.0, GCOS 1.2, and Data Mining Tools 3.0 programs (Affymetrix). To compare data from different arrays, the signal intensities of the arrays were globally scaled to 500 and normalization was done using a probe set of 100 constitutively expressed transcripts provided by Affymetrix. The signal log ratio was calculated by comparing transcripts between mitomycin C–treated and untreated cells. Generation of detected (present or absent) and changed (increased or decreased) calls was done using the Wilcoxon test and default variables of P value cutoffs. During the first step to identify genes with altered expression, we discarded genes that had changed calls in less than six out of nine comparative files (Rank test) as well as genes that had "absent" calls in all microarrays. The remaining genes were further analyzed using both a Student's t test and the Mann-Whitney test (P < 0.05 cutoffs). Genes were considered up-regulated if they passed the Mann-Whitney and Rank tests, and down-regulated if they passed the Rank and t tests.
Quantitative in vivo analysis of alternative splicing activity. Cells (5 x 105) were transfected with the pLuc14 plasmid containing a tau minigene fused to luciferase (16) as described previously (17) and split into a 96-well plate 24 h later. At 48 h posttransfection, cells were treated with 2 µg/mL of mitomycin C for the indicated amount of time and harvested in luciferase lysis buffer (Promega). Luciferase activity was quantified using a MicroLumatPlus microplate reader (Berthold Technology). Three independent experiments, were each conducted in triplicate, and significance was analyzed by one-way ANOVA. Differences were considered significant at a 0.05 level of confidence.
Inhibition of SFRS6 gene expression by small interfering RNA. Cells were transfected with predesigned small interfering RNAs (siRNA) for the human SFRS6 gene from Ambion or from Santa Cruz Biotechnology, or with control siRNA using the siRNA transfection kit as recommended by the manufacturer (Santa Cruz Biotechnology). Levels of silencing of the SFRS6 gene were evaluated by RT-PCR and immunoblot analyses as described above. Twenty-four hours posttransfection, cells were treated with mitomycin C for 24 h, followed by quantification of viable cells by the MTT assay (14). Three independent experiments were done, each was conducted in quadruplicate, and significance was analyzed by one-way ANOVA. Differences were considered significant at a 0.05 level of confidence.
| Results |
|---|
|
|
|---|
|
E6 alters the set of genes affected by DNA damage. The survival experiments described above indicated that the cytotoxicity of mitomycin C for both U2OS-derived cell lines was essentially equivalent. However, the differences in p53 levels suggested that the pathways involved might be quite different. Because we were interested in the early response of cells to DNA damage, we decided to evaluate the global changes in expression after 5 h of treatment with 2 µg/mL of mitomycin C. Based on the time of CHK1 kinase activation, at this drug concentration and time of treatment, the cells should have begun to respond to the insult. RNA samples were extracted from both cell lines, with and without mitomycin C treatment, and subjected to microarray analysis. According to the criteria outlined in Materials and Methods, we found 38 genes in U2OSE6AS cells and 22 genes in U2OSE64b cells that showed statistically significant up-regulation or down-regulation (Tables 1 and 2 ).
|
|
Fifteen genes were identified as up-regulated in U2OSE6AS cells by microarray analysis, with 13 of them representing genes with identified functions (Table 1). Among these genes, seven have well-documented relationships to p53-dependent apoptosis, including MDM2, ATF3, BTG2, PPM1D, NOXA, SESN2, and TP53INP1 (24–30). These data show that, as expected, DNA damage activated the p53-mediated response in U2OSE6AS cells.
A separate group of 22 genes with statistically significantly altered expression was identified in U2OSE64b cells treated with mitomycin C (Table 2). Interestingly, unlike the group of genes up-regulated in U2OSE6AS cells, more than half of the genes with increased expression in U2OSE64b cells (10 out of 18) are poorly characterized or entirely unknown.
Among the genes with known functions that are up-regulated, three participate in cell cycle regulation and five participate in the regulation of transcription and RNA processing. Interestingly, three genes are directly involved in RNA splicing, and two of them, SFRS6 and SFRS7, belong to the SR splicing factor family (31).
Splicing factors and alternative splicing activity are induced in U2OSE64b cells following DNA damage. To determine whether up-regulated transcription of genes encoding the splicing factors also corresponded to an increase at the protein level, we did immunoblot analysis using the pan-SR protein antibody, 1H4, which has been shown to recognize four human members of this family (32). In addition to increased protein levels for SRp55 encoded by SFRS6, we also found increased protein levels for the splicing factors SRp30 and SRp40 (Fig. 2A ). Only one of the splicing factors reactive with this antibody, SRp75, did not show an obvious change following treatment, whereas the other three SR splicing factors had a peak of expression at 5 h posttreatment. To determine whether this decrease was due to the lack of p53 or to some other activity of E6, we monitored SR protein expression in two isogenic cell lines: HCT116, which expresses wild-type p53, and HCT116 p53–/–. Results from the immunoblot analysis clearly showed that increased expression of the SRp55 splicing factor was seen only in the cells lacking p53 (Fig. 2B), indicating that it was the p53-degradatory activity of E6 that was responsible for SRp55 up-regulation.
|
Silencing the SFRS6 gene increases the survival of U2OSE64b cells following mitomycin C treatment. To explore the possibility that SRp55 activity might affect the overall cellular response to genotoxic stress, its expression was silenced by siRNA inhibition and the resulting sensitivity to mitomycin C treatment was evaluated by the MTT assay. To ensure that the silencing effect was specific, we did these survival experiments using two independently designed siRNAs. Transfection of U2OSE64b cells with each of these two siRNAs led to a sharp decrease in the corresponding mRNA level as estimated by semiquantitative RT-PCR (Fig. 3A ) and was accompanied by a substantial decrease in the SRp55 protein concentration (Fig. 3B). SRp55-depleted cells were then tested for cell viability following mitomycin C treatment. With both siRNA species, p53-deficient U2OSE64b, but not U2OSE6AS, cells showed a significantly higher resistance to drug treatment in the absence of SRp55 expression (Fig. 3C). The same tendency was observed with the HCT116 cells. Depletion of SRp55 activity in HCT116 p53–/– cells resulted in an increased resistance to mitomycin C at concentrations between 2 and 10 µg/mL, whereas it did not affect the sensitivity of the cells with wild-type p53 (Fig. 3D).
|
|
| Discussion |
|---|
|
|
|---|
We compared the genotoxic stress response in two pairs of cell lines. The first pair consisted of human osteosarcoma U2OS cells that stably expressed E6, U2OSE64b, or its antisense construct, U2OSE6AS, which was used as a control. To determine whether the changes in response were due the effects of E6 on p53 stability or to some other E6 activity, we employed a second pair of cell lines, HCT116, expressing wild-type p53 and its isogenic derivative HCT116 p53–/– (13). Immunoblot analysis of the U2OS-derived cells treated with mitomycin C showed that, as expected, the presence of E6 caused a sharp decrease in both baseline and induced levels of p53, (Fig. 1B), and in the HCT116 cells, a complete absence of p53 expression was detected in the null mutant (Fig. 2B). Survival experiments showed that expression of E6 in the U2OS cell lines did not alter sensitivity to treatment with mitomycin C, suggesting that U2OSE64b cells were able to effectively use p53-independent apoptotic pathways (Fig. 1A).
To examine changes at an early stage of the genotoxic stress response, we chose the 5 h exposure to 2 µg/mL of mitomycin C for expression analysis because CHK1 activation was already observed by this time, although the treated cells had not yet experienced PARP-1 cleavage, a hallmark of apoptosis (Fig. 1D). Consistent with the idea that an early response was being observed in our analysis, we found the global changes in transcription to be modest, both with respect to the number of identified genes with altered expression and with the magnitude of the differences.
Comparative global expression profiling confirmed the idea that p53 depletion by E6 expression significantly changes the set of genes engaged in the early response to DNA damage (Tables 1 and 2). Intriguingly, almost half of the identified up-regulated genes in U2OSE64b cells were genes with unidentified functions, suggesting the involvement of new and uncharacterized pathways and mechanisms in these cells. One of the most striking and unexpected observations of the microarray analysis was the induction of the SFRS6 and SFRS7 genes in E6-expressing cells. These genes code for proteins that belong to a family of 16 currently known human SR proteins which play a pivotal role in both constitutive and alternative regulation of RNA splicing (31). Immunoblotting using a pan-SR antibody (32) not only confirmed the up-regulation of the SRp55 protein, encoded by the SFRS6 gene, but also revealed the up-regulation of two other splicing factors, SRp30 and SRp40, in U2OS-derived cells (Fig. 2A). SRp55 was also observed to be up-regulated in HCT116 p53–/– cells (Fig. 2B). In addition, the observed increase of up to 50% in alternative splicing activity for the U2OS-derived cells (Fig. 2D), as well as a significant up-regulation in the HCT116 cells, shows that these changes in transcript and protein levels have a functional consequence. It is of interest to note that the profile of SR protein expression in U2OSE64b cells coincides with that of alternative splicing activity, suggesting that alternative splicing activation may be due to up-regulation of SR protein expression. The fact that similar responses were seen in the U2OS- and HCT116-derived cell lines indicates that the observed transient increase of alternative splicing activity was not specific to U2OS cells. It also points out that the response is dependent on the p53 status of a cell, and that it is therefore most likely the E6-p53 interaction that causes the increase in alternative splicing, rather than some other activity of E6.
A growing number of new findings including those involving MDM2 and MDM4 (37), SRPK1 (38), and TAF1 (39) show not only the existence of connections between the DNA damage response and changes in splicing, but also that these connections are functional. The results from this present study add another example to the literature regarding alternative splicing regulation, by showing a clear connection between DNA damage, splicing factor induction, and activation of alternative splicing.
The hypothesis that the activation of alternative splicing activity during the early response results in altered splicing patterns of target genes was verified by our identification of the CD44 gene as a target for which the splicing profiles changed dramatically within the first 5 h of drug treatment. CD44, a cell surface glycoprotein involved in cell-cell and cell-matrix interactions, is an example of a gene with multiple splice variants that are thought to affect events connected to cell proliferation and survival as well as adhesion and motility (40).
We found that CD44 isoforms containing v7 and v10 exons were highly responsive to the depletion of SRp55 activity in U2OS cells (Fig. 4B). Silencing of the SRp55 gene promotes an increase in the v7 360 bp band, which is compatible with CD44 variant types 7 (pmeta-2), 11, and 14 (35), and this variant decreases during the first 5 h of mitomycin treatment of U2OSE64b cells. Interestingly, the disappearance of this CD44v7 isoform after 5 h of treatment, and its reappearance after 10 h, coincides with the profile of SRp55 expression in these mitomycin C–treated cells, implying that its activity may be directly involved in v7-specific splicing regulation. Comparison of CD44 expression in U2OS and HCT116 cells revealed that its splicing patterns were cell type–specific. CD44 isoforms containing the v7 exon, which are induced in SRp55-depleted U2OS cells, are practically absent in HCT116, whereas the pattern of HCT116-specific isoforms detected by the v10 primer was very similar to that observed in U2OS cells following SRp55 depletion (Fig. 4B and C). Nevertheless, in spite of different baseline splicing patterns, the tendency of mitomycin C treatment to up-regulate the v6 isoforms and down-regulate the v10 isoforms is the same in both p53-deficient cell lines (Fig. 4A and C).
Finally, experiments using siRNA to inhibit SFRS6 gene expression show that the contributions of this SR protein to alternative splicing activity modify the genotoxic stress response in p53-deficient cells. Depletion of the SRp55 splicing factor in both U2OSE64b and HCT116 p53–/– cells resulted in a significant increase in cell viability following treatment with the genotoxic drug (Fig. 3C). This increase is particularly remarkable given the fact that the up-regulation of alternative splicing activity was time-dependent and was observed only within the first 8 h of treatment (Fig. 2D). These data suggest that in the absence of a p53-mediated response, splicing can be heavily involved in the modulation of cellular responses.
Alternative splicing is being increasingly recognized as a fundamental mechanism for the generation of protein diversity and as an important source of variability and complexity. It provides an additional mechanism for genes to be differentially expressed throughout development, and the loss of splicing fidelity, which often occurs during tumorigenesis, can result in the production of aberrant and alternative splice isoforms (9). It is worth noting that more than half of all human tumors lack wild-type p53, and the observed influence of p53 status on alternative splicing activity regulation in response to low doses of DNA-damaging agents may contribute to an increased loss of alternative splicing regulation in tumors. In this context, it is worth noting that p53 status has been linked to the presence or absence of aberrant transcripts in cancer cells (41, 42). The results of this report, together with observations described previously (37, 39), show the involvement of alternative splicing activity in modulating the response to genotoxic stress and provide new insights into the functions of alternative splicing.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Dr. J. Zhou (Department of Medicine and Program in Neuroscience, University of Massachusetts Medical School, Worcester, MA) for the LucM14 construct and Dr. B. Vogelstein (The Howard Hughes Medical Institute and the Ludwig Center for Cancer Genetics and Therapeutics, Johns Hopkins Kimmel Comprehensive Cancer Center, Baltimore, MD) for the IICT116 cell lines.
Received 1/11/07. Revised 5/18/07. Accepted 6/ 8/07.
| References |
|---|
|
|
|---|
isoform is both physically positioned and functionally competent to regulate multiple events of mRNA metabolism. J Cell Sci 1999;112:2647–56.[Abstract]This article has been cited by other articles:
![]() |
J. R. LOPEZ-EGIDO, Y. WANG, M. GRONBERG, P. GRIMFJARD, S. WANG, P. STALBERG, and B. SKOGSEID Differentially Regulated Genes in MEN1-transfected BON Cells Using RT-differential Display and Oligonucleotide Microarrays Anticancer Res, June 1, 2009; 29(6): 1859 - 1866. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |