| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Endocrinology |
1 Cancer Research Program, Garvan Institute of Medical Research, Sydney, New South Wales, Australia and 2 Departments of Molecular and Cellular Biology and Pathology, Baylor College of Medicine, Houston, Texas
Requests for reprints: Robert L. Sutherland, Cancer Research Program, Garvan Institute of Medical Research, 384 Victoria Street, Darlinghurst, Sydney, New South Wales 2010, Australia. Phone: 61-29295-8322; Fax: 61-29295-8321; E-mail: r.sutherland{at}garvan.org.au.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
ICI 182780 is a potent inhibitor of cell proliferation in ER-positive, MCF-7 breast cancer cells, in which it induces quiescence (4). Growth arrest is preceded by a decline in c-Myc expression, a consequent decrease in cyclin D1 protein levels, and decreased cyclin-dependent kinase (Cdk4 and Cdk2) activity (4, 5). Studies investigating the role of ICI 182780 in the inhibition of breast cancer cell proliferation have focused mainly on ER
-mediated effects in breast cancer cell lines (6). However, ER has a functional relationship with PR in modulating many physiologic responses in target tissues, including the control of cell proliferation in both the breast and uterus (7), with evidence that progestins can enhance breast cancer risk (8, 9). Furthermore, high expression of ER and PR is a marker of therapeutic responsiveness and patient outcome in breast cancer (10, 11).
PR is expressed in most target tissues as two isoforms, PRA and PRB, transcribed from a single gene with distinct estrogen-inducible promoter regions (12). The first NH2-terminal 164 amino acids of PRB are absent in PRA. This unique NH2-terminal region of PRB mediates a transactivation function that contributes to the differential binding of cofactors and to the distinct properties of the two isoforms (13–16). PR is an estrogen-induced protein, and in some breast cancer cell lines, estrogen activation of ER preferentially stimulates PRB expression (17). Conversely, PRA can antagonize ER action and suppress the activity of PRB (13).
Target tissues for progesterone express both PRA and PRB (7, 18), but when expressed separately, PRA and PRB mediate both distinct and overlapping transcriptional responses (19), resulting in different physiologic effects in different target tissues (20). Selective ablation of PRA or PRB showed that PRB, but not PRA, was sufficient for normal mammary gland development in mice (21, 22). In the normal human breast, PRA and PRB have similar but low levels of expression (23), being expressed in
30% of nonproliferating breast epithelial cells (24). In the progression from normal to malignant breast cells, the expression of PRA and PRB becomes more heterogeneous, with more aggressive breast cancers being associated with a predominance of either one of the two PR isoforms (23). Differential isoform expression is associated with different phenotypes. For example, overexpression of PRA in breast cancer cells resulted in an aberrant progestin response leading to loss of cell adhesion (25), whereas increased expression in the mammary gland of transgenic mice resulted in excessive side branching and disruption of normal gland architecture (26). Alternatively, increased PRB expression has been linked to cell proliferation in patients with breast cancer (27), whereas in mice, excess PRB induced lobulo-alveolar hyperproliferation (28). Consequently, altered PRA/PRB ratios might play a role in the etiology of breast cancer, and the detection of differential expression of PRA and PRB may be an important marker in breast cancer development, progression, and therapeutic responsiveness.
In the present study, we show that progestins can reinitiate cell cycle progression in antiestrogen-arrested cells. Furthermore, this effect is mediated by PRB and not PRA, and is dependent on a functional DNA-binding domain, implying that the effect is mediated primarily via PRB-mediated gene transcription.
| Materials and Methods |
|---|
|
|
|---|
-ethoxy-21-hyhroxy-19-norpregn-4-en-3, 20-dione] (Amersham); R5020 [17
-21-dimethyl-19-norpregn-4,9-diene-3,20-dione] (Du Pont, Ltd.); RU486 [17ß-hydroxy-11ß-(4-methylaminophenyl)-17
-(1-propynyl)-etra-4,9-diene-3-one] (Dr. J-P. Raynaud of Roussel-Uclaf, France); ICI 182780 (Faslodex) [7
-[9-(4,4,5,5,5-pentafluropentyl-sulfinyl)nonyl]estra-1,3,5(10)-triene-3,17ß-diol] and 4-hydroxytamoxifen (from Dr. Alan Wakeling, Astra Zeneca Pharmaceuticals, Alderley Park, Cheshire, United Kingdom).
Construction of the retroviral PR vectors. Constructs for retroviral expression were made using the pQCXIP vector (BD Biosciences) which was first converted to the Gateway system (Invitrogen) by cloning the Gateway Cassette RfA into the blunted BamHI site of pQCXIP to generate pQCXIPgat. PRA and PRB and mutant constructs (PRB
SH3, PRA
SH3, PRBC587A, PRAC587A) were cloned into KpnI/NotI sites of entry clone2b and subsequently transferred into pQCXIPgat via the LR reaction.
To block the expression of PRA the PRA transcriptional start site atg was mutated to gcg in all PRB constructs using the Quick-Change II kit (Stratagene; ref. 29). This also introduced an NruI site at this position (PRBM165A). The primer sequences used were NruI minus (cttgcacccggcggctcgcgagcggggacaaca) and NruI plus (tgttgtccccgctcgcgagccggtccgggtgcaag). All PR sequences were verified by sequence analysis to ensure the fidelity of the constructs.
Cell culture. MCF-7-PR and MCF-7-B
SH3 cell lines have been described previously (30). Stock cultures of MCF-7 and T-47D cells were maintained in RPMI 1640 supplemented with 10% FCS and insulin (10 µg/mL). MCF-7PR cell lines were supplemented with 0.5 µg/mL of zeocin and MCF-7M13-PR supplemented with puromycin (2 µg/mL; Invitrogen). For experiments investigating the effects of ICI 182780, six-well dishes were seeded at 1.5 x 105 cells/well in RPMI plus 5% FCS and supplemented with insulin (10 µg/mL). After 24 h, ICI 182780 (10 nmol/L) was added directly to the medium. Cells were treated with hormones and harvested at the times indicated.
Cell kinetic studies. At the completion of the experiments, cells were harvested for assessment of cell cycle phase distribution using flow cytometry as described previously (31). A minimum of 20,000 cells were counted for each sample. Analysis was done with ModFit software.
Retroviral infection of MCF-7M13 cells. MCF-7M13 cells, a PR-negative clone of the MCF-7 cell line, were transfected with the murine ecotropic receptor and selected for expression using geneticin (400 µg/mL; Sigma-Aldrich). Subsequently, MCF-7M13EcoR cells were infected with PRA, PRB, and various PR mutant retroviral constructs using methods described previously (31).
Immunoblot analysis. Cells were prepared for protein extraction as previously described (31). Protein was quantitated using the Bio-Rad assay and equal amounts of total protein (20 µg) were separated by SDS-PAGE then transferred to polyvinylidene difluoride membranes. Proteins were visualized using the enhanced chemiluminescence detection system (Amersham Pharmacia Biotech) after incubation with the following primary antibodies: 1294/H9, a mouse monoclonal antibody that recognizes both human PRA and PRB isoforms (32); cyclin D1 (DCS-6; Novacastra Laboratories, Ltd.); c-Myc-C-19 (Santa Cruz Biotechnology); anti–phospho-retinoblasma protein (Rb) (phospho-Ser780; Sigma Aldrich); and Rb (G3-245; PharMingen). Protein abundance was quantified by analysis of autoradiographs using densitometry (Molecular Dynamics).
Indirect immunofluorescence. PR expressing MCF-7M13 cells were grown in RPMI 1640 supplemented with 5% FCS in four-well chamber slides and incubated for 24 h. The following day, cells were treated with ethanol or ORG2058 (10 nmol/L) for 8 h. After hormone treatment, cells were paraformaldehyde-fixed and permeabilized with 0.2% Triton X-100 in PBS. Cells were washed with PBS and blocked with 1% bovine serum albumin in PBS and incubated with a PR-specific monoclonal antibody (1294/H9) in 1% bovine serum albumin-FCS. The nucleus was defined by staining with 4'-6-diamidino-2-phenylindole, and the cytoskeleton (filamentous actin) was stained using TRITC-phalloidin (Sigma Aldrich). Slides were mounted using 80% glycerol.
Digital images were collected using a Zeiss fluorescence microscope (x40 objective). Using the "Image J" software package (33), a linear profile across the diameter of the cell measured the fluorescence intensity of PR in the cytoplasm and nucleus and the relative ratio of PR (nucleus/cytoplasm) for each cell treated with ORG2058 (10 nmol/L) or vehicle was determined. An average of 30 to 40 cells per cell line was analyzed.
| Results |
|---|
|
|
|---|
|
To test whether this phenomenon was shared by other structural classes of estrogen antagonists, we arrested T-47D cells with the SERMs, tamoxifen and clomiphene, and treated these cells with ORG2058 48 h later. As with ICI 182780–arrested cells, progestin treatment reinitiated cell cycle progression (Fig. 1D).
Analysis of MCF-7 cell lines with stable wild-type and mutant PRA or PRB expression. To investigate the potential roles of PRA and PRB in progestin release from ICI 182780–induced cell cycle arrest, we stably expressed PRA and PRB independently in MCF-7M13 cells (a subline of MCF-7 cells which express high levels of ER and no detectable PR). To inhibit transcription of the PRA isoform, the second transcription start site which gives rise to the 165 amino acid–truncated hPRA, was mutated (Fig. 2A
). Expression of PRB only from this construct (PRBM165A) was confirmed by Western blot (Fig. 2B). It was previously shown that progestins could mediate their effects via both "classical" PR-mediated transcription and rapid "non-classical" effects mediated via an interaction between a proline-rich domain in the NH2 terminus (polyproline SH3 recognition motif, amino acids 421–428), and SH3-type 1 domains of selected signaling molecules including members of the Src family of tyrosine kinases (30). To distinguish the transcriptional effects of PR from c-Src (SH3)–mediated effects, we generated both
SH3 and zinc finger mutants (C587A) of PR (Fig. 2A) which were stably expressed in MCF-7M13 cells.
|
SH3 PR variants were transcriptionally active using a PRE-luciferase reporter construct (data not shown). Immunofluorescence analysis showed that >70% of cells expressed detectable levels of PR. As shown in Fig. 2C, PRA and PRB have distinct intracellular distribution in the absence of ligand: PRBM165A and PRBM165A/
SH3 were localized to both the cytoplasmic and nuclear compartments, whereas PRA and PRA
SH3 proteins were predominantly nuclear. Interestingly, disruption of the DNA-binding domain (PRAC587A and PRBM165A/C587A) caused localization of PRB and PRA to the cytoplasm and nucleus with similar intensity (Fig. 2C). These data suggest that an intact zinc finger and the unique NH2 terminus of PRB (amino acids 1–164) are important for receptor localization in the absence of ligand. Nevertheless, we observed nuclear translocation of all PR variants upon hormone binding (Fig. 2C and D).
The role of PRA/PRB in cell cycle reinitiation by progestins. Progestin treatment reinitiated cell cycle progression in MCF-7M13 cells pretreated with ICI 182780 and constitutively expressing PRBM165A (Fig. 3A
). In marked contrast, cells expressing wild-type PRA, mutant PRA isoforms, or no PR (vector) failed to reinitiate cell cycle progression under identical experimental conditions (Fig. 3A–C). Progestins also reinitiated cell cycle progression in cells expressing PRB mutated at the SH3 domain interaction motif (PRBM165A/
SH3). In contrast, MCF-7M13 cells expressing PRB with a mutation in the first zinc finger of the DNA-binding domain (PRBM165A/C587A) were not released from cell cycle arrest following ORG2058 treatment (Fig. 3C). We confirmed these results with a previously described MCF-7 cell line constructed to stably express wild-type PRB, PRB
SH3, or empty vector (LacZ; Fig. 3D; ref. 30). In the absence of estrogen, endogenous PR is very low in these cells, as estrogen induction is required to elicit a progestin response (30). ICI 182780 inhibition was more effective in these cell lines than in MCF-7M13 cells (S phase = 5–10%) and progestin treatment again reinitiated cell cycle progression in cells expressing either wild-type PRB or PRB
SH3 but not in vector control MCF-7 cells that lack PR (Fig. 3D). Finally, to test that a similar effect was apparent when cells were arrested with tamoxifen, we conducted an experiment identical to that described in Fig. 3D following 48 h treatment with 1 µmol/L 4-hydroxytamoxifen. As described previously, tamoxifen was less potent than ICI 182780 in inhibiting S phase (36). However, the addition of ORG2058 to tamoxifen-treated MCF-7 cells expressing either PRB or PRB
SH3 reinitiated cell cycle progression but had no effect in empty vector cells (Fig. 3E). Hence, progestin reinitiation of cell cycle progression in antiestrogen-arrested cells was independent of the ability of PR to interact with and activate Src.
|
Time course of progestin reversal of ICI 182780–mediated cell cycle arrest in MCF-7 and MCF-7M13 cells stably expressing PRA or PRB. We next measured the time course of progestin effects in ICI 182780–arrested MCF-7 and MCF-7M13 cells stably expressing different forms of PR to determine whether cells expressing PRA constructs initiated a transient proliferative response not evident at 24 h post-progestin treatment.
The distribution of cells in different phases of the cell cycle was determined by flow cytometry and the S phase fraction for each of the cell lines is presented in Fig. 4
. In agreement with the data in Figs. 1 and 3, ICI 182780 treatment reduced S phase from
30% to
10% at 36 h in all cell lines and no significant changes were observed in these cells throughout the subsequent 24-h time course. Progestin did not stimulate MCF-7M13 PRA and PRA
SH3 cells, and combinations of RU486 and ORG2058 had no effect at the time points examined (Fig. 4A).
|
35%, and it remained significantly elevated at 24 h (Fig. 4B). Over this time period, cells did not show any evidence of an inhibitory response to progestin, as previously observed in T-47D cells at later time points (34, 35). In addition, the ORG2058-stimulated proliferative response was significantly enhanced in MCF-7 PRB cells compared with T-47D cells (
35–40% S phase compared with 20%, respectively; compare Fig. 1A–Fig. 4B and C). The antiprogestin RU486 abrogated this ORG2058-stimulated cell cycle progression. Progression from G0/G1 to S phase in ICI 182780–pretreated MCF-7 PRB cell lines was also observed 21 h after treatment with the synthetic progestin R5020 and this proliferative effect was repressed by RU486, as shown in Fig. 4C. MCF-7 PRB
SH3 cells yielded results essentially identical to MCF-7 cells expressing wild-type PRB (Fig. 4B and C).
Effects of ICI 182780 on estrogen-regulated genes in breast cancer cells overexpressing PRB. The mechanisms of antiestrogen arrest of MCF-7 cells are well documented (4–6), as are the responses to estradiol (E2) in antiestrogen-arrested cells (6). To elucidate the molecular mechanisms involved in progestin release from ICI 182780 inhibition, we first investigated whether the presence of unliganded PR could influence the effects of ICI 182780 on the levels of selected cell cycle regulatory proteins with a known role in estrogen/antiestrogen-regulated cell proliferation. Constitutive expression of PRB and PRB
SH3 in the absence of progestin did not affect the efficiency of ICI 182780–mediated growth arrest (Fig. 5A
). Because early events in the growth-inhibitory response to ICI 182780 include down-regulation of ER and the cell cycle targets c-Myc and cyclin D1, we determined if increased PRB or PRB
SH3 expression influenced ICI 182780 regulation of these target genes.
|
SH3 attenuated ICI 182780 down-regulation of cyclin D1 (Fig. 5B). This did not seem to compromise the decrease in phosphorylation of Rb at Ser780 in MCF-7 and T-47D cells (Fig. 5B), characteristic of ICI 182780 treatment (37), or antiestrogen-induced growth arrest as assessed by decreased S phase (Fig. 5A).
Effects of estrogen and progestin on PR and ER expression. Because modulation of ER and PR expression, phosphorylation, and degradation are documented responses of breast cancer cells to estrogen and progestin agonists and antagonists (7), we assessed changes in ER and PR levels and phosphorylation in our models (Fig. 6A and B
). Previous studies have suggested that in ER-positive cells, progestin-induced cell proliferation was mediated through an interaction between PRB and ER (38, 39). Thus, we also investigated the effects of ICI 182780, E2, and ORG2058 on ER
levels. ORG2058 treatment of T-47D cells resulted in PR phosphorylation, as assessed by decreased electrophoretic motility, and subsequent degradation, whereas in MCF-7 cells expressing PRB or PRB
SH3, the characteristic upshift associated with phosphorylation was apparent without a subsequent decline in protein levels, presumably as a consequence of continuous expression from the exogenous vector (Fig. 6A and B). In all cell lines, administration of E2 resulted in a 2- to 3-fold increase in ER
(which depleted ER
, see Fig. 5) compared with ICI 182780 alone (Fig. 6A and B). This was unexpected, as in the absence of ICI 182780, E2 down-regulated ER
(data not shown). In contrast, progestin treatment had no discernable effect on ER
levels in ICI 182780–pretreated cells. In summary, estrogen augmented ER expression in ICI 182780–pretreated MCF-7 and T-47D cells, whereas progestin had no effect in MCF-7 cell lines.
|
Cyclin D1 mRNA and protein were up-regulated by progestin treatment
2-fold by 8 h in MCF-7 cells constitutively expressing ectopic PRB or PRB
SH3 (Fig. 6A; data not shown) and this increase was maintained at 21 h (Fig. 6B) in the presence of ORG2058 and ICI 182780. A similar 2-fold increase in cyclin D1 expression was observed in E2-treated cells at 8 and 21 h in all cell lines examined (Fig. 6A and B). Cyclin D1 induction, through estrogen or progestin stimulation, was associated with increased phosphorylation of Rb at Ser780 (Fig. 6A and B). No significant increases in cyclin D1 expression or Rb phosphorylation were observed in progestin-treated MCF-7 cells that lack PR expression (LacZ control cells).
Differential regulation of c-Myc by progestin and estrogen. c-Myc is a key regulator of steroid-induced cell proliferation in both MCF-7 and T-47D cells (6, 40). In ICI 182780–arrested T-47D cells, treatment with ORG2058 increased expression of c-Myc by
2.8-fold at both 8 and 21 h, whereas a >5-fold increase was observed following E2 treatment at the same time points (Fig. 6A and B). This increase in c-Myc was maintained in ORG2058-treated T-47D cells (Fig. 6B), although the fraction of S phase cells had returned to ICI 182780–treated levels at this time (see Fig. 1A and C). In contrast, levels of c-Myc were maintained or slightly increased at 21 h in estrogen-treated cells concurrent with an increase in S phase (Fig. 6B and C).
In MCF-7 cells stably transfected to constitutively express PR, the addition of estrogen to ICI 187280–arrested cells significantly increased c-Myc levels as early as 2 h (data not shown) and these elevated levels (>10-fold) were maintained at 8 and 21 h in all MCF-7 cell lines (Fig. 6A and B). ORG2058 treatment caused only a minor increase of c-Myc expression in ICI 182780–arrested MCF-7 cells at 8- and 21-h time points (<2-fold; Fig. 6A and B). These data support a key role for cyclin D1/Rb in progestin reinitiation of cell cycle progression in ICI 182780–arrested breast cancer cells, whereas c-Myc seems to be less important. In contrast, estrogen-induced cell cycle progression of ICI 182780–arrested cells is associated with increased expression of both c-Myc and cyclin D1 (Fig. 6).
| Discussion |
|---|
|
|
|---|
Of potential clinical importance is the observation that aberrant expression of PRA and PRB is symptomatic of hormone-dependent breast cancers (23). When we examined the effects of progestin in antiestrogen (ICI 182780 or SERM)–treated breast cancer cells, we observed that PRB, but not PRA, could mediate a significant proliferative response. Interestingly, constitutive expression of PRB in MCF-7 cells not only allowed the progestin-proliferative response in the presence of ICI 182780, but also enhanced and prolonged S phase entry compared with T-47D cells. We propose that this effect is a direct consequence of high PRB expression and is consistent with the observations that PRB is essential for mammary development, proliferation, and differentiation, whereas PRA is not (20) and that carriers of the PR +331 A allele, which leads to increased expression of PRB, are at increased risk of breast cancer (27). Hence, aberrant PRB expression may have a causative role in breast cancer development and/or progression, or in the context of this study, decrease the ability of antiestrogens and other endocrine treatments to maintain growth arrest in patients with breast cancer. The latter hypothesis is not consistent with a study of PR isoform expression in tamoxifen-treated patients in whom a high PRA/PRB ratio, predominantly caused by high PRA levels, was associated with early patient relapse (42). However, expression of high levels of PRA alone confer a more invasive phenotype on breast cancer cells which may, in part, explain these findings (25). Clearly a more extensive analysis of the potential role of PR isoform expression in breast cancer prognosis and response to therapy is warranted but is currently impeded by the lack of isoform-specific antibodies suitable for assessment of expression in the context of tamoxifen response.
A PR mutant with a disabled DNA-binding domain was unable to mediate the progestin-induced reinitiation of cell cycle progression in antiestrogen-arrested cells, whereas mutations in the NH2-terminal, SH3 domain interaction motif had no effect on this response. Thus, progestin stimulation of antiestrogen-arrested cells is mediated primarily by the nuclear transcriptional activity of PR and not by its rapid activation of c-Src signaling. This result contrasts with previous studies (43, 44) showing that rapid progestin-induced activation of the Src/mitogen-activated protein kinase (MAPK) signaling pathway, mediated by PR interaction with SH3 domain of c-Src, was required for progestin induction of cyclin D1 expression and cell cycle progression. One possible explanation for this apparent discrepancy is that progestin treatment in the present context occurred in a mitogen-rich environment (i.e., in the presence of whole serum, endogenous growth factors, and insulin), whereas the previous studies (43, 44) were conducted under growth factor–depleted conditions. Thus, progestin/PR-dependent induction of cell cycle progression may be mediated through multiple pathways and mechanisms dependent on the cellular environment. An alternative mechanism by which progestins can mediate rapid activation of Src/MAPK pathways has been reported to occur through a preformed PR/ER/Src complex, in which the progestin signal is transmitted to Src through unliganded ER (38, 39). However, in previous studies, cell lines were employed that lacked ER and only expressed various PRs, suggesting that PR activation of Src/MAPK through direct coupling of PR with SH3 domains is sufficient to mediate cyclin D1 expression and cell proliferation in the absence of ER (44). Because most target tissues express both ER and PR, and estrogens and progestins can each induce rapid activation of Src/MAPK (45), an important unresolved issue is how ER and PR integrate with cytoplasmic signaling pathways. In previous studies (38, 39), antiestrogens blocked progestin-induced activation of Src/MAPK and proliferation in cells that express both ER and PR. However, in the present study, progestin reinitiated cell cycle progression in the presence of antiestrogen in cells that express both ER and PR. Thus, the mechanism(s) and role that progestin/PR–induced rapid activation Src/MAPK plays in cell proliferation remains to be more completely defined.
Previous studies have shown that the regulation of cyclin D1 and cyclin E–activated cyclin-dependent kinases plays a critical role in exit from quiescence and the deregulated cell cycles of cancer cells (46), and that cyclin D1 is a critical element of progestin regulation of breast cancer cell proliferation (31, 40, 41). The introduction of PRB into MCF-7 cells compromised ICI 182780 down-regulation of cyclin D1; however, the phosphorylation of Rb decreased and cells ceased to proliferate. In concordance with previous reports, reactivation of the cyclin D1-Rb pathway was sufficient to reinitiate cell cycle progression. Moreover, progestin treatment had little effect on c-Myc expression and no effect on ER expression. In contrast, estrogen treatment was associated with significant increases in c-Myc and cyclin D1 expression and accelerated transition of cells from G0/G1 phase to S phase. Although the mechanisms underlying the progestin-induced release from antiestrogen inhibition are not well-defined and need to be further studied, we propose, based on the present results, the existence of two independent but interconnecting pathways of hormone-mediated cell cycle progression for progestins and estrogens in breast cancer cells. Progestins and estrogens both stimulate cyclin D1 expression, and hence, activate the cyclin D1-Rb pathway, whereas estrogen also stimulates cells by reactivation and maintenance of ER and c-Myc expression, which further activates the Rb pathway via cyclin E/Cdk2 (47).
In conclusion, we propose that the potential of breast cancer cells to become desensitized to antiestrogen inhibition may be dependent in part on the total and relative abundance of PR isoforms. If the responses documented here also operate in vivo, circulating hormones present in premenopausal women or as part of hormone replacement therapy regimens have the potential to stimulate cell cycle progression in cells that express high levels of PRB. Furthermore, high PRB in the presence of progestins can attenuate growth arrest induced by antiestrogens. This could have major clinical implications in the treatment of hormone-dependent breast cancer with endocrine agents targeting ER. However, our data showing that this effect of progestin is blocked by the progestin antagonist, RU486, suggests that some progestin antagonists (48, 49) might have therapeutic utility in this context.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Alison Butt, Claire Inman, and Christine Lee for their valuable input into experimental design and critical comments on the manuscript.
Received 4/30/07. Revised 6/28/07. Accepted 7/10/07.
| References |
|---|
|
|
|---|
, epidermal growth factor receptor, c-fos, and c-myc genes. Mol Cell Biol 1991;11:5032–43.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |