| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
Departments of 1 Endocrinology, 2 Urology, 3 Molecular Cell Biology, and 4 Pathology, Leiden University Medical Center, Leiden, the Netherlands; 5 Departments of Clinical Research and Urology, University of Bern, Inselspital, Bern, Switzerland; 6 Centre René Huguenin and Institut National de la Sante et de la Recherche Medicale, Research Unit 735, St. Cloud, France; 7 Institut National de la Sante et de la Recherche Medicale, Research Unit 664, Laennec School of Medicine, Lyon, France; and 8 Department of Anatomy, School of Medicine, Zagreb, Croatia
Requests for reprints: Jeroen T. Buijs, Department of Endocrinology, Leiden University Medical Center, C4-R, Albinusdreef 2, 2333 ZA Leiden, the Netherlands. Phone: 31-71-5266652; Fax: 31-71-5248136; E-mail: J.T.Buijs{at}lumc.nl.
| Abstract |
|---|
|
|
|---|
10 years of follow-up. In line with these clinical observations, BMP7 expression is inversely related to tumorigenicity and invasive behavior of human breast cancer cell lines. Moreover, BMP7 decreased the expression of vimentin, a mesenchymal marker associated with invasiveness and poor prognosis, in human MDA-MB-231 (MDA-231)-B/Luc+ breast cancer cells under basal and transforming growth factor-ß (TGF-ß)–stimulated conditions. In addition, exogenous addition of BMP7 to TGF-ß–stimulated MDA-231 cells inhibited Smad-mediated TGF-ß signaling. Furthermore, in a well-established bone metastasis model using whole-body bioluminescent reporter imaging, stable overexpression of BMP7 in MDA-231 cells inhibited de novo formation and progression of osteolytic bone metastases and, hence, their metastatic capability. In line with these observations, daily i.v. administration of BMP7 (100 µg/kg/d) significantly inhibited orthotopic and intrabone growth of MDA-231-B/Luc+ cells in nude mice. Our data suggest that decreased BMP7 expression during carcinogenesis in the human breast contributes to the acquisition of a bone metastatic phenotype. Because exogenous BMP7 can still counteract the breast cancer growth at the primary site and in bone, BMP7 may represent a novel therapeutic molecule for repression of local and bone metastatic growth of breast cancer. [Cancer Res 2007;67(18):8742–51] | Introduction |
|---|
|
|
|---|
Members of the transforming growth factor-ß (TGF-ß) superfamily, which include bone morphogenetic proteins (BMP), are involved in the control of many different biological processes, including cell proliferation, differentiation, apoptosis, and regulation of invasiveness (12–14). In normal and nonmalignant epithelial cells, TGF-ß is a potent growth inhibitor (15, 16). However, different types of carcinomas often escape this tumor-suppressing activity and become refractile to growth inhibition (15, 16). Even more, TGF-ß can also potentiate tumorigenesis and contribute to the progression and invasiveness of various carcinomas (8, 17, 18). Accordingly, it has been shown that a blockade of TGF-ß (signaling) inhibits tumor cell viability, migration, and metastasis (19), including the formation of bone metastases (20, 21).
The homodimeric protein BMP7 induces MET in normal and nontransformed cells (14, 22). For instance, during kidney development, BMP7 is essential for the condensation and epithelialization of the metanephric mesenchyme in the kidney, resulting in the formation of the tubular epithelium (9–11, 14). Furthermore, BMP7 seems to be involved in the preservation of the epithelial phenotype (23, 24), decreases fibrogenesis (23–25), and causes repression of inflammation (26, 27).
In this study, we present a cross-talk between BMP7 and TGF-ß signaling in the regulation of EMT in breast cancer and identify BMP7 as a potential therapy for metastatic bone disease.
| Materials and Methods |
|---|
|
|
|---|
Putative BMP7 effects on luciferase expression by MDA-231-B/Luc+ cells have been tested and excluded (data not shown).
Generation of isogenic BMP7-overexpressing cell lines using targeted integration. MDA-231 cells that display a unique predilection for bone (MDA-231-BO2; ref. 31) were selected to generate a stable cell line that overexpresses BMP7. Stable cell lines were generated using the Flp-In system (Invitrogen) according to the manufacturer's protocol (32). In short, a MDA-231-BO2-Flp-in host cell line (MDA-231-BO2-Frt11) was generated by stable introduction of a single copy of a Flp recombinase target (FRT) site as an integral part of an antibiotic resistancy gene in the genome of these cells. Subsequently, a luciferase-expressing subclone (MDA-231-BO2-Frt11/Luc+) was generated as described previously (28). This clone was used for the generation of isogenic stable cell lines by transient cotransfection of an FRT-targeting vector and a Flp recombinase expression vector. The FRT-targeting vector was either a pcDNA5/FRT vector (Invitrogen) expressing green fluorescent protein (GFP; control) or BMP7 (target gene) under the control of the cytomegalovirus (CMV) promotor. Due to Flp-mediated recombination at the genomic FRT site, this targeting vector was incorporated in the genome. Simultaneously, a shift in antibiotic resistance was introduced allowing positive selection for integrants in the genomic FRT site only and negative selection for random integrants in one single step (32). This method allows the generation of isogenic stable cell lines, which only differ in sequence inserted in the genomic FRT site, thereby eliminating the need for clonal selection. It is important to note that both the MDA-231-BO2-Frt11 and MDA-231-BO2-Frt11/Luc+ cell line were validated for in vivo bone metastasis formation.
Patients. We retrospectively analyzed tumor tissue from 67 primary unilateral nonmetastatic ductal breast carcinomas excised from women treated at Centre René Huguenin (St. Cloud, France) from 1980 to 1994. The samples were examined histologically for the presence of tumor cells. A tumor sample was considered suitable if the proportion of tumor cells was >70%. Immediately after surgery, the tumor samples were stored in liquid nitrogen until RNA extraction.
Standard prognostic factors are presented in Supplementary Table S1. All patients were treated by hormone therapy only after surgery. The patients had physical examinations and routine chest radiography every 3 months for the first 2 years, followed by annual examination (mammograms). The median follow-up was 11.2 years (range, 1.5–20.3 years). Thirty-five patients were without relapse (
10 years of follow-up), 17 patients developed exclusively visceral metastases (liver and/or lung), and 15 patients developed exclusively bone metastases. Immunohistochemical validation was done on fixed, paraffin-embedded tissue sections from primary breast tumor specimens (8 of 67).
ELISA for human BMP7. Levels of BMP7 in conditioned medium were measured with a commercially available specific ELISA kit using sandwich enzyme immunoassay technique (R&D Systems). Cells were routinely cultured for 4 days.
Real-time reverse transcription-PCR. Total RNA was extracted with the RNeasy Midi kit (Qiagen) from in vitro cultured cells at 70% to 80% confluence. Reverse transcription was done with random primers in the presence of RNase inhibitor (Roche Diagnostics). Quantitative real-time reverse transcription-PCR (qPCR) was done using commercially obtained exon-specific primers for BMP7, E-cadherin, vimentin, and ß-actin (Applied Biosystems) on an ABI Prism 7700 Sequence Detection System (Applied Biosystems). All experiments were done in duplo on four different samples. For BMP7 mRNA detection in patients, qPCR (including thermal cycling conditions) was done as described previously (33). Each sample was normalized based on its TATA box-binding protein (TBP) content. Primers used were as follows: BMP7 ATGGCCAACGTGGCAGAGAA (forward) and CAGCCCAGGTCTCGGAAGCT (reverse) and TBP TGCACAGGAGCCAAGAGTGAA (forward) and CACATCACAGCTCCCCACCA (reverse). All qPCR values were normalized using the comparative method of Livak and Schmittgen (34).
Western blot. Cells were seeded in six-wells plates at a density of 20,000/cm2 in DMEM with 0.1% Fetal Clone II (FCII; HyClone, Perbio Science Nederland B.V.) for MDA-231-B/Luc+. After 18 h, cells were stimulated with recombinant human mature BMP7 [rhBMP7; 0.5 mg batches; Creative Biomolecules; rhBMP7 was freshly dissolved to a stock solution [1 mg/mL in 20 mmol/L acetate buffer with 5% mannitol (pH 4.5)] and was obtained from Dr. Vukicevic, Department of Anatomy, School of Medicine, Zagreb, Croatia; ref. 35] and/or porcine TGF-ß2 (R&D Systems). After an additional 48 h, cells were lysed and collected in 250 µL lysis buffer [20 nmol/L Tris (pH 7.5), 20% glycerol, 400 mmol/L KCl, 1 nmol/L DTT, aprotinin (1:1,000), Roche protease inhibitor mix] followed by one or two rounds of freeze/thawing and used for Western blot analysis as described earlier (36). Rabbit polyclonal antibodies
-vimentin (diluted 1:500; ab7783, Abcam) and
-E-cadherin (diluted 1:500; Santa Cruz Biotechnologies, Tebu-bio), and a mouse monoclonal antibody
-ß-actin (clone AC-15, Sigma-Aldrich) were used as primary antibodies.
Cells grown on chamber slides. MDA-231-B/Luc+ cells were seeded at a density of 20,000/cm2 in DMEM with 0.1% FCII in eight chamber slides (Falcon, Becton Dickinson), and growth factors were added after 18 h. After 30 h, cells were dried for 5 min and fixed with 3.7% paraformaldehyde (pH 6.8; Merck, VWR) in PBS for 10 min and stained for vimentin as described for tissues, with the exception of the antigen retrieval step (see section histomorphometry, histochemistry, and immunohistochemistry). Images were acquired using a color charge-coupled device (CCD) camera mounted on a Nikon Eclipse 610 microscope at a 20-fold magnification. Subsequently, cells were scored double blind for positive vimentin staining from four randomly chosen fields by two investigators (J.T.B. and P.G.M.v.O.).
Transient transfections and transcription reporter assays. MDA-231 cells were seeded at a density of 7,500 cells/cm2 in DMEM with 10% FCII in 24-well plates. On the subsequent day, cells were transiently transfected with 1 µg of the indicated constructs using Fugene 6 (Roche) transfection reagent following manufacturer's protocol. To correct for transfection efficacy, 100 ng Renilla luciferase (pRL-CMV or pRL-CAGGS, both from Promega) was cotransfected. On day 3, cells were serum starved for 24 h before stimulation with TGF-ß and/or BMP7 for a duration of 30 h. On day 5, luciferase activities were quantified using Dual-Luciferase Assay (Promega; ref. 37). Firefly luciferase activity was corrected for Renilla luciferase activity. The experiments were done in 4-fold and repeated at least twice. Values are expressed as mean ± SE.
Luciferase reporter gene constructs. For intracellular signaling of TGF-ß, the CAGA-luciferase construct, consisting of 12 Smad3/Smad4 binding sequences (CAGA boxes) and the luciferase-coding sequence, was used. The CAGA boxes confer TGF-ß stimulation to a heterologous promoter reporter construct, whose activity depends on binding of activated Smad3/Smad4 transcription factor complexes (37).
The BRE-luciferase construct, which is based on the mouse Id1 promoter, was used to study the presence and functionality of BMP receptors (38).
Animals. Female nude mice (BALB/c nu/nu) were purchased from Charles River. Animals were housed in individual ventilated cages under sterile condition, and sterile food and water were provided ad libitum. Animal experiments were approved by the local committee for animal health, ethics and research of Leiden University and carried out in accordance with European Communities Council Directive 86/609/EEC. For surgical and analytical procedures, mice were anesthetized by i.p. injection of a 50 µL 1:1:1 mixture; ketamine HCl (stock solution of 100 mg/mL Nimatek, Vetimex Animal Health B.V.) + xylazine (2% Rompun, Bayer AG) + PBS (pH 6.8). At the end of the experimental period, animals were sacrificed by cervical dislocation.
Animal models. All cells were harvested at 70% to 80% confluence after changing to geneticin-free medium 24 h before inoculation.
For tumor growth in the bone marrow, single-cell suspensions of 2.5 x 105 MDA-231-B/Luc+ cells/10 µL PBS were injected into the right tibiae of 6-week-old mice as described previously (28, 39).
Three days after intraosseous inoculation of MDA-231-B/Luc+ cells, the animals were equally distributed into three experimental groups based on a comparable tumor burden/mouse, as detected by whole-body bioluminescent reporter imaging (BLI). From this time point (day 0) and during a subsequent period of 24 days, all animals received vehicle or rhBMP7 (10 or 100 µg/kg/d) treatment by tail vein injection. The progression of intraosseous growth was monitored by BLI at days 3, 10, 17, and 24 and by radiography at days 17 and 24 (28, 39).
Six-week-old mice were also intraosseous inoculated (1.0 x 105 cells/10 µL PBS) with either MDA-231-BO2-Frt11(GFP)/Luc+ cells (n = 8) or MDA-231-BO2-Frt11(BMP7)/Luc+ cells (n = 5). The progression was monitored by BLI weekly and by radiography at the end of the experiment (day 28; refs. 28, 39).
For orthotopic tumor growth, single-cell suspensions of 1.0 x 106 MDA-231-B/Luc+ cells/10 µL PBS were inoculated via a 0.5 mL U-100 insulin needle (29G 1/2, BD Micro-Fine, Becton Dickinson) into the mammary fat pads of 7-week-old mice. Animals were equally distributed into two experimental groups based on a comparable tumor burden/mouse, as detected by BLI. From this time point (day 0), all animals were given vehicle or BMP7 (100 µg/kg/d) treatment by tail vein injection. Subsequently, the progression of orthotopically growing tumors was monitored weekly by BLI (28, 39).
Nude mice (4.5 weeks old) were inoculated (5.0 x 105 cells/100 µL PBS) in the tail artery with either MDA-231-BO2-Frt11(GFP)/Luc+ cells (n = 13) or MDA-231-BO2-Frt11(BMP7)/Luc+ cells (n = 8), as described earlier (31). The progression was monitored by BLI weekly and by radiography at the end of the experiment (day 28; refs. 28, 39).
After the experimental periods, mice were sacrificed by cervical dislocation.
Mammary fat pads and tibiae with tumors were dissected and processed for further histomorphometrical and immunohistochemical analysis (see below).
Whole-body BLI of isogenic BMP7- and GFP-overexpressing cell lines. In animals that were inoculated with either MDA-231-BO2-Frt11(GFP)/Luc+ or MDA-231-BO2-Frt11(BMP7)/Luc+, the luciferase activity was visualized through imaging of whole bodies with an intensified CCD video camera of the in vivo Imaging System (IVIS 100, Xenogen). The animals were anesthetized using the isofluorane anesthesia system (XGI-8, Xenogen) and injected i.p. with 2 mg D-luciferin sodium salt (Synchem OHG) dissolved in PBS. Animals were kept anesthetized, and measurements were done 5 min after the injection of D-luciferin. Bioluminescence imaging was acquired with a 15-cm FOV, a medium binning factor, and exposure times of 10 to 60 s. Imaging data were analyzed by using the program living image (Xenogen). Values are expressed as relative light units (RLU) in photons per seconds.
Radiographical analysis. Radiographic analyses of osteolytic lesions were assessed by radiography (Kodak X-OMAT TL film, Eastman Kodak Co.) using a Hewlett Packard X-ray system Faxitron 43805 and quantified using NIH Image 1.62b7 software as described earlier (39).
Histomorphometry, histochemistry, and immunohistochemistry. After orthotopic tumors and bone metastasis were fixed in 3.7% paraformaldehyde (pH 6.8) in PBS and processed, they were submitted to Goldner staining, staining for tartrate-resistant acid phosphatase (TRAcP), H&E staining, or immunohistochemical staining as described previously (39, 40). Histomorphometric measurements of tumor burden were done on central sections through the tumor (largest tumor area). Tumor growth in bone could be readily identified by pancytokeratin staining alone or in combination with H&E staining. Total tumor areas, as an estimate of total tumor burden, was measured by image analysis using NIH Image 1.62b7 image analyses software as described previously (39). Subsequently, a distinction was made between the total tumor burden and the intraosseous and extraosseous tumor burden as described previously (39).
The following rabbit polyclonal antibodies were used at a concentration of 10 µg/mL:
-human pancytokeratin (DAKO),
-human vimentin (ab7783),
-human BMP7 (2854ab, directed against prodomain of BMP7, obtained from Dr. Vukicevic; refs. 35, 41),
-phosphorylated Smad1 (PS1; ref. 42), and normal rabbit IgG (Jackson ImmunoResearch) antibodies as negative control. Goat
-rabbit IgG (DAKO) was used as secondary antibody. For antigen retrieval, slides were treated for 10 min at 37°C with 5 µg/mL proteinase K (Invitrogen). To quantify PS1 and TRAcP staining, three histological sections per mouse (n = 8) were acquired using a color CCD camera mounted on a Nikon Eclipse 610 microscope at a 20-fold magnification. Subsequently, the number of cells that stained positive was scored single blind by two investigators (G.v.d.P. and P.G.M.v.O.).
BMP7 staining on patient material was done similarly, except that 5% normal goat serum (Jackson ImmunoResearch)/0.5% Boehringer Milk Powder (Boehringer Mannheim)/TTBS was used instead of 0.5% Boehringer Milk Powder/TTBS for incubation and first antibody dilution, and 0.01 mol/L citrate buffer (pH 6.0; 7 min at 98°C) was used as antigen retrieval step, unless stated otherwise.
Statistical analysis. Survival rates were determined using the log-rank test. Because BMP7 mRNA levels in patients did not follow a Gaussian distribution, (a) the mRNA levels in each subgroup of samples were characterized by their median values and ranges, rather than their mean values and coefficients of variation and (b) relationships between the molecular markers and clinical and histological variables were tested using the nonparametric Mann-Whitney U test. Other data are represented as mean ± SE. In vivo tumor growth was analyzed by general linear model with repeated measurements using a least significant difference (LSD) post hoc test when applicable. Other statistical evaluations were carried out by ANOVA using a LSD post hoc test when applicable.
| Results |
|---|
|
|
|---|
In patient-matched normal ducts of the breast, apical BMP7 staining could be observed (Fig. 1, top ). Staining intensity of BMP7 protein in primary breast cancer specimens was in accordance with BMP7 mRNA levels (Fig. 1, middle). Adult kidneys were used as positive (Fig. 1, bottom left) and negative (Fig. 1, bottom right) control.
|
|
Next, we tested whether BMP7 acts on MDA-231 cells to inhibit the acquisition of an invasive, mesenchymal phenotype by antagonizing Smad-dependent TGF-ß signaling.
The presence of functionally active TGF-ß receptor complexes, particularly ALK5, in MDA-231 cells was shown by the dose-dependent activation of the CAGA-luciferase reporter, whose activity depends on activated Smad3/Smad4 transcription factor complexes (Fig. 2D). Addition of BMP7 to TGF-ß–stimulated MDA-231 cells significantly inhibited the TGF-ß–driven CAGA-luciferase activity (P < 0.001).
Addition of BMP7, but not TGF-ß, stimulated BRE4-luciferase activity, indicating the presence of functioning, activated type I BMP receptor complexes in MDA-231 cells (Fig. 2D). TGF-ß antagonizes BMP7–induced BRE-luciferase activity (P < 0.001).
It is important to note that BMP7 did not affect proliferation of MDA-231-B/Luc+ cells in vitro using different cell culture conditions (1% FCS and 10% FCS; Supplementary Fig. S1).
BMP7 overexpression and experimental bone metastasis. As detected with ELISA, overexpression of BMP7 in MDA-231 cells [MDA-231-BO2-Frt11(BMP7)/Luc+] resulted in substantial secretion of BMP7 protein in the medium, 6.55 ng BMP7 protein/106 cells/d. In contrast, BMP7 protein was not detectable in the control cell line [MDA-231-BO2-Frt11(GFP)/Luc+], <0.03 ng BMP7 protein/106 cells/d.
Overexpression of BMP7 in MDA-231 cells [MDA-231-BO2-Frt11(BMP7)/Luc+] significantly inhibited both the intrabone growth (P = 0.034), osteolytic area (P = 0.007), and extraosseous extension (P = 0.042) when compared with control [MDA-231-BO2-Frt11(GFP)/Luc+; Fig. 3A ]. Moreover, in an experimental model of bone metastasis using tail inoculation of breast cancer cells, overexpression of BMP7 in MDA-231 cells [MDA-231-BO2-Frt11(BMP7)/Luc+] was shown to significantly inhibit the number of osteolytic lesions (P = 0.025; Fig. 3B and C). In line with the ELISA data described above, overexpression of BMP7 protein in tumor cells was also detected in histological sections in bone metastasis from MDA-231 cells overexpressing BMP7 [MDA-231-BO2-Frt11(BMP7)/Luc+], but not in the GFP control cell line (Fig. 3B). In addition, a trend was noticed for less overall total tumor burden as detected by BLI (P = 0.10; Fig. 3C). Furthermore, it is important to note that BMP7 overexpression did not affect the growth rate in vitro [doubling time MDA-231-BO2-Frt11(BMP7)/Luc+ cells: 21.0 h versus MDA-231-BO2-Frt11(GFP)/Luc+ cells: 20.9 h].
|
|
|
|
| Discussion |
|---|
|
|
|---|
It has been well established that the process of EMT provides mechanisms for breast epithelial cells to overcome physical constraints imposed on them by intercellular junctions and adopt a motile phenotype (3, 8, 46). It is becoming increasingly clear that this local invasive process, representing initial stages of the metastatic cascade during carcinogenesis, is adapted from the remarkable epithelial plasticity (EMT) that occurs during embryonic development and postnatal tissue maintenance (2, 47). In many cancers, TGF-ß is a protumorigenic factor that stimulates oncogenic EMT (8, 17, 18). In contrast, BMP7 is a strong inducer of the reverse process (MET) during embryonic development (9–11, 14) and in renal fibroblasts (22). Moreover, BMP7 can inhibit TGF-ß–induced fibrosis (25) and counteracts TGF-ß–induced EMT in normal renal epithelial cells (24).
We show here that BMP7 mRNA expression is inversely related to tumorigenicity and invasive behavior of human breast cancer cell lines. Functional studies reveal that BMP7 overexpression by breast cancer cells inhibits de novo formation of osteolytic bone metastases and, hence, the metastatic capability of breast cancer cells in our in vivo bone metastasis model. Furthermore, BMP7 overexpression significantly inhibited tumor growth in bone. In keeping with these functional data, daily systemic administration of BMP7 strongly and significantly impairs both the orthotopic and intraosseous growth of human MDA-231-B/Luc+ breast cancer cells in nude mice.
Our in vitro studies reveal for the first time that BMP7 is a potent inhibitor of TGF-ß–induced EMT in MDA-231 cancer cells. In these cells, BMP7 is able to counteract Smad-dependent TGF-ß signaling. These actions of BMP7 may be of critical importance and could explain the observed beneficial effects of experimental BMP7 treatment on orthotopic growth and skeletal metastasis. In this context, it is important to note that inactive TGF-ß is concentrated and stored in high amounts in extracellular bone matrix and can be released and activated by osteoclastic resorption. Activated bone matrix–derived TGF-ß may act as a paracrine growth factor for neighboring osteolytic cancer cells that may have colonized the bone marrow (21, 40, 48). Our in vivo data further support this notion because BMP7 antagonizes TGF-ß signaling routes in human breast cancer cells that are metastatic to the skeleton. We hypothesize that the activation process of micrometastases in bone marrow may bear similarities to EMT that occurs at the primary site in various epithelial cancers and during ontogeny (49).
Exogenous BMP7, however, could not restore E-cadherin expression in MDA-231-B/Luc+ cells. Recent observations support the notion that hypermethylation of the E-cadherin promoter in MDA-231 cells is involved in E-cadherin expression (6). Apparently, BMP7 cannot overcome this epigenetic effect.
It is important to note that comparable data have been obtained in clinical samples of prostate cancer (50) and uveal melanoma.10 Moreover, in human prostate cancer, we observed recently that BMP7 antagonizes TGF-ß–induced EMT concomitant with an induction of E-cadherin expression (50).
Collectively, our data suggest that BMP7 regulates epithelial homeostasis in the human mammary gland by preserving the epithelial phenotype. Decreased BMP7 expression during breast cancer progression may, therefore, contribute to the acquisition of a bone metastatic phenotype. Furthermore, exogenous BMP7 can still inhibit breast cancer growth at the primary site and in bone marrow. Therefore, BMP7 may represent a novel therapeutic molecule for repression of local and bone metastatic growth of human breast cancer.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| Footnotes |
|---|
9 J.T. Buijs, unpublished observation. ![]()
10 I.C. Notting, et al. BMP7 inhibits tumor growth of uveal melanoma. Invest Ophthalmol Vis Sci 2007, in press. ![]()
Received 7/11/06. Revised 6/27/07. Accepted 7/ 9/07.
| References |
|---|
|
|
|---|

C(T)) Method. Methods 2001;25:402–8.[CrossRef][Medline]This article has been cited by other articles:
![]() |
S. M. BOKOBZA, L. YE, H. E. KYNASTON, R. E. MANSEL, and W. G. JIANG Reduced Expression of BMPR-IB Correlates with Poor Prognosis and Increased Proliferation of Breast Cancer Cells Cancer Genomics Proteomics, March 1, 2009; 6(2): 101 - 108. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cassar, H. Li, A. R. Pinto, C. Nicholls, S. Bayne, and J.-P. Liu Bone Morphogenetic Protein-7 Inhibits Telomerase Activity, Telomere Maintenance, and Cervical Tumor Growth Cancer Res., November 15, 2008; 68(22): 9157 - 9166. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Aubin, R. Bouillon, T. A. Guise, and I. R. Reid Meeting Report from the 17th Scientific Meeting of the International Bone and Mineral Society: June 24-29, 2007 in Montreal, Quebec, Canada IBMS BoneKEy, November 1, 2007; 4(11): 299 - 313. [Full Text] [PDF] |
||||
![]() |
I. Notting, J. Buijs, R. Mintardjo, G. van der Horst, S. Vukicevic, C. Lowik, N. Schalij-Delfos, J. Keunen, and G. van der Pluijm Bone Morphogenetic Protein 7 Inhibits Tumor Growth of Human Uveal Melanoma In Vivo Invest. Ophthalmol. Vis. Sci., November 1, 2007; 48(11): 4882 - 4889. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |