Cancer Research Cancer Epigenetics  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 67, 8615, September 15, 2007. doi: 10.1158/0008-5472.CAN-07-0232
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kopitz, C.
Right arrow Articles by Krüger, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kopitz, C.
Right arrow Articles by Krüger, A.

Cell, Tumor, and Stem Cell Biology

Tissue Inhibitor of Metalloproteinases-1 Promotes Liver Metastasis by Induction of Hepatocyte Growth Factor Signaling

Charlotte Kopitz1, Michael Gerg1, Obul Reddy Bandapalli4, Dilek Ister1, Caroline J. Pennington6, Stephanie Hauser1, Christin Flechsig1, Hans-Willi Krell7, Dalibor Antolovic5, Keith Brew8, Hideaki Nagase9, Manfred Stangl2, Claus W. Hann von Weyhern3, Björn L.D.M. Brücher2, Karsten Brand4, Lisa M. Coussens10, Dylan R. Edwards6 and Achim Krüger1

1 Institut für Experimentelle Onkologie und Therapieforschung, 2 Chirurgische Klinik, and 3 Institut für Allgemeine Pathologie und Pathologische Anatomie, Klinikum rechts der Isar der Technischen Universität München, Munich, Germany; 4 Institute of Pathology and 5 Department of Surgery, University Hospital Heidelberg, Heidelberg, Germany; 6 School of Biological Sciences, University of East Anglia, Norwich, Norfolk, United Kingdom; 7 Roche Diagnostics GmbH, Penzberg, Germany; 8 Department of Biomedical Science, Florida Atlantic University, Boca Raton, Florida; 9 The Kennedy Institute of Rheumatology Division, Imperial College School of Medicine, London, United Kingdom; and 10 Department of Pathology and Comprehensive Cancer Center, University of California, San Francisco, California

Requests for reprints: Achim Krüger, Institut für Experimentelle Onkologie und Therapieforschung, Klinikum rechts der Isar der Technischen Universität München, Ismaninger Str. 22, D-81675 Munich, Germany. Phone: 49-89-4140-4463; Fax: 49-89-4140-6182; E-mail: achim.krueger{at}lrz.tu-muenchen.de.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Balanced expression of proteases and their inhibitors is one prerequisite of tissue homeostasis. Metastatic spread of tumor cells through the organism depends on proteolytic activity and is the death determinant for cancer patients. Paradoxically, increased expression of tissue inhibitor of metalloproteinases-1 (TIMP-1), a natural inhibitor of several endometalloproteinases, including matrix metalloproteinases and a disintegrin and metalloproteinase-10 (ADAM-10), in cancer patients is negatively correlated with their survival, although TIMP-1 itself inhibits invasion of some tumor cells. Here, we show that elevated stromal expression of TIMP-1 promotes liver metastasis in two independent tumor models by inducing the hepatocyte growth factor (HGF) signaling pathway and expression of several metastasis-associated genes, including HGF and HGF-activating proteases, in the liver. We also found in an in vitro assay that suppression of ADAM-10 is in principle able to prevent shedding of cMet, which may be one explanation for the increase of cell-associated HGF receptor cMet in livers with elevated TIMP-1. Similar TIMP-1–associated changes in gene expression were detected in livers of patients with metastatic colorectal cancer. The newly identified role of TIMP-1 to create a prometastatic niche may also explain the TIMP-1 paradoxon. [Cancer Res 2007;67(18):8615–23]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Metastasis and progressive scattering of tumor cells throughout tissues is the main cause of organ failure and subsequent death of cancer patients. Proteolytic remodeling of components of the extracellular matrix (ECM) in tissue interstitium is a prerequisite of the metastatic process (1). Matrix metalloproteinases (MMP) have long been thought to be major regulators of the pericellular protease-dependent steps of tumor progression (2). Altered expression profiles of some MMPs have been correlated with poor clinical prognosis for several human tumor types (3). Based on these facts, the historical view of MMPs and cancer was that they exerted proinvasive and prometastatic activity by mere ECM remodeling (1). Thus, it was hypothesized that therapeutic broad-spectrum inhibition of MMPs would result in antimetastatic activity (1). Indeed, under certain experimental circumstances, overexpression of the endogenous broad-spectrum metalloproteinase [including a disintegrin and metalloproteinase-10 (ADAM-10); ref. 4] inhibitor tissue inhibitor of metalloproteinases-1 (TIMP-1; ref. 5) can reduce tumor cell invasion (6, 7).

In contrast to these observations are other results, which are actually in agreement with clinical studies showing a correlation between elevated TIMP-1 expression and poor prognosis in many human cancer types (5, 8), where elevated levels of TIMP-1 either had no effect on metastasis (9) or led to increased incidence (10, 11) or growth (12) of primary tumors. These effects of TIMP-1 on cancer development have been attributed to its known proproliferative, antiapoptotic (5), or proangiogenic (13) activities, which are necessary but not sufficient for metastasis.

Tumor cell invasion and metastasis are the primary determinants of the survival of cancer patients (13). Signaling pathways leading to the expression of proteolytic enzymes have been suggested to be key mediators of invasive growth (14). Hepatocyte growth factor (HGF/scatter factor) signaling regulates a multitude of downstream prometastatic effector molecules, such as urokinase-type plasminogen activator (uPA), uPA receptor (uPAR), plasminogen activator inhibitor-1 (PAI-1), and MMPs (1517). HGF stimulates metastasis of diverse tumor cells (15) and elevated levels of circulating HGF (18) or aberrant activity of cMet (14) has been detected in patients with many cancer types, including non-Hodgkin's lymphoma (19) and colorectal cancer (14). Although elevated TIMP-1 expression in these patients correlates with decreased survival, a link between TIMP-1 and metastasis-promoting pathways has previously not been described. Here, we address this issue and report that elevated stromal levels of TIMP-1 induce HGF signaling, leading to enhanced expression of other metastasis-promoting genes. Consequently, susceptibility of the liver for metastasis of tumor cell lines of different origin was shown to be increased, assigning a new role to TIMP-1 as a factor creating a prometastatic niche.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and adenoviruses. HEK 293 (20), HT1080lacZ-K15 (21), L-CI.5s (22), and 293T cells (23) were cultured as described previously. NIH3T3 cells were cultured similarly to HT1080lacZ-K15 (21). Amino acids 1 to 126 of the human TIMP-1 cDNA (N-TIMP-1; ref. 24) were cloned into pSecTag2/Hygro A (Invitrogen). A DNA fragment consisting of Ig{kappa}-leader sequence and N-TIMP-1 cDNA or full-length human TIMP-1 cDNA (pGEMhTIMP-1; ref. 25), respectively, was obtained and cloned into the adenoviral shuttle plasmid pKA1 (26). Recombinant adenoviruses were generated, purified, and plaque titered as described previously (26). As control, Addl70-3, an adenovirus without transgene, was used (27). Functionality of adenoviral constructs was tested in vitro (data not shown). Adenoviral infection in vitro was done as described previously (26).

Experimental metastasis assays. Pathogen-free, athymic CD1nu/nu mice (Charles River) were injected i.v. with 2 x 109 plaque-forming units of Addl70-3, AdTIMP-1, and AdN-TIMP-1, respectively, or vehicle (1% glycerin in PBS) alone. Three days later, 5,000 lacZ-tagged murine T-cell lymphoma cells (L-CI.5s; ref. 22) or 1 x 106 lacZ-tagged human fibrosarcoma cells (HT1080lacZ-K15; ref. 21) were injected i.v. Alternatively, inoculation of tumor cells preceded the adenoviral transfer by 2 days (Fig. 1C ). Mice were sacrificed and their livers and lungs were removed at 6 days (L-CI.5s) or 21 days (HT1080lacZ-K15) after inoculation. The right lobe of each lung and three samples of each liver, with a volume of ~0.5 cm3, were snap frozen in liquid nitrogen for biochemical analysis, and left lung lobes and remaining liver were stained with 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside (X-Gal; Roche Diagnostics) as described (22). Blue multicellular foci on the surface of the livers (L-CI.5s) or lungs (HT1080lacZ-K15) were counted. Total metastasis burden was assessed by quantitative real-time PCR (RT-PCR) for lacZ. All animal experiments were done in compliance with the guidelines of the Tierschutzgesetz des Landes Oberbayern.


Figure 1
View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. TIMP-1–mediated reduction of formation of macrometastases but induction of liver-specific secondary spread of tumor cells. A and B, CD1nu/nu mice received the respective adenovirus 3 d before inoculation of L-CI.5s (A) or HT1080lacZ-K15 cells (B), respectively. Six or 21 d, respectively, after tumor cell inoculation, mice were sacrificed and livers and lungs were removed. A, top left, number of X-Gal–stained L-CI.5s macrometastases (>0.2 mm) over the whole liver surface was reduced by overexpression of human TIMP-1 or N-TIMP-1 compared with the virus control group. Columns, mean; bars, SE. Addl70-3: 67.60 ± 7.73, n = 5; AdTIMP-1: 38.50 ± 8.14, n = 6, P = 0.03; AdN-TIMP-1: 32.83 ± 8.32, n = 6, P = 0.009. Close-up pictures of the surfaces of representative X-Gal–stained L-CI.5s metastasis-bearing livers (bottom) show increased micrometastasis in livers with elevated levels of TIMP-1 or N-TIMP-1. Top right, the total L-CI.5s tumor burden in livers overexpressing the TIMP-1 variants was significantly increased compared with the virus control as detected by quantitative RT-PCR of lacZ in metastasis-bearing livers. Columns, mean of relative lacZ mRNA amount versus 18S RNA; bars, SE. Addl70-3: 0.22 ± 0.04, n = 3; AdTIMP-1: 1.99 ± 0.80, n = 4, P = 0.044; AdN-TIMP-1: 1.96 ± 0.76, n = 4, P = 0.041. B, significant reduction of HT1080 lung metastasis by overexpression of human TIMP-1. Top left, columns, mean of the number of X-Gal–stained metastases over the whole surface of the left lung lobe; bars, SE. Addl70-3: 38.1 ± 16.1, n = 16; AdTIMP-1: 2.5 ± 1.4, n = 10; P = 0.018. Significant increase of HT1080 metastasis in livers with elevated levels of TIMP-1. lacZ mRNA and 18S RNA levels were detected in total RNA of HT1080lacZ-K15 metastasis-bearing livers by quantitative RT-PCR. Top right, columns, mean of relative lacZ mRNA amount versus 18S RNA; bars, SE. Addl70-3: 0.016 ± 0.002; AdTIMP-1: 0.040 ± 0.007, n = 3, P = 0.04. Bottom, close-up pictures of the surfaces of representative X-Gal–stained HT1080 metastasis-bearing livers. C, effects of TIMP-1 elevation after tumor cell inoculation on liver metastasis. CD1nu/nu mice received the respective adenovirus 2 d after inoculation of L-CI.5s. Six days after tumor cell inoculation, mice were sacrificed and livers were removed and X-Gal stained. The number of macrometastases (>0.2 mm) was counted on the whole surface of the liver. Top left, columns, mean; bars, SE. Addl70-3: 45 ± 4, n = 4; AdTIMP-1: 44 ± 3, n = 4. Total metastasis burden was assessed by quantitative RT-PCR of the marker gene lacZ. Top right, columns, mean of relative lacZ mRNA versus 18S RNA; bars, SE. Addl70-3: 0.29 ± 0.16, n = 4; AdTIMP-1: 2.25 ± 0.62, n = 4. Bottom, X-Gal–stained livers. Representative pictures of each group. Bar, 200 µm. Asterisks, macrometastases; arrows, micrometastases.

 
Immunostaining. Fixed sections of livers of the different groups were paraffin embedded for immunostaining. Dewaxing, rehydration, blocking, and antigen retrieval of liver sections (4 µm) were done as described (28). Sections were incubated with primary antibodies [proliferating cell nuclear antigen (PCNA) antibody, 1:2,000, Novocastra Laboratories Ltd.; cMet antibody, 1:200, Santa Cruz Biotechnology] for 20 h at 4°C and washed in TBS, 0.1% (v/v) Tween 20. StreptAB Complex/HRP Duett Mouse/Rabbit kit (Dako Cytomation) and 3,3'-diaminobenzidine (DAB) substrate (DAKO Liquid DAB+ Substrate-Chromogen Solution, DAKO Corp.) were used for detection. Sections were counterstained with Mayer's hemalaun (Merck). For detection of cMet activation, unfixed fresh liver samples were embedded in Tissue-Tek OCT compound (Sakura Finetek), shock frozen on dry ice, and stored at –80°C until sectioning. Sections were dried, fixed in ice-cold acetone, dried at room temperature, rehydrated in TBS, blocked with 3% goat serum in TBS-Tween 20, and incubated with phosphorylated Met (Tyr1349) antibody [Cell Signaling Technology; 1:100 in antibody diluting buffer (DAKO)] overnight at 4°C. Counterstaining was done with 100 ng/mL 4',6-diamidino-2-phenylindole (DAPI; AppliChem). Sections were mounted with Moviol (Merck). Green fluorescent signal was displayed using stereomicroscope Axiovert 135 (Zeiss) with integrated digital camera disposing the AxioVision LE 4.2 software (Zeiss Vision GmbH).

HGF ELISA. Livers were perfused with 100 mL PBS before excision, sample preparation, purification (HiTrap heparin column, Amersham), and ELISA [rat HGF ELISA (Institute of Immunology Co. Ltd.)] were done following the manufacturers' instructions. This kit detects mouse HGF equally well (manufacturers' manual). The ELISA was done in duplicates and results were expressed as picogram HGF per milligram extracted liver.

In situ zymography and MMP-9 activity assay. In situ zymography was done and documented as described previously (29). To detect the origin of gelatinolytic activity, serial sections were overlaid with DQ-gelatin (Molecular Probes; ref. 29) containing either 10 µmol/L E64 (AppliChem), 10 µmol/L aprotinin (AppliChem), or 400 µmol/L 1,10-phenanthroline (AppliChem). MMP-9 activity was quantified by MMP-9 activity assay (Amersham) according to the manufacturer's instructions. The antibody used in this assay binds human and murine species of MMP-9 (manufacturer's information). MMP-9 activity in 80 µg total protein was determined. Assay was done in triplicates.

Patient material. Liver tissue of 14 patients with metastatic colorectal cancer (7 males and 7 females; mean age, 61.0 ± 2.3 years) was obtained from patients who had signed informed consent for scientific study of their tumors and surrounding tissues at the Department of Surgery of the Klinikum rechts der Isar or of the University Hospital Heidelberg. Tissue samples were harvested under identical, rigorous procurement protocol and snap frozen in liquid nitrogen immediately after surgical resection. "Normal" liver tissue was harvested from zones 2 cm distant from visible liver metastases. Three experienced pathologists from two independent institutions used cryodissected sections for confirmation of histologic identity. All samples were stored at –80°C until use.

RNA isolation, reverse transcription, design of primer and probes, and quantitative RT-PCR. RNA isolation and reverse transcription were done as described (28). Design of primers and probes for murine uPA, murine uPAR, murine PAI-1, murine matriptase, murine MMP-9, murine MMP-2, and murine ADAM-10 was described previously (28, 30, 31). The lacZ primer and probes were designed and obtained from Applied Biosystems (forward primer: 5'-CAAGCCGTTGCTGATTCGA-3'; reverse primer: 5'-GCTCATCCATGACCTGACCAT-3'; probe: 5'-FAM-ACCGTCACGAGCATCAT-nFQ-3'). All other quantitative RT-PCRs were done with inventoried primers and probes from Applied Biosystems. Quantitative RT-PCR was done as described previously (28).

Inhibition of HGF signaling by a specific kinase inhibitor. Three days before i.v. tumor cell inoculation, four mice were transduced with adenoviral vectors. Mice received 100 mg/kg of 2-(2,6-dichloro-4-(2-hydroxyethoxy)phenyl-4-(3-benzyloxyphenyl)-5-(2-[3-hydroxypropyl-amino]pyrimidin-4-yl)-N-H-imidazole (cMet inhibitor), with high affinity for cMet [dissolved in 6% (v/v) Tween 80 with two equivalents HCl], i.p. 1 h before and 1 h after tumor cell inoculation. I.p. treatment with the cMet inhibitor was continued daily (100 mg/kg/d). As control, mice were treated with vehicle alone. Three days after tumor cell inoculation, mice were sacrificed and livers were removed and X-Gal stained as described previously (22). Inhibition of cMet by this inhibitor was measured by an ELISA-type assay: Lysate of human colon adenocarcinoma HT29 cells was exposed to a microtiter plate with an antihuman HGF receptor antibody (BAF 358 ATP phosphorylation; R&D Systems). ATP phosphorylation of the receptor kinase (cMet kinase) was detected in the presence or absence of the test compounds using a phosphorylated tyrosine mouse IgG (Santa Cruz Biotechnology). The IC50 value for cMet inhibition is 2 nmol/L. Kinase inhibition activity against other kinases was measured as described by Fabian et al. [IC50 values: cyclin-dependent kinase 2, 290 nmol/L; HER4, 99 nmol/L; c-Jun NH2-terminal kinase (JNK) 1, 12 nmol/L; JNK3, 2 nmol/L; p38{alpha}, 10 nmol/L; p38ß, 18 nmol/L; other kinases (254 tested), >1,000 nmol/L; data not shown; ref. 32].

Knockdown of ADAM-10 in NIH3T3 cells. Oligodeoxynucleotides coding for small hairpin RNA interference (shRNAi) directed against murine ADAM-10 (small interfering RNA sequence: AACCTACGAATGAAGAGGGAC) were designed and obtained from Eurogenetec. Annealed shRNAis were cloned into pSiren-RetroQ (Clontech). Recombinant retroviruses were generated as described (23) by transient cotransfection of 293T cells with pHIT60 (23), pHCMV-G (33), and pSiren-RetroQ coding for anti-ADAM-10 shRNAi. Infection of NIH3T3 cells was done according to standard protocols (23). Transduced cells were selected with 20 µg/mL puromycin (Clontech).

cMet ELISA. For detection of membrane-bound cMet, NIH3T3 cells transduced with the different viral constructs were resuspended in 0.1 mol/L Tris, 10 mmol/L EDTA, and 0.1% Triton X-114 (AppliChem) at pH 7.5, supplemented with 10 µL Protease Inhibitor Cocktail (Sigma). Subsequently, cells were incubated for 5 min on ice and 5 min at 37°C and centrifuged for 5 min at 300 x g at 30°C. The lower phase containing the membrane proteins was used for ELISA. For detection of cMet shedding, transduced NIH3T3 cells were incubated with serum-free medium for 36 h. Total and cMet protein in membrane fractions and supernatants were quantified by bicinchoninic acid assay and cMet ELISA (Mouse HGF R/c-MET ECD DuoSet, R&D Systems), respectively, following the manufacturers' instructions. Assays were done in triplicates.

Statistical analysis. Data were tested for normal distribution and normally distributed data were tested by Student's t test, and where the normality test failed, Mann-Whitney test was applied. P < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reduction of experimental macrometastases but induction of scattered micrometastases in the liver by TIMP-1. To achieve elevated TIMP-1 expression in the host, we transduced full-length cDNAs of TIMP-1 by i.v. inoculation of adenoviral vectors into mice. Efficient adenoviral transduction of liver cells was determined by quantitative RT-PCR (Supplementary Fig. S1). Maintenance of transgene overexpression achieved by the adenoviral vectors until the end of all following metastasis assays was verified (Supplementary Fig. S1). To test the effects of elevated stromal TIMP-1 on tumor cell invasion, we used the well-established syngeneic in vivo metastasis assay with lacZ-tagged lymphoma cells (L-CI.5s), which form hepatic metastatic foci following i.v. injection. Colonies that we defined as macrometastases in livers reached the cutoff size of 0.2 mm in this assay at day 6 after tumor cell inoculation. At this time point, the combination of successful extravasation right after tumor cell inoculation and proliferation of the extravasated tumor cells for at least six days resulted in multicellular foci of this size. Detected micrometastases (<0.2 mm) resulted from additionally invaded tumor cells if their number exceeds the 5,000 inoculated tumor cells.

Three days after adenoviral gene transfer, TIMP-1–transduced and control mice were challenged with L-CI.5s tumor cells. The pattern of metastasis in TIMP-1–transduced livers was significantly altered compared with the control virus–transduced livers: Elevated levels of TIMP-1 correlated with significant reduction of the number of macrometastases (by 43%, P = 0.003; Fig. 1A, top left). However, on the level of micrometastases, no decrease but a drastic increase of scattered infiltrating tumor cells was detected in livers with elevated TIMP-1 (Fig. 1A). In one photographic frame (1.3 mm x 1.5 mm), already 623 micrometastatic foci at the liver surface were visible (Fig. 1A, bottom), showing that the number of scattered micrometastases in the entire liver by far exceeded the number of inoculated cells (5,000). Quantification of the tumor cell tag lacZ revealed an overall increase of total metastasis burden in livers transduced with TIMP-1 cDNA compared with the control (P = 0.044; Fig. 1A, top right), reflecting induction of micrometastasis.

To determine whether inhibition of macrometastasis but promotion of micrometastasis was a function of the metalloproteinase-inhibitory activity of TIMP-1, we investigated the effect of the N-terminal domain of human TIMP-1 (N-TIMP-1) harboring the metalloproteinase-inhibitory bioactivity on liver metastasis. Indeed, elevated levels of N-TIMP-1 significantly suppressed macrometastasis by 51% (P = 0.009; Fig. 1A) and promoted micrometastasis (P = 0.041; Fig. 1A), indicating that N-TIMP-1 is sufficient to evoke the described effects.

We used lacZ-tagged human fibrosarcoma cells (HT1080lacZ-K15) that typically form large pulmonary metastatic foci and only few single tumor cells as micrometastases, but no macrometastases, in livers (26) to exclude that the TIMP-1 effect was cell type dependent. After challenge of CD1nu/nu mice with HT1080lacZ-K15, significant reduction of lung metastasis by 93% was observed in TIMP-1–transduced animals compared with mice with virus control (P = 0.018; Fig. 1B, top left). Again, in livers with elevated TIMP-1 levels, a significant increase of the metastatic burden was found (P = 0.04; Fig. 1B, top right). No induction of HT1080lacZ-K15 micrometastasis was detected in lungs (data not shown). In the above experiments, no differences in metastasis between control virus–transduced mice and mice treated with vehicle alone were found, excluding effects of viral transduction itself (data not shown).

Effects of TIMP-1 elevation on liver metastasis after tumor cell inoculation. To determine whether TIMP-1 affects liver metastasis on two different levels, [i.e., on the level of initial manifestation and subsequent growth (leading to formation of macrometastases) or subsequent infiltration (micrometastases)], we inoculated L-CI.5s cells into CD1nu/nu 2 days before adenoviral transfer of TIMP-1 cDNA. The number of macrometastatic colonies was not affected compared with the control (Fig. 1C, top left). However, we still observed induction of micrometastasis compared with the control (Fig. 1C, bottom), resulting in a significantly increased total metastasis burden in livers with elevated TIMP-1 (Fig. 1C, top right). This indicates that micrometastases take advantage of the TIMP-1–modulated host microenvironment. In contrast, macrometastasis formation was only reduced when TIMP-1 was already elevated in the host at the time point of extravasation right after tumor cell inoculation (Fig. 1A).

Proliferation activity of TIMP-1–induced scattered liver micrometastases. To assess if the increased presence of invaded L-CI.5s cells in the liver was a function of TIMP-1–induced proliferation, we determined their proliferative status by examining PCNA expression. Indeed, infiltrating T-cell lymphoma cells in livers with elevated TIMP-1 or N-TIMP-1 were proliferatively active (Fig. 2A ), indicating a proproliferative effect of the TIMP-1–modulated environment on these cells, accounting for the increase of total metastasis burden in the liver. A proproliferative environment was further indicated by the presence of proliferating hepatocytes in these groups (Fig. 2A, arrows). In the control livers, proliferation was restricted to the macrometastases (Fig. 2A, left).


Figure 2
View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Induction of hepatocyte proliferation and HGF signaling by elevated levels of TIMP-1. A, PCNA staining of L-CI.5s metastasis-bearing liver sections (4 µm) 9 d after adenoviral gene transfer and 6 d after L-CI.5s inoculation. Representative sections. Asterisks, PCNA-positive hepatocytes; arrows, PCNA-positive micrometastases. B, left, HGF protein level 9 d after gene transfer and 6 d after L-CI.5s inoculation. HGF protein in pools of three livers per group was quantified by HGF ELISA (Addl70-3: 30.3 pg/mg; AdTIMP-1: 75.8 pg/mg; AdN-TIMP-1: 80.6 pg/mg). Right, HGF protein in metastasis-free livers 3 d after gene transfer. HGF protein in pools of three livers per group was quantified by ELISA (Addl70-3: 25.2 pg/mg; AdTIMP-1: 41.1 pg/mg; AdN-TIMP-1: 45.7 pg/mg). C, increased cMet expression in AdTIMP-1–transduced livers. Paraffin-embedded sections of L-CI.5s metastasis-bearing livers 9 d after adenoviral gene transfer and 6 d after tumor cell inoculation were immunohistochemically analyzed for cMet localization. Bottom inset, stronger staining for cMet was found within metastases compared with liver parenchyma; top inset, controls without primary antibody for each slide. Black arrows, additionally stained micrometastases. D, TIMP-1–induced activation of cMet. Cryosections of metastasis-bearing (top) and metastasis-free (bottom) livers, respectively, were immunohistochemically analyzed for phosphorylated cMet (phospho cMet). Counterstaining was done with DAPI. Asterisks, lumen of blood vessels; arrows, staining of phosphorylated cMet. Bar, 100 µm.

 
TIMP-1 induces HGF signaling in the liver. To elucidate a molecular mechanism responsible for the TIMP-1–induced proproliferative and proinvasive environment in the liver, we tested for expression of HGF, also known as scatter factor. Elevated levels of HGF correlated with the TIMP-1–induced scattered metastatic phenotype (Fig. 2B, left). In fact, increase of HGF expression was already a component of the TIMP-1–altered liver environment as it could already be detected 3 days after adenoviral gene transfer (i.e., at the time point of tumor cell challenge; Fig. 2B, right). In addition, cMet, the tyrosine kinase receptor of HGF, was elevated throughout the tissue of metastasis-bearing livers transduced by either TIMP-1 species (Fig. 2C) and in macrometastases (Fig. 2C, insets).

Elevated expression of either TIMP-1 variant led to markedly increased HGF signaling, as detected by immunohistochemical staining of phosphorylated cMet throughout the liver parenchyma (Fig. 2D). In control animals, activated cMet was very low even in macrometastases (Fig. 2D, top). Importantly, this TIMP-1–mediated induction of HGF signaling was already present 3 days after TIMP-1 gene transfer (Fig. 2D, bottom), at the time point of tumor cell challenge, suggesting that a HGF pathway-connected prometastatic niche has been formed.

Causal relationship between HGF signaling and TIMP-1–induced scattering of experimental liver metastasis. In TIMP-1–transduced animals, the scattered metastasis phenotype was already apparent 3 days after inoculation of L-CI.5s cells (Fig. 3A, top ). To investigate whether HGF signaling was essential for formation of scattered metastasis, we first transduced mice with AdTIMP-1 or Addl70-3 virus, treated the mice with a cMet inhibitor, and challenged with L-CI.5s cells. Kinase inhibition prevented formation of micrometastasis (Fig. 3A, bottom), indicating that HGF signaling was essential for TIMP-1–induced micrometastatic spread. The TIMP-1–induced significant increase of total metastasis burden compared with the control (P < 0.001; Fig. 3B) was significantly reduced by cMet inhibition (P < 0.001; Fig. 3B). The number of multicellular metastatic foci was significantly reduced by elevated levels of TIMP-1 compared with the control (P = 0.048; Fig. 3C), indicating that formation of macrometastasis is not affected by HGF signaling.


Figure 3
View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Reduction of TIMP-1–induced micrometastatic spread by cMet inhibition. A to C, CD1nu/nu mice were transduced with AdTIMP-1 or Addl70-3. Three days later, mice were treated with a cMet-specific kinase inhibitor [2-(2,6-dichloro-4-(2-hydroxyethoxy)phenyl-4-(3-benzyloxyphenyl)-5-(2-[3-hydroxypropyl-amino]pyrimidin-4-yl)-N-H-imidazole] or vehicle alone and challenged by inoculation of L-CI.5s cells. Three days after tumor cell inoculation, mice were sacrificed and livers were removed and X-Gal stained. A, pictures of the surface of representative livers of each treatment group. Bar, 0.1 mm. B, total metastasis burden in the liver as detected by quantitative RT-PCR of lacZ. Columns, mean; bars, SE. Addl70-3/vehicle: 0.059 ± 0.021; AdTIMP-1/vehicle: 0.728 ± 0.233; Addl70-3/cMet inhibitor: 0.040 ± 0.016; AdTIMP-1/cMet inhibitor: 0.051 ± 0.030; all n = 3. C, number of multicellular metastatic foci was counted on the whole surface of X-Gal–stained livers. Columns, mean; bars, SE. Addl70-3/vehicle: 55 ± 10; AdTIMP-1/vehicle: 36 ± 2; Addl70-3/cMet inhibitor: 42 ± 9; AdTIMP-1/cMet inhibitor: 25 ± 6; all n = 5.

 
Overexpression of TIMP-1 reduces metalloproteinase activity and increases activity of other proteases in the liver. As proteolytic activity is one prerequisite of metastasis, we next assessed whether TIMP-1–related changes in metastasis rely on modulated proteolytic activity. In situ zymography revealed gelatinolytic activity in macrometastatic foci in Addl70-3–transduced livers but not in foci of AdTIMP-1–transduced animals (Fig. 4A, left ). As this was inhibitable by the canonical metalloproteinase inhibitor 1,10-phenanthroline (Fig. 4B, left), we showed that the achieved TIMP-1 levels indeed inhibited MMP activity in vivo. No MMP-9–derived proteolytic activity was detected in livers with elevated TIMP-1 (Fig. 4C), indicating the expected functional activity of TIMP-1 to inhibit proMMP-9 activation.


Figure 4
View larger version (59K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Reduction of gelatinase activity but increase of non-MMP proteolytic activity by overexpression of TIMP-1 detected by in situ zymography. A, B, and D, cryosections of L-CI.5s metastasis-bearing livers, transduced by either AdTIMP-1 or Addl70-3, were overlaid with agarose containing DQ-gelatin (A). Parallel sections were overlaid with the same solution supplemented with 1,10-phenanthroline (B), E64, and aprotinin (D), respectively. Counterstaining was done with DAPI. White line, boundaries of metastases; asterisks, lumen of blood vessels; arrows, areas of micrometastases. C, inhibitory activity of TIMP-1 in the liver 3 d after adenoviral gene transfer was tested using a MMP-9 activity assay. Columns, mean; bars, SE. Addl70-3: 100 ± 23.23%, n = 4; AdTIMP-1: 0 ± 0%, n = 4.

 
The gelatinolytic activity detectable in TIMP-1–elevated liver parenchyma distant from metastases (Fig. 4A, right) was by and large metalloproteinase independent, as it was only slightly inhibitable by 1,10-phenanthroline (Fig. 4B). Addition of broad-spectrum cysteine protease inhibitor E64 (34) or broad-spectrum serine protease inhibitor aprotinin (35) to the in situ zymography DQ-overlay revealed the remaining gelatinolytic activity as partly derived from serine and cysteine proteases (Fig. 4D). Elevated levels of N-TIMP-1 had the same effects (data not shown). These data indicate that increased expression of TIMP-1 in the liver led to an increase of metalloproteinase-independent proteolytic activity.

TIMP-1–induced expression of metastasis-related genes in the liver. Induction of HGF signaling and nonmetalloproteinase proteolytic activity in liver parenchyma by TIMP-1 suggested an altered HGF signaling-related gene expression favoring metastasis. Therefore, we used quantitative RT-PCR to characterize the expression of HGF-inducible genes, HGF-activating proteases, as well as gelatinolytic proteases. Elevation of TIMP-1 led to increase of mRNA expression of uPA, uPAR, PAI-1, tissue plasminogen activator (tPA), matriptase, MMP-9, MMP-2, ADAM-10, cathepsin G, and neutrophil elastase in the tumor-free liver (Fig. 5 ). Elevated levels of N-TIMP-1 had the same effects (data not shown).


Figure 5
View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Common TIMP-1–associated alterations in gene expression in mouse and human. Mice were transduced with either control virus (Addl70-3) or AdTIMP-1. Three days later, mice were sacrificed and livers were removed. Normal liver samples of patients with metastatic colorectal cancer were obtained at least 2 cm distant from colorectal liver metastases during curative surgical interventions. Total RNA was isolated from murine and human liver samples and gene expression was assessed by quantitative RT-PCR. Human samples were initially tested for TIMP-1 expression and then divided into two subgroups according to their TIMP-1 expression levels (low TIMP-1: 21.22 ± 1.89, n = 6; high TIMP-1: 98.92 ± 19.84, n = 8; P < 0.001). All samples were tested for uPA, uPAR, PAI-1, tPA, matriptase, PCNA, MMP-2, MMP-9, ADAM-10, cathepsin G (Cath G), neutrophil elastase (NE), and Met mRNA expression. Columns, mean of gene expression in murine [Addl70-3 (n = 4) versus AdTIMP-1 (n = 3): uPA: 100 ± 16.3% versus 193.3 ± 20.3%; uPAR: 100 ± 15.3% versus 557.9 ± 63.2%; PAI-1: 100 ± 21.2% versus 5,083.0 ± 3,052.9%; tPA: 100 ± 18.4% versus 1,673.8 ± 465.2%; matriptase: 100 ± 4.4% versus 451.5 ± 33.8%; PCNA: 100 ± 82.7% versus 554.6 ± 80.3%; MMP-9: 100 ± 47.2% versus 494.1 ± 34.6%; MMP-2: 100 ± 45.9% versus 289.4 ± 63.2%; ADAM-10: 100 ± 35.7% versus 542.8 ± 397.4%; cathepsin G: 100 ± 52.6% versus 2,040.0 ± 721.1%; neutrophil elastase: 100 ± 66.0% versus 1,024.3 ± 541.1%; Met: 100 ± 9.3% versus 109.6 ± 8.9%] and human (low TIMP-1 versus high TIMP-1: uPA: 100 ± 16.6% versus 615.5 ± 61.2%; uPAR: 100 ± 20.7% versus 691.6 ± 131.1%; PAI-1: 100 ± 15.7% versus 107.1 ± 182%; tPA: 100 ± 10.8% versus 116.9 ± 18.6%; matriptase: 100 ± 18.1% versus 213.0 ± 24.4%; PCNA: 100 ± 24.3% versus 231.7 ± 50.7%; MMP-9: 100 ± 29.5% versus 2,418.6 ± 396.4%; MMP-2: 100 ± 30.6% versus 695.3 ± 590.9%; ADAM-10: 100 ± 11.1% versus 150.6 ± 33.9%; cathepsin G: 100 ± 31.9% versus 379.5 ± 107.8%; neutrophil elastase: 100 ± 75.5% versus 1621.6 ± 339.2%; Met: 100 ± 17.0% versus 111.5 ± 27.6%) livers; bars, SE. *, P < 0.05.

 
To test whether these TIMP-1–regulated changes in gene expression are of more general relevance, we measured TIMP-1 mRNA expression in human liver tissue samples distant from colorectal metastases. In normal tissue, elevated expression of TIMP-1 (relative mRNA expression: 98.92 ± 19.84, n = 8) was associated with increased mRNA expression of uPA, uPAR, matriptase, MMP-9, MMP-2, ADAM-10, cathepsin G, and neutrophil elastase compared with livers with significantly lower TIMP-1 expression (relative mRNA expression: 21.22 ± 1.89, n = 6, P < 0.001; Fig. 5). This difference also correlated with shorter time interval between detection of primary tumor and liver metastases [26.83 ± 5.81 months (n = 6) versus 13.75 ± 2.62 months (n = 8); P = 0.049].

Inhibition of cMet shedding by TIMP-1. Interestingly, although cMet protein was increased in livers with elevated TIMP-1 (Fig. 2C), mRNA expression of cMet was not up-regulated in these livers, neither at the time point of tumor cell inoculation (Fig. 5) nor in metastasis-bearing livers (Supplementary Fig. S2). Reduced shedding of cMet by TIMP-1–induced inhibition of metalloproteinase activity may account for the accumulation of cMet protein, but it was thus far unknown that TIMP-1 can inhibit its shedding. As this hypothesis cannot be addressed in vivo, we chose a murine nontumorigenic cell line expressing inhibitable metalloproteinases as well as cMet, thus providing all prerequisites for a proof-of-concept study. Overexpression of either TIMP-1 or N-TIMP-1 in NIH3T3 cells (Fig. 6A ) resulted in significantly augmented membrane-bound cMet protein in these cells compared with the virus control (both P ≤ 0.026; Fig. 6B), although RNA expression of cMet was not increased (both P > 0.33; Fig. 6C). TIMP-1 indeed inhibited cMet shedding, as reduced levels of soluble cMet were detected in supernatant of cells overexpressing TIMP-1/N-TIMP-1 compared with the control (both P ≤ 0.033; Fig. 6D). The elevated level of cell-associated cMet in cells overexpressing TIMP-1/N-TIMP-1 correlated with increased phosphorylation of cMet (Supplementary Fig. S3).


Figure 6
View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Preservation of cell-associated cMet by either TIMP-1 overexpression or ADAM-10 knockdown. NIH3T3 cells were infected either with Addl70-3 (NIH/Addl70-3), AdTIMP-1 (NIH/AdTIMP-1), AdN-TIMP-1 (NIH/AdN-TIMP-1 all adenoviruses with a multiplicity of infection of 100), with a retroviral vector coding for shRNAi targeting murine ADAM-10 (NIH-shADAM-10), or with a retroviral vector encoding scrambled shRNAi (NIH-scr). A, quantitative RT-PCR of human TIMP-1 (huTIMP-1; left) and murine ADAM-10 (muADAM-10; right), respectively, verified overexpression of TIMP-1/N-TIMP-1 and suppression of ADAM-10. Columns, mean of relative huTIMP-1 and muADAM-10 mRNA, respectively, versus 18S RNA; bars, SE. B, membrane preparations of transduced cells were tested for the presence of cMet by ELISA. Elevated levels of either TIMP-1 variant (left) or reduced levels of ADAM-10 (right) led to increased membrane-bound cMet protein compared with the controls. C, murine cMet (mu-cMet) expression in cells with either increased expression of TIMP-1/N-TIMP-1 (left) or reduced expression of ADAM-10 (right), respectively, was assessed by quantitative RT-PCR. Columns, mean of murine cMet mRNA versus 18S RNA; bars, SE. D, quantification of soluble cMet. FCS-free culture medium of transduced NIH3T3 cells was tested by cMet ELISA. Columns, mean of soluble cMet in culture medium; bars, SE. ELISAs were done in triplicates. Results of three independent experiments.

 
Activity of ADAM-10 regulates cMet shedding. Knockdown of ADAM-10 mRNA expression in NIH3T3 cells by 88% (Fig. 6A) led to a significant increase of membrane-bound cMet protein compared with the control (P = 0.018; Fig. 6B), whereas cMet mRNA expression was not enhanced (P = 0.2; Fig. 6C). ADAM-10 knockdown was verified on protein level (Supplementary Fig. S4). A significant reduction of shed cMet in the supernatant of cells with reduced ADAM-10 expression was detected (P = 0.021; Fig. 6D), indicating that depletion of ADAM-10 was sufficient to accumulate cMet on the cell surface. In addition, suppression of ADAM-10 mRNA expression significantly increased cMet signaling (Supplementary Fig. S3).

Together, these data suggest a molecular pathway regulated by TIMP-1 that could lead to a microenvironment with higher susceptibility to metastases.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study shows that host-derived TIMP-1 can promote liver metastasis by induction of HGF signaling. Until recently, the dominant concept of natural inhibitors of tumor-associated proteases focused on their capacity to repress activity of ECM remodeling enzymes, such as metalloproteinases. This view has undergone revision based on increased awareness of "degradome" functions of metalloproteinases and the tumor microenvironment and recognition of their participation during many stages of tumor progression (3).

The original hypothesis that TIMP-1 overexpression would yield a reduction in the number of successfully extravasated tumor cells into a target organ was based on numerous reports on the importance of MMPs for metastasis in many tumor models (36). In agreement with these and our previous studies indicating the importance of gelatinase inhibition for formation of macrometastases of the lymphoma model (28, 29), elevated host levels of TIMP-1 prevented macrometastases only when it was already increased at the time point of tumor cell inoculation. This confirms the already known effect of metalloproteinase inhibition by TIMP-1 on the level of extravasation.

In contrast to this inhibitory action on initial invasion, we reveal here for the first time an unexpected metastasis-promoting feature of TIMP-1 (i.e., induction of scattered invasion of tumor cells in liver parenchyma). The bulk of these micrometastases cannot derive from augmented extravasation of the L-CI.5s cells because the number of the proliferative active and scattered micrometastases by far exceeded the number of inoculated tumor cells. Previous studies have reported that, even when metalloproteinases are required for metastasis in a particular tumor model, TIMP-1 does not always suppress metastasis (9, 37), supporting the idea that TIMP-1 possesses a broad range of biological activities, some of which may be independent of its metalloproteinase-inhibitory function (11, 3840). Those variations of antitumorigenic efficacy of TIMP-1 have been suggested to depend on the concentrations of TIMP-1 (10, 41) or related to the proproliferative and antiapoptotic features of TIMP-1 (11, 12, 38).

The new aspect is that we found a proinvasive feature of TIMP-1 when elevated in the liver based on TIMP-1–induced stimulation of HGF signaling and downstream expression of metastasis-promoting genes. The N-terminal domain of TIMP-1, which includes the metalloproteinase-inhibitory domain, was sufficient to exhibit this effect, indicating that broad-spectrum inhibition of metalloproteinases is responsible for this scattering. In agreement with this notion, treatment with a synthetic broad-spectrum metalloproteinase inhibitor also leads to liver-specific promotion of metastasis in several xenograft models as well as in the syngeneic T-cell lymphoma model (42, 43). In addition, in the present study, promotion of liver metastasis was found, whereas lung metastasis was significantly reduced. Either TIMP-1 was not able to induce HGF signaling in the lung or induction of HGF signaling in the lung tissue has different effects on the formation of a premetastatic niche than in the liver parenchyma. However, several studies revealed that inhibition or overexpression of proteases or protease families evolves different effects on metastasis to liver versus lung (26, 4244). This leads to the hypothesis that metastasis to the liver requires a different repertoire of proteases than metastasis to the lung and that the different microenvironments present in these organs react differentially on changed proteolysis. The underlying mechanism of the organ specificity of the prometastatic effect of TIMP-1 will need to be determined in future studies.

Upon elevation of TIMP-1, we observed augmented HGF as well as cMet protein in livers. Simultaneous increase of HGF and functional cell-associated cMet can explain the overall increase of HGF/cMet signaling. Elevated presence of the active form of HGF, which is required for signaling (15), can derive from the observed up-regulation of the HGF-activating proteases uPA and matriptase (45, 46) in the liver. Active matriptase and uPA (also activated by matriptase; ref. 46) can lead to an additional increase of proteolytic activity by initiating a protease activation cascade, including the activation of plasminogen by uPA and of some pro-MMPs by active plasmin (47). Elevated levels of TIMP-1 in the liver also increased expression of cathepsin G, also a gelatinolytic enzyme (48), as well as expression of neutrophil elastase, which also enhances plasminogen activation (49). Such proteases are likely the source of the increased nonmetalloproteinase-derived proteolytic activity observed in metastasis-bearing liver sections with augmented TIMP-1 levels in situ. Interestingly, the TIMP-1–provoked gene expression signature of the experimental model resembled in some instances (matriptase, uPA, uPAR, PCNA, MMP-9, and cathepsin G) the signature observed in liver samples of colorectal cancers in patients with elevated levels of TIMP-1, which is a hint on general molecular mechanisms provoked by elevated stromal TIMP-1. In the future, stable knockdown of cMet in host and/or tumor cells will further characterize the role of TIMP-1–induced cMet signaling in liver metastasis.

A link between metalloproteinase inhibition and enhancement of HGF/cMet signaling was revealed by an in vitro biochemical assay: Elevated levels of TIMP-1/N-TIMP-1 preserved activatable cMet on cell surfaces by reduced cMet shedding. Interestingly, suppression of ADAM-10 also prevented shedding of cMet, indicating that ADAM-10 is involved in the regulation of cMet shedding. Sheddases are already known for their capacity to regulate cell surface–associated tyrosine kinase receptors (50). These data indicate that preservation of cMet is induced by TIMP-1 or N-TIMP-1 and may be a consequence of direct inhibition of ADAM-10 and thereby loss of its sheddase activity (4) or indirectly by inhibition of ADAM-10 activation.

Many tumor cell lines respond to elevated levels of HGF (scatter factor) with increased invasive behavior (15, 16). Indeed, the altered host environment fed back to the inoculated tumor cell lines, which expressed functional cMet (Supplementary Fig. S5). Thus, increased scattering of tumor cells in the liver parenchyma seems to be based on a reaction of the tumor cells to the TIMP-1–provoked change of homeostasis in the host. Identification of this TIMP-1–provoked prometastatic niche reveals a novel role for TIMP-1 during cancer progression and illuminates the intricacy of protease and protease inhibitor networks that regulate the penultimate step of cancer evolution and are one explanation for the association between tumor aggressiveness and increased levels of TIMP-1 in cancer patients.


    Acknowledgments
 
Grant support: Deutsche Forschungsgemeinschaft grant SFB 469 (A. Krüger), European Union Framework Programme 6, project LSHC-CT-2003-503297, Cancerdegradome (A. Krüger, K. Brand, and D.R. Edwards), and NIH grant AR40994 (K. Brew and H. Nagase).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Susanne Schaten and Katja Honert (both from Technische Universität München) for expert technical support.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 1/18/07. Revised 6/22/07. Accepted 7/11/07.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Overall CM, Lopez-Otin C. Strategies for MMP inhibition in cancer: innovations for the post-trial era. Nat Rev Cancer 2002;2:657–72.[CrossRef][Medline]
  2. Overall CM, Kleifeld O. Tumour microenvironment—opinion: validating matrix metalloproteinases as drug targets and anti-targets for cancer therapy. Nat Rev Cancer 2006;6:227–39.[CrossRef][Medline]
  3. Egeblad M, Werb Z. New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer 2002;2:161–74.[Medline]
  4. Amour A, Knight CG, Webster A, et al. The in vitro activity of ADAM-10 is inhibited by TIMP-1 and TIMP-3. FEBS Lett 2000;473:275–9.[CrossRef][Medline]
  5. Chirco R, Liu XW, Jung KK, Kim HR. Novel functions of TIMPs in cell signaling. Cancer Metastasis Rev 2006;25:99–113.[CrossRef][Medline]
  6. Elezkurtaj S, Kopitz C, Baker AH, et al. Adenovirus-mediated overexpression of tissue inhibitor of metalloproteinases-1 in the liver: efficient protection against T-cell lymphoma and colon carcinoma metastasis. J Gene Med 2004;6:1228–37.[CrossRef][Medline]
  7. Brand K. Cancer gene therapy with tissue inhibitors of metalloproteinases (TIMPs). Curr Gene Ther 2002;2:255–71.[CrossRef][Medline]
  8. Hammer JH, Basse L, Svendsen MN, et al. Impact of elective resection on plasma TIMP-1 levels in patients with colon cancer. Colorectal Dis 2006;8:168–72.[CrossRef][Medline]
  9. Krüger A, Fata JE, Khokha R. Altered tumor growth and metastasis of a T-cell lymphoma in Timp-1 transgenic mice. Blood 1997;90:1993–2000.[Abstract/Free Full Text]
  10. Goss KJ, Brown PD, Matrisian LM. Differing effects of endogenous and synthetic inhibitors of metalloproteinases on intestinal tumorigenesis. Int J Cancer 1998;78:629–35.[CrossRef][Medline]
  11. Rhee JS, Diaz R, Korets L, Hodgson JG, Coussens LM. TIMP-1 alters susceptibility to carcinogenesis. Cancer Res 2004;64:952–61.[Abstract/Free Full Text]
  12. Guedez L, McMarlin AJ, Kingma DW, Bennett TA, Stetler-Stevenson M, Stetler-Stevenson WG. Tissue inhibitor of metalloproteinase-1 alters the tumorigenicity of Burkitt's lymphoma via divergent effects on tumor growth and angiogenesis. Am J Pathol 2001;158:1207–15.[Abstract/Free Full Text]
  13. Wurtz SO, Schrohl AS, Sorensen NM, et al. Tissue inhibitor of metalloproteinases-1 in breast cancer. Endocr Relat Cancer 2005;12:215–27.[Abstract/Free Full Text]
  14. Trusolino L, Comoglio PM. Scatter-factor and semaphorin receptors: cell signalling for invasive growth. Nat Rev Cancer 2002;2:289–300.[CrossRef][Medline]
  15. Jiang WG, Martin TA, Parr C, Davies G, Matsumoto K, Nakamura T. Hepatocyte growth factor, its receptor, and their potential value in cancer therapies. Crit Rev Oncol Hematol 2005;53:35–69.[Medline]
  16. Fujiuchi Y, Nagakawa O, Murakami K, Fuse H, Saiki I. Effect of hepatocyte growth factor on invasion of prostate cancer cell lines. Oncol Rep 2003;10:1001–6.[Medline]
  17. Tacchini L, Matteucci E, De Ponti C, Desiderio MA. Hepatocyte growth factor signaling regulates transactivation of genes belonging to the plasminogen activation system via hypoxia inducible factor-1. Exp Cell Res 2003;290:391–401.[CrossRef][Medline]
  18. Kuroi K, Toi M. Circulating angiogenesis regulators in cancer patients. Int J Biol Markers 2001;16:5–26.[Medline]
  19. Hsiao LT, Lin JT, Yu IT, et al. High serum hepatocyte growth factor level in patients with non-Hodgkin's lymphoma. Eur J Haematol 2003;70:282–9.[CrossRef][Medline]
  20. Hitt M, Bett AJ, Addison CL, Prevec L, Graham FL. Techniques for human adenovirus vector construction and characterization. In: Adolph KW, editor. Viral gene techniques. San Diego: Academic Press; 1995. p. 13–30.
  21. Schweinitz A, Steinmetzer T, Banke IJ, et al. Design of novel and selective inhibitors of urokinase-type plasminogen activator with improved pharmacokinetic properties for use as antimetastatic agents. J Biol Chem 2004;279:33613–22.[Abstract/Free Full Text]
  22. Krüger A, Schirrmacher V, von Hoegen P. Scattered micrometastases visualized at the single-cell level: detection and re-isolation of lacZ-labeled metastasized lymphoma cells. Int J Cancer 1994;58:275–84.[Medline]
  23. Soneoka Y, Cannon PM, Ramsdale EE, et al. A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res 1995;23:628–33.[Abstract/Free Full Text]
  24. Wei S, Chen Y, Chung L, Nagase H, Brew K. Protein engineering of the tissue inhibitor of metalloproteinase 1 (TIMP-1) inhibitory domain. In search of selective matrix metalloproteinase inhibitors. J Biol Chem 2003;278:9831–4.[Abstract/Free Full Text]
  25. Parkes R, Meng QH, Siapati KE, McEwan JR, Hart SL. High efficiency transfection of porcine vascular cells in vitro with a synthetic vector system. J Gene Med 2002;4:292–9.[CrossRef][Medline]
  26. Kopitz C, Anton M, Gansbacher B, Krüger A. Reduction of experimental human fibrosarcoma lung metastasis in mice by adenovirus-mediated cystatin C overexpression in the host. Cancer Res 2005;65:8608–12.[Abstract/Free Full Text]
  27. Jones N, Shenk T. Isolation of deletion and substitution mutants of adenovirus type 5. Cell 1978;13:181–8.[CrossRef][Medline]
  28. Arlt M, Kopitz C, Pennington C, et al. Increase in gelatinase-specificity of matrix metalloproteinase inhibitors correlates with antimetastatic efficacy in a T-cell lymphoma model. Cancer Res 2002;62:5543–50.[Abstract/Free Full Text]
  29. Krüger A, Arlt MJ, Gerg M, et al. Antimetastatic activity of a novel mechanism-based gelatinase inhibitor. Cancer Res 2005;65:3523–6.[Abstract/Free Full Text]
  30. Banke IJ, Arlt MJ, Pennington C, et al. Increase of anti-metastatic efficacy by selectivity- but not affinity-optimization of synthetic serine protease inhibitors. Biol Chem 2003;384:1515–25.[CrossRef][Medline]
  31. Palosaari H, Pennington CJ, Larmas M, Edwards DR, Tjaderhane L, Salo T. Expression profile of matrix metalloproteinases (MMPs) and tissue inhibitors of MMPs in mature human odontoblasts and pulp tissue. Eur J Oral Sci 2003;111:117–27.[CrossRef][Medline]
  32. Fabian MA, Biggs WH III, Treiber DK, et al. A small molecule-kinase interaction map for clinical kinase inhibitors. Nat Biotechnol 2005;23:329–36.[CrossRef][Medline]
  33. Yee JK, Miyanohara A, LaPorte P, Bouic K, Burns JC, Friedmann T. A general method for the generation of high-titer, pantropic retroviral vectors: highly efficient infection of primary hepatocytes. Proc Natl Acad Sci U S A 1994;91:9564–8.[Abstract/Free Full Text]
  34. Barrett AJ, Kembhavi AA, Brown MA, et al. L-trans-Epoxysuccinyl-leucylamido(4-guanidino)butane (E-64) and its analogues as inhibitors of cysteine proteinases including cathepsins B, H and L. Biochem J 1982;201:189–98.[Medline]
  35. Fritz H, Wunderer G. Biochemistry and applications of aprotinin, the kallikrein inhibitor from bovine organs. Arzneimittelforschung 1983;33:479–94.[Medline]
  36. Coussens LM, Werb Z. Matrix metalloproteinases and the development of cancer. Chem Biol 1996;3:895–904.[CrossRef][Medline]
  37. Soloway PD, Alexander CM, Werb Z, Jaenisch R. Targeted mutagenesis of Timp-1 reveals that lung tumor invasion is influenced by Timp-1 genotype of the tumor but not by that of the host. Oncogene 1996;13:2307–14.[Medline]
  38. Chesler L, Golde DW, Bersch N, Johnson MD. Metalloproteinase inhibition and erythroid potentiation are independent activities of tissue inhibitor of metalloproteinases-1. Blood 1995;86:4506–15.[Abstract/Free Full Text]
  39. Porter JF, Shen S, Denhardt DT. Tissue inhibitor of metalloproteinase-1 stimulates proliferation of human cancer cells by inhibiting a metalloproteinase. Br J Cancer 2004;90:463–70.[CrossRef][Medline]
  40. Kong Y, Poon R, Nadesan P, et al. Matrix metalloproteinase activity modulates tumor size, cell motility, and cell invasiveness in murine aggressive fibromatosis. Cancer Res 2004;64:5795–803.[Abstract/Free Full Text]
  41. Yamauchi K, Ogata Y, Nagase H, Shirouzu K. Inhibition of liver metastasis from orthotopically implanted colon cancer in nude mice by transfection of the TIMP-1 gene into KM12SM cells. Surg Today 2001;31:791–8.[CrossRef][Medline]
  42. Krüger A, Soeltl R, Sopov I, et al. Hydroxamate-type matrix metalloproteinase inhibitor batimastat promotes liver metastasis. Cancer Res 2001;61:1272–5.[Abstract/Free Full Text]
  43. Della Porta P, Soeltl R, Krell HW, et al. Combined treatment with serine protease inhibitor aprotinin and matrix metalloproteinase inhibitor batimastat (BB-94) does not prevent invasion of human esophageal and ovarian carcinoma cells in vivo. Anticancer Res 1999;19:3809–16.[Medline]
  44. Tester AM, Waltham M, Oh SJ, et al. Pro-matrix metalloproteinase-2 transfection increases orthotopic primary growth and experimental metastasis of MDA-MB-231 human breast cancer cells in nude mice. Cancer Res 2004;64:652–8.[Abstract/Free Full Text]
  45. Mars WM, Zarnegar R, Michalopoulos GK. Activation of hepatocyte growth factor by the plasminogen activators uPA and tPA. Am J Pathol 1993;143:949–58.[Abstract]
  46. Lee SL, Dickson RB, Lin CY. Activation of hepatocyte growth factor and urokinase/plasminogen activator by matriptase, an epithelial membrane serine protease. J Biol Chem 2000;275:36720–5.[Abstract/Free Full Text]
  47. Reuning U, Magdolen V, Wilhelm O, et al. Multifunctional potential of the plasminogen activation system in tumor invasion and metastasis [review]. Int J Oncol 1998;13:893–906.[Medline]
  48. Capodici C, Berg RA. Cathepsin G degrades denatured collagen. Inflammation 1989;13:137–45.[CrossRef][Medline]
  49. Machovich R, Owen WG. An elastase-dependent pathway of plasminogen activation. Biochemistry 1989;28:4517–22.[CrossRef][Medline]
  50. Blobel CP. ADAMs: key components in EGFR signalling and development. Nat Rev Mol Cell Biol 2005;6:32–43.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
B. Foveau, F. Ancot, C. Leroy, A. Petrelli, K. Reiss, V. Vingtdeux, S. Giordano, V. Fafeur, and D. Tulasne
Down-Regulation of the Met Receptor Tyrosine Kinase by Presenilin-dependent Regulated Intramembrane Proteolysis
Mol. Biol. Cell, May 1, 2009; 20(9): 2495 - 2507.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
I. Gerin, G. W. Louis, X. Zhang, T. C. Prestwich, T. R. Kumar, M. G. Myers Jr., O. A. MacDougald, and W. B. Nothnick
Hyperphagia and Obesity in Female Mice Lacking Tissue Inhibitor of Metalloproteinase-1
Endocrinology, April 1, 2009; 150(4): 1697 - 1704.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
W. G. Stetler-Stevenson
Tissue Inhibitors of Metalloproteinases in Cell Signaling: Metalloproteinase-Independent Biological Activities
Sci. Signal., July 8, 2008; 1(27): re6 - re6.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Bendrik, J. Robertson, J. Gauldie, and C. Dabrosin
Gene Transfer of Matrix Metalloproteinase-9 Induces Tumor Regression of Breast Cancer In vivo
Cancer Res., May 1, 2008; 68(9): 3405 - 3412.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
J. Wu, J. Liu, M. P. Waalkes, M.-L. Cheng, L. Li, C.-X. Li, and Q. Yang
High Dietary Fat Exacerbates Arsenic-Induced Liver Fibrosis in Mice
Experimental Biology and Medicine, March 1, 2008; 233(3): 377 - 384.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J. Wels, R. N. Kaplan, S. Rafii, and D. Lyden
Migratory neighbors and distant invaders: tumor-associated niche cells
Genes & Dev., March 1, 2008; 22(5): 559 - 574.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kopitz, C.
Right arrow Articles by Krüger, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kopitz, C.
Right arrow Articles by Krüger, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online