Cancer Research Meeting Calendar  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 67, 9097, October 1, 2007. doi: 10.1158/0008-5472.CAN-07-2987
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ayyanathan, K.
Right arrow Articles by Rauscher, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ayyanathan, K.
Right arrow Articles by Rauscher, F. J., III

Molecular Biology, Pathobiology, and Genetics

The Ajuba LIM Domain Protein Is a Corepressor for SNAG Domain–Mediated Repression and Participates in Nucleocytoplasmic Shuttling

Kasirajan Ayyanathan1,4, Hongzhuang Peng1, Zhaoyuan Hou1, William J. Fredericks1, Rakesh K. Goyal3, Ellen M. Langer2, Gregory D. Longmore2 and Frank J. Rauscher, III1

1 The Wistar Institute, Philadelphia, Pennsylvania; 2 Department of Medicine, Washington University School of Medicine, St. Louis, Missouri; 3 Blood and Marrow Transplantation Program, Children's Hospital of Pittsburgh, Pittsburgh, Pennsylvania; 4 Center for Molecular Biology and Biotechnology, Department of Biological Sciences, Florida Atlantic University, Boca Raton, Florida

Requests for reprints: Frank J. Rauscher III, The Wistar Institute, 3601 Spruce Street, Philadelphia, PA 19104-4268. Phone: 215-898-0995; Fax: 215-898-3929; E-mail: rauscher{at}wistar.org.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The SNAG repression domain is comprised of a highly conserved 21–amino acid sequence, is named for its presence in the Snail/growth factor independence-1 class of zinc finger transcription factors, and is present in a variety of proto-oncogenic transcription factors and developmental regulators. The prototype SNAG domain containing oncogene, growth factor independence-1, is responsible for the development of T cell thymomas. The SNAIL proteins also encode the SNAG domain and play key roles in epithelial mesenchymal differentiation events during development and metastasis. Significantly, these oncogenic functions require a functional SNAG domain. The molecular mechanisms of SNAG domain–mediated transcriptional repression are largely unknown. Using a yeast two-hybrid strategy, we identified Ajuba, a multiple LIM domain protein that can function as a corepressor for the SNAG domain. Ajuba interacts with the SNAG domain in vitro and in vivo, colocalizes with it, and enhances SNAG-mediated transcriptional repression. Ajuba shuttles between the cytoplasm and the nucleus and may form a novel intracellular signaling system. Using an integrated reporter gene combined with chromatin immunoprecipitation, we observed rapid, SNAG-dependent assembly of a multiprotein complex that included Ajuba, SNAG, and histone modifications consistent with the repressed state. Thus, SNAG domain proteins may bind Ajuba, trapping it in the nucleus where it functions as an adapter or molecular scaffold for the assembly of macromolecular repression complexes at target promoters. [Cancer Res 2007;67(19):9097–106]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Transcription factors are modular in architecture, often encoding sequence-specific DNA binding and functionally separable effector domains. The Cys2-His2 (C2H2) type zinc finger proteins (ZFP) constitute the largest family of transcription factors in the human proteome (1). The ZFPs can be classified into distinct subfamilies such as SNAG-, KRAB-, BTB/POZ-, and SCAN-ZFPs based on these highly conserved functional domains often encoded in their NH2 termini. The mechanisms used by these domains during transcriptional regulation include: (a) direct interaction with the components of the basal transcription machinery, (b) ATP-dependent remodeling of chromatin, and (c) site-specific modifications such as acetylation, phosphorylation, methylation, and ubiquitination of the nucleosomal histones, which serve as biochemical codes in the context of complex chromatin structure (2). A widely accepted paradigm is that histone acetylation leads to gene activation, whereas histone deacetylation results in repression. Importantly, many repressors function through corepressor molecules as exemplified by DR-DRAP-1 (3), WRPW-Groucho (4), REST-Co-REST (5), and KRAB–KRAB-associated protein-1 (KAP-1; ref. 6).

The SNAG repression domain (Snail/GFI-1) is present in the vertebrate homologues of the Snail/Slug and in the growth factor independence-1 (GFI-1) ZFPs (710). The GFI-1 proto-oncogene was cloned by using an insertional mutagenesis strategy wherein Moloney murine leukemia virus–infected T cells selected for interleukin 2 independence showed non–random integration of the provirus at the GFI-1 locus (11). Remarkably, GFI-1 was independently cloned as a gene, which could cooperate with myc and pim1 in transgenic models of B- and T-cell lymphoma (12). GFI-1 is a nuclear localized ZFP which recognizes a 12 bp DNA consensus sequence (13, 14). The GFI-1 ZFP encodes the 20–amino acid SNAG domain in its NH2 terminus. This segment is sufficient for repression, and single amino acid substitutions in the SNAG domain abolish repression (10). Consistent with its role as a T cell–tropic oncogene, overexpression of GFI-1 in immortalized T cells allowed them to escape the G1 arrest induced by interleukin 2 withdrawal and, interestingly, a SNAG domain mutant of GFI-1 was inactive in this capacity (10). Gene knockout studies have shown that mammalian GFI-1 genes are essential for the development of erythroid and megakaryocytic lineages as well as neutrophil differentiation (1517).

The vertebrate homologues of the fly Snail and Slug genes encode SNAG domains and their roles in development and disease have been extensively studied (18). In Xenopus, the Snail/Slug family has been shown to play essential roles in both mesoderm differentiation and in neural crest induction/migration, and these functions require a competent SNAG domain. Both fibroblast growth factor and hepatocyte growth factor induce expression of Slug, which in turn, induces epithelial-mesenchymal transitions (19). The E2A-HLF fusion protein has been shown to activate the human Slug gene with resultant interleukin-3–independent survival and transformation of pro–B cells (20). Snail family members also play crucial roles in the development of mesoderm and nervous system by triggering epithelial-mesenchymal transition. Recent studies have shown that the human and mouse E-cadherin promoters are direct targets for Snail ZFPs and the loss of E-cadherin expression is a major contributor to the acquisition of an invasive, highly malignant phenotype during human tumor progression (21, 22). Thus, it is clear that the SNAG-ZFPs play important and diverse roles in embryonic development and in human disease. Despite these advances in defining the roles of SNAG domain proteins in biological processes, the molecular mechanisms of SNAG-mediated transcriptional repression are still largely undefined.

In this article, we identify Ajuba (23, 24) and LIMD1 (25) proteins as SNAG domain–interacting proteins and provide strong evidence that they function as corepressors for the SNAG domain.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines and antibodies. COS-1, NIH3T3, and its stable cell line derivatives (SPHL11 and SPHL20) were grown as described (26). The {alpha}-PAX3 (27) and {alpha}-LEXA IgGs (Santa Cruz Biotechnology) are rabbit and goat polyclonal antibodies which recognize the PAX3 and LEXA DNA-binding domains, respectively. The {alpha}-Ajuba and {alpha}-LIMD1 are polyclonal antibodies raised by immunizing rabbits with 6-His fusion proteins of mouse Ajuba (amino acids 1–216) and mouse LIMD1 (amino acids 1–158) as antigens. These antibodies only recognize their cognate antigens and do not cross-react in the assays tested. The {alpha}-MYC tag monoclonal antibody (clone 9E10), {alpha}-AcH3, {alpha}-AcH4 (raised against acetylated histone H3 and H4), and {alpha}-H3-MeK9 (raised against trimethylated lysine 9, histone H3) antibodies were purchased from Upstate.

Construction of a SNAG domain minigene and its derivatives. A synthetic SNAG domain coding sequence derived from GFI-1 was constructed by standard overlap-extension PCR. A Kozak consensus was added prior to the initiator methionine of the 20–amino acid SNAG domain (MPRSFLVKSKKAHSYHQPRS) followed by a 6–amino acid spacer (PGPDYS). In-frame EcoRI (5') and SalI (3') sites were included for cloning into the pSP73 vector. Alanine substitution mutagenesis was done via PCR using appropriate mutant oligonucleotides. The wild-type and mutant SNAG minigenes were subcloned into PAX3-, LEXA-, and pBTM116-LEXA containing plasmids to create NH2 terminal fusions.

Immunoprecipitation and electrophoretic mobility shift assays. Each expression plasmid was verified for stable protein expression in vivo as previously described (26). The myc-AJUBA and LIMD1 plasmids have also been described (23). Briefly, [35S]-L-methionine–labeled whole cell extracts prepared from transiently transfected COS-1 cells were immunoprecipitated with {alpha}-PAX3 IgG or {alpha}-LEXA IgG, and proteins analyzed by SDS-PAGE and fluorography. In coimmunoprecipitation experiments, subsequent to cotransfection of either SNAG-PAX3 or SNAG-LEXA with the MYC-Ajuba plasmid (1:1 ratio), immunoprecipitation was carried out using ELB buffer (28). Nuclear extracts were prepared using a rapid protocol (27) and used in electrophoretic mobility shift assays with a 32P-labeled e5 site (a PAX3-binding site derived from the engrailed gene) probe.

Transcriptional repression assays. To monitor the repression potentials of the chimeric SNAG repressor proteins, 2 x 105 NIH3T3 cells were transfected with 1 µg of the expression plasmid along with 0.5 µg of PAX3- or LEXA-luciferase reporter plasmids, and 0.25 µg of pCMV-LacZ plasmids, using LipofectAMINE (Life Technologies). Whole cell extracts were assayed for luciferase activities and then normalized to ß-galactosidase values for transfection efficiency (26, 27). Fold repression was determined as the ratio of normalized light units in vector versus SNAG-expression plasmid–transfected cells. To examine the effect of Ajuba on SNAG-PAX3 or SNAG-LEXA–mediated repression, cotransfection was done as described above.

Immunofluorescence and colocalization. Immunocytochemistry was done essentially as previously described (28). NIH3T3 cells were transfected with the indicated expression plasmids. The cells were fixed, permeabilized, and then incubated with {alpha}-LEXA (1:100 dilution) or {alpha}-MYC (1:1,000 dilution) antibodies. The proteins were detected with FITC-conjugated {alpha}-rabbit IgG (1:500 dilution) or Texas red–conjugated {alpha}-mouse IgG (1:1,000 dilution), respectively. Finally, the cells were stained for DNA with Hoechst (2 ng/mL) and mounted on glass slides using Fluoromount G (Southern Biotechnology Associates, Inc.). Cells were visualized using a Leica confocal laser-scanning microscope with the help of the Wistar Institute Cancer Center Microscopy Core Facility. Images were captured using QED Imaging software.

Chromatin immunoprecipitation. SPHL11 or SPHL20 cells were plated at 5 x 106 cells/150 mm dish, treated continuously with either 500 nmol/L of 4-hydroxytamoxifen (4-OHT; +OHT dishes) or 0.1% ethanol (–OHT dishes) for 2 days, and then fixed in 1% formaldehyde (EM Biosciences) for 20 min at 37°C. Solubilized and sonicated chromatin was prepared as previously described (29), and immunoprecipitated with {alpha}-PAX3, {alpha}-Ajuba, {alpha}-LIMD1, {alpha}-AcH3, {alpha}-AcH4, or {alpha}-H3-MeK9 antibodies. Usually, 10% of the clarified chromatin was saved as input. The immunocomplexes were processed as previously described (29). Both the input and the immunoprecipitated DNAs were used in quantitative PCR reactions with the primer pairs illustrated in Fig. 5A. The PBS1 (5' GATCGATAATTCGAGCTACTG 3') and PBS2 (5' GAGCTCGGTACCCGGGTCG 3') primer pair amplify the PAX3 binding sites; the primer pair TKP1 (5' GCGCGGTCCCAGGTCCACTT 3') and LUC1 (5' TCCAGGAACCAGGGCGTATCTCT 3') amplify the HSV-TK promoter region (26). The DNA fragments were electrophoresed on 1.5% agarose gels and either photographed or subjected to Southern blotting and autoradiography.


Figure 5
View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. SNAG-mediated transcriptional repression mechanisms on a chromatinized locus. A, development of a dual plasmid system. The SNAG-PAX3-HBD chimeric repressor protein is constitutively expressed from the CMV promoter. The reporter plasmid contains six repeats of PAX3 DNA-binding motifs and a HSV thymidine kinase (HSV TK) promoter that controls the basal expression of the luciferase gene. This plasmid also contains a zeocinR cassette for drug selection. The primer-pair PBS1 and PBS2 amplify the PAX3-binding sites (344 bp), whereas the TKP1 and LUC1 primer-pair amplify the TK promoter region (257 bp). B, C, and D, ChIP assays identified putative components of the SNAG repression pathway. B, 4-OHT–dependent enrichment of the SPHBD at the PAX3 sites. Chromatin prepared from (–) or (+) 4-OHT–treated SPHL11 and SPHL20 cells were immunoprecipitated with {alpha}-PAX3 (10 µg) and analyzed by quantitative PCR using PBS1 and PBS2 primer-pairs. Arrow, the PAX3 site fragment (344 bp) amplified. C, Ajuba and LIMD1 proteins were inducibly recruited to the TK promoter. ChIP experiments were done with (–) or (+) 4-OHT–treated SPHL11 cells using {alpha}-Ajuba (20 µL) and {alpha}-LIMD1 (20 µL), {alpha}-MeK9 (5 µL) antisera. The immunoprecipitated DNA was amplified using TKP1 and LUC1 primer-pair. Arrow, the amplified TK promoter fragment (257 bp). D, 4-OHT–dependent promoter hypoacetylation. ChIP experiments were done with (–) or (+) 4-OHT–treated SPHL11 and SPHL 20 cell lines using {alpha}-AcH3 IgG (5 µL) or {alpha}-AcH4 (5 µL) IgG and the retained DNA was tested by quantitative PCR using TKP1 and LUC1 primer-pair. Arrow, the amplified TK promoter fragment (257 bp).

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Characterization of engineered SNAG repressors. The SNAG transcription factor superfamily includes Snail, Slug, GFI-1, Scratch, and IA-1 ZFPs. In spite of possessing a varied number of C2H2-type zinc fingers at their COOH-termini, they all contain the highly conserved NH2-terminal SNAG repression domain (Fig. 1A ). Multiple sequence alignment using Clustal W indicates that the SNAG domain homology extends to ~20 amino acids with the NH2-terminal first seven amino acids being strictly conserved between the different members (Fig. 1B). Furthermore, the SNAG domains of GFI-1 and GFI-1B genes also possess a well-conserved nuclear localization signal (KSKK). To determine if the synthetic SNAG domain would function as a transferable, modular repression domain, we fused it to the NH2 terminus of the minimal PAX3 DNA-binding domain (PAX3; Fig. 1C). We have used PAX3 as a recipient (26, 27, 30) for the following reasons: PAX3 (a) binds DNA as a monomer and recognizes an extended nondegenerate DNA binding site due to paired and homeodomain-DNA binding motifs, (b) is easily detectable using PAX3 antibodies, and (c) is transcriptionally neutral when bound to DNA in the absence of an effector domain. We used alanine scanning mutagenesis to map the amino acid sequence requirements for SNAG repression. We targeted both the NH2 terminal block of seven amino acids, which is identical among all SNAG domains and the more COOH-terminal region, which is not as highly conserved (Fig. 1C). Each protein was comparably expressed (Fig. 1D) and showed comparable DNA binding activity to the e5 site (Fig. 1E). Expression plasmids encoding SNAG-PAX3 fusions were cotransfected with the PAX3-luciferase reporter plasmid and cell extracts assayed for activity. Fusion of the SNAG domain to the NH2-terminus of PAX3 created a potent repressor (Fig. 1F). Repression was dose-dependent and was strictly contingent on PAX3-binding sites in the reporter plasmid (data not shown). The mutants varied in their abilities to repress the PAX3-luciferase in reporter assays (Fig. 1F). The FLV-AAA substitution severely reduced repression. However, the S-A and KK-AA mutants retained significant repression activity, whereas the single substitution F-A severely reduced repression. Thus, a phenylalanine to alanine substitution in the highly conserved SNAG domain converts a normally powerful repressor of transcription into a neutral DNA binding protein. Whether the seven–amino acid NH2 terminal segment is sufficient for repression remains to be tested. Interestingly, a modular repression domain as small as four amino acids (WRPW) present in the hairy and achaete-scute bHLH transcription factors is sufficient to confer repression by recruiting the Groucho corepressor (4). We suggest that the SNAG domain may function in a similar manner.


Figure 1
View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Characteristics of SNAG-zinc finger transcription factors. A, alignment of human SNAG-ZFPs. Presence of a highly conserved NH2-terminal SNAG repression module and a variable COOH-terminal zinc finger arrays are highlighted. The Slug and Scratch ZFPs also contain conserved slug and scratch domains, respectively. B, SNAG domain homology. The SNAG repression domain extends to ~20 amino acids, of which the NH2-terminal first seven amino acids are strictly conserved. C, diagrammatic representation of the wild-type and mutant SNAG-PAX3 repressors. D, protein expression. The expression plasmids mentioned in (C) were transfected into COS-1 cells, 35S-labeled cell extracts were immunoprecipitated with {alpha}-PAX3 IgG, and analyzed by SDS-PAGE and fluorography. E, gel shift. Nuclear extracts made from transfected COS-1 cells were incubated with 32P-labeled e5 probe and electrophoresed on a nondenaturing PAGE. Arrows, shifted bands. F, transcriptional repression competence of SNAG-PAX3 repressors. The wild-type and mutant SNAG-PAX3 expression plasmids were transfected into NIH3T3 cells along with PAX3-luciferase reporter and CMV-lacZ plasmids. Values for normalized luciferase activity obtained for each construct (bottom).

 
A yeast two-hybrid strategy to identify SNAG domain–associated proteins. Because direct protein-protein interactions might be required for SNAG-mediated repression, we screened for such proteins using yeast two-hybrid methods. The 20–amino acid SNAG domain was used as bait by fusing the SNAG domain (wild-type and mutants) to the NH2-terminus of LEXA (Fig. 2A ). To guard against spatial constraints to protein binding, we included a 17–amino acid, inert spacer between the SNAG domain and the NH2 terminus of LEXA. The SNAG-LEXA fusions were properly expressed in mammalian cells (Fig. 2A), exhibited proper binding to a LEXA DNA-binding site in gel shift assays (data not shown), and repressed the LEXA-luciferase reporter plasmid (Fig. 2A). Thus, this spectrum of "baits" formed the important set of reagents with which to identify and distinguish true mediators of SNAG repression.


Figure 2
View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Identification and characterization of SNAPs. A, characteristics of SNAG-LEXA repressors. The wild-type and mutant SNAG-LEXA repressors were tested for stable protein expression, and also monitored for repression of a LEXA-luciferase reporter. B and C, specificity of SNAPs. B, the SNAP13 and SNAP20 clones bind to wild-type SNAG, but not to SNAG (FLV-AAA), or unrelated baits in the mating assay. C, these SNAPs bind to SNAG domains that retain repression activity, but not to either LEXA DNA-binding domain or to mutants that abolish repression. Note that the KK-AA mutant is not stably expressed either in COS-1 (A) or in yeast (data not shown), which accounts for its poor association. D, group 3 LIM domain proteins. The SNAG-interacting regions of SNAP13 and SNAP20 contain two NH2-terminal LIM domains of LIMD1 and Ajuba, respectively. The characteristic Gly-, Pro-rich regions and nuclear export signals (NES) present in these family members are highlighted. E, the signature Cys-His spacing (CX2CX16–23HX2CX2CX2CX16–21CX2–3C/H/D; C, cysteine; H, histidine; D, aspartic acid; and X, any amino acid), and conserved residues (black bars) characteristic to LIM domains are shown as exemplified for by Ajuba LIM domains. F, phylogenetic tree analysis. Sequence conservation between the LIM domains of the indicated three LIM domain proteins was determined using DNASTAR software.

 
First, we showed that the pBTM116-SNAG-LEXA constructs neither activated nor repressed transcription in yeast (data not shown). The wild-type SNAG-LEXA fusion was then cotransformed with a murine embryonic (E9-E11) library constructed in pVP16 and scored for histidine prototrophy and LacZ activity in a standard two-hybrid screen (31). From ~200 primary hits that were obtained upon screening, ~40 million library clones, we isolated ~20 that interacted strongly with the wild-type SNAG domain. Several of these were re-screened by reintroduction into naïve yeast with a variety of other baits. SNAG domain–associated proteins, SNAP13 and SNAP20, interacted very strongly with wild-type SNAG but failed to interact with the SNAG (FLV-AAA) mutant, LEXA, or any of the other negative control baits including KAP-1, Lamin, Rho, and protein kinase C (Fig. 2B). We further characterized SNAP13 and SNAP20 by introducing them into naïve yeast along with each of the pBTM116-SNAG-LEXA baits (Fig. 2C). The interactions were almost completely concordant with repression activity; each SNAP interacted with active SNAG repressors (wild-type and S-A mutants) but did not interact with the mutants (FLV-AAA and F-A), which abolish repression. The exception to this concordance is KK-AA, which is expressed at a much-reduced level in yeast (data not shown). Thus, by these criteria, these SNAPS are strong candidates for mediators of SNAG function.

The DNA sequence of the SNAPs showed that the proteins were in-frame with the VP16 activation domain encoded by the vector. In the primary screen, we obtained two independent isolates of SNAP13 and multiple, identical isolates of SNAP20. BLAST searches revealed that SNAP13 and SNAP20 were identical to the two NH2-terminal LIM domains of Ajuba and LIMD1, respectively. LIM is an acronym of three transcription factors, Lin11, Isl-1, and Mec-3, in which the motif was first identified (32). The LIM domain protein subfamily, which includes Ajuba and LIMD1, is illustrated in Fig. 2D. The Ajuba, LIMD1, and three other LIM domain proteins such as Zyxin, TRIP6, and lipoma-preferred partner proteins contain characteristic glycine/proline-rich regions and nuclear export signals. They belong to the group 3 LIM domain family, the members of which exhibit nucleocytoplasmic distribution and mediate both cellular and nuclear signaling events (33). LIM domains are bona fide protein-protein interaction motifs, which encode a signature Cys2-His1-Cys3-Cys Zn2+ binding domain as shown for the three individual LIM domains of Ajuba (Fig. 2E). A dendrogram analysis constructed from the LIM domains of the three LIM domain proteins revealed that a distinct phylogenetic relationship exists only between the LIM domains of Ajuba and LIMD1 (Fig. 2F). The SNAG-interacting LIM domains of Ajuba and LIMD1 (~134 amino acids) fell into a single group with a similarity index of 62.7, implying that they evolved from a common ancestral gene.

Ajuba interacts with SNAG in vivo and functions as a corepressor. To verify that SNAG-LIM domain interactions occur in vivo in mammalian cells, we used expression vectors for SNAG-PAX3, SNAG-LEXA, and MYC epitope–tagged, full-length Ajuba (MYC-Ajuba). Proper expression of the MYC-Ajuba protein was confirmed by immunoprecipitation with {alpha}-MYC monoclonal antibody (data not shown). Next, we cotransfected the MYC-Ajuba and wild-type or mutant SNAG-LEXA plasmids into COS-1 cells. The 35S-methionine-labeled cell lysates were immunoprecipitated with either {alpha}-MYC or {alpha}-LEXA IgG. Figure 3A shows that the {alpha}-MYC detects a 66 kDa MYC-Ajuba protein whereas the {alpha}-LEXA detects a 25 kDa LEXA protein in the MYC-Ajuba + LEXA vector cotransfected cells. However, in the wild-type SNAG-LEXA + MYC-Ajuba cotransfected cells, the {alpha}-LEXA also detects the MYC-Ajuba protein. As expected, the {alpha}-MYC also detects the wild-type SNAG-LEXA protein. Coimmunoprecipitation experiments with mutant SNAG-LEXA plasmids indicated that the repression-incompetent mutants of the SNAG domain fail to bind the Ajuba, strongly suggesting that this interaction is functionally relevant (Fig. 3A).


Figure 3
View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Ajuba functions as a SNAG corepressor. A, Ajuba interacts with repression-competent SNAG domains in vivo. The wild-type and mutant SNAG-LEXA plasmids were either transfected alone or cotransfected along with Ajuba into COS-1 cells. The 35S-labeled cell extracts were immunoprecipitated with {alpha}-LEXA or {alpha}-MYC antibodies and analyzed. Arrow, presence of coprecipitated Ajuba protein. B, enhancement of SNAG-mediated transcriptional repression by Ajuba. The wild-type and mutant SNAG-PAX3 or SNAG-LEXA plasmids were either transfected alone or cotransfected with MYC-Ajuba. Values for relative luciferase activities obtained after normalization (bottom).

 
To confirm that the region of Ajuba required for SNAG interaction contained the LIM domain, we used the expression plasmids coding for the NH2- or COOH-terminal segments of Ajuba (defined as "Ajuba-preLIM" or "Ajuba-LIM"; ref. 23) in cotransfection experiments along with the SNAG-PAX3 plasmid. The SNAG-PAX3 protein coprecipitated with the Ajuba protein or the Ajuba-LIM domain but not the Ajuba-preLIM domain, suggesting that the LIM region of Ajuba is the site of SNAG domain interaction (data not shown). Thus, Ajuba-SNAG-PAX3 complexes are very efficiently formed in vivo following cotransfection and are stable to moderate salt, detergent extraction procedures. Importantly, this coprecipitation was not detected when a PAX3 protein that lacks a SNAG domain was used, confirming that a SNAG-Ajuba interaction is occurring (data not shown).

We did cotransfection experiments to determine if Ajuba could modify the transcriptional repression function of the SNAG domain. We transfected CMV vectors for SNAG-PAX3 or SNAG-LEXA constructs into NIH3T3 cells, with or without CMV-Ajuba. SNAG-LEXA repressed the LEXA-luciferase reporter, and this repression was enhanced by CMV-Ajuba. As expected, Ajuba also enhanced SNAG-PAX3–mediated repression of the PAX3 luciferase reporter (Fig. 3B). These results suggest that Ajuba mediates SNAG repression and functions as a SNAG corepressor.

Recruitment and nuclear colocalization of Ajuba and SNAG in NIH3T3 cells. The functional studies prompted us to investigate the subcellular localization patterns of the MYC-Ajuba, the wild-type and mutant SNAG-LEXA proteins. Immunofluorescence analysis revealed that cells transfected with MYC-Ajuba showed predominant cytoplasmic staining and those that were transfected with SNAG-LEXA (wild-type and mutants) showed intense nuclear staining (Fig. 4A ). However, cells that received both Ajuba and SNAG-LEXA plasmids showed abundant nuclear staining of Ajuba that was solely dependent on the repression competency of the SNAG domain (Fig. 4B). A majority of cells in this doubly transfected population showed the pattern observed in Fig. 4B. These remarkable images strongly corroborate our functional studies described earlier. These results also suggest that the SNAG domain can recruit and/or retain Ajuba in the nucleus, and are consistent with our earlier observations that Ajuba is both cytoplasmic and nuclear. Recent reports suggest that group 3 LIM proteins like Zyxin and Ajuba can shuttle between the cytoplasm and the nucleus, and thus, may form a novel intracellular signaling system. It has been hypothesized that there are nuclear "anchors" for this class of shuttling LIM proteins (34). We hypothesize and present evidence that the SNAG domain may be such an anchor for the Ajuba protein.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. SNAG domain colocalizes with Ajuba in a repression competence–dependent manner. A, localization patterns of Ajuba and SNAG-LEXA proteins. The MYC-Ajuba, wild-type, and mutant SNAG-LEXA plasmids were transfected individually into NIH3T3 cells and immunostaining was carried out with {alpha}-LEXA or {alpha}-MYC antibodies. Note that Ajuba remains mainly cytoplasmic whereas the wild-type and mutant SNAG-LEXA proteins are predominantly nuclear. B, colocalization of repression competent SNAG-LEXA proteins with MYC-Ajuba protein. The wild-type and mutant SNAG-LEXA plasmids were cotransfected along with the MYC-Ajuba plasmid into NIH3T3 cells. Binding, interaction in yeast two-hybrid analysis. Repression, transcriptional competence in reporter assays. A representative cell is shown for each transfected population.

 
Molecular components of SNAG repression are recruited to the target promoter. We investigated whether the SNAG domain–mediated transcriptional repression involves chromatin modification by using trichostatin A (TSA) and by performing chromatin immunoprecipitation (ChIP) assays. We generated stable cell lines, which contained a chromatin-integrated PAX3-luciferase reporter transgenes and a conditional SNAG repressor SNAG-PAX3-HBD wherein the SNAG-PAX3 is fused to the estrogen receptor hormone-binding domain (SPHBD; Fig. 5A ). This system has been extensively used by this laboratory (26, 27). We tested multiple cell lines for protein expression and hormone-dependent (4-OHT) repression of the PAX3-luciferase reporter (26). We chose the SPHL11 and SPHL20 cell clones to study due to their repression potentials. In the presence of 4-OHT, ~6-fold repression was observed (26); however, in the presence of both 4-OHT and TSA, this repression was totally relieved in both clones (26). This experiment suggests that one of the mechanisms of SNAG domain repression may involve histone deacetylation. To confirm that the SNAG-Ajuba machinery was recruited to the target gene, we did comprehensive ChIP experiments using a battery of antibodies: chromatin-associated proteins were cross-linked to DNA in vivo with formaldehyde in mock or 4-OHT–treated SPHL11 and SPHL20 cells and immunoprecipitated with {alpha}-PAX3, {alpha}-Ajuba, {alpha}-LIMD1, {alpha}-AcH3, {alpha}-AcH4, and {alpha}-H3-MeK9 antibodies. The immunoprecipitated DNA was analyzed by quantitative PCR, using primer pair targeting the 6xPAX3 binding sites (PBS1 and PBS2), the TK promoter regions (TKP1 and LUC1) or the CD19-TK-LUC zeocinR locus (26). Fragments, which bracket the PAX3-binding sites, were considerably enriched in the PAX3 immunoprecipitates after 4-OHT treatment, indicating that there was a strong enrichment of the SPHBD protein at the PAX3 sites. This experiment was controlled by the presence of similar levels of the PAX3 binding site fragment in the input chromatin (Fig. 5B). Likewise, we observed a strong 4-OHT–dependent enrichment of the 257 bp TK promoter fragment in {alpha}-Ajuba, {alpha}-LIMD1, and {alpha}-H3-MeK9 chromatin immunoprecipitates (Fig. 5C). Thus, in addition to the DNA-binding component, other components of the SNAG repression complex (i.e., Ajuba, LIMD1, and H3-MeK9) were inducibly recruited to the target gene. Based on these results, we conclude that the SPHBD fusion protein, Ajuba, LIMD1, and H3-MeK9 are strongly recruited to the chromatin regions comprising the PAX3 binding site, and the TK promoter region, respectively.

In parallel ChIP experiments, we observed a significant reduction in the levels of acetylated histones H3 and H4 at the TK promoter region following 4-OHT-treatment, indicating that histone hypoacetylation occurs upon recruitment of SPHBD protein to the upstream PAX3 sites (Fig. 5D). These results are in agreement with the repression of this locus by SPHBD following hormone treatment. Future ChIP experiments will unravel the identity of the enzymes involved in SNAG repression. We expect these experiments to yield clues about the nature of the unique nucleocytoplasmic signaling mechanism used by Ajuba and LIMD1 proteins.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mammalian zinc finger transcription factors play vital roles during organism development and subsequent homeostasis. In order to gain insights into the molecular mechanisms of SNAG-mediated repression that are responsible for the biological functions of SNAG-ZFPs, we isolated and characterized SNAG-specific corepressors. The highly modular nature of SNAG and other repression domains such as KRAB and BTB/POZ has greatly aided the discovery of their mechanisms of action (6, 3538). We followed this approach in our earlier studies to understand the mechanistic details of the KRAB-mediated repression by isolating and characterizing the KAP-1 corepressor (6, 28). In this study, we have identified Ajuba and LIMD1 proteins as downstream players in the SNAG repression pathway.

After the initial identification of LIM domain proteins, Ajuba and LIMD1, as SNAG-domain interactors in the yeast two-hybrid assay, we did extensive biochemical analyses to confirm this interaction. Our striking results from coimmunoprecipitation experiments indicate that the SNAG domain interacts avidly with Ajuba in vivo and also that Ajuba can enhance SNAG-mediated repression. As expected, we observed these results only with repression-competent SNAG domains. The KAP-1 corepressor, which interacts only with repression-competent KRAB domains, also enhance KRAB-mediated repression. Because Ajuba possesses these important characteristics of corepressor proteins similar to KAP-1, we designate Ajuba as a SNAG corepressor.

LIM domain interactions have been observed in several classes of transcription factors and cofactors. Specific examples include: (a) the nuclear LIM-only (LMO) protein interact with GATA-1, GATA-2, and Tal1/Scl transcription factors (39); (b) the LIM domain–binding protein Ldb1, its LIM-only protein partner LMO2, and the DNA-binding SCL/E12, exist in a multiprotein complex that negatively regulates erythroid function (40); (c) FHL2/DRAL interacts with the promyelocytic leukemia zinc finger protein (a sequence-specific transcriptional repressor) and functions as a corepressor by augmenting promyelocytic leukemia zinc finger–mediated transcriptional repression (41); (d) FHL2 associates with Jun and Fos and serves as a coactivator of activator protein by stimulating Fos- and Jun-dependent transcription (42); (e) the CLIM forms a protein complex consisting of LIM-HD, LMO, bHLH, and GATA at the target promoters (43); (f) the LIM-homeodomain transcription factor Lhx3 binds to the pituitary-specific transcription factor Pitx-1 and also interacts with several coactivator/adapter proteins including the selective LIM-binding protein (44); and (g) cysteine-rich LIM-only proteins (CRP1 and CRP2) play important roles in organizing multiprotein complexes, both in the cytoplasm, where they participate in cytoskeletal remodeling, and in the nucleus, where they strongly facilitate smooth muscle differentiation (45). These studies clearly show that nuclear LIM proteins can function as adapter molecules in the formation of large multiprotein complexes that form on DNA and that influence transcription.

Our colocalization studies show that Ajuba by itself remains totally cytoplasmic, however, in the presence of a repression-competent SNAG domain, its localization completely shifted to the nucleus. The SNAG domain may facilitate both the import of Ajuba into the nucleus and its subsequent retention by serving as a nuclear anchor in chromatin. Similar nuclear targeting functions have been observed for other LIM proteins. For example, (a) stimulation of the Rho signaling pathway induces translocation of the transcriptional LIM-only coactivator FHL2 to the nucleus (46); (b) in heart, FHL2 interacts with hNP220, a DNA-binding nuclear protein to serve as a molecular adapter in the formation of a multiprotein complex (47); (c) the LIM protein KyoT2, an alternatively spliced murine isoform of SLIM1 has been shown to negatively regulate transcription by interacting with RBP-J DNA-binding protein and displacing it from the DNA (48, 49); (d) interaction of Zyxin (usually found in focal adhesions) with the human papillomavirus–derived E6 protein leads to its accumulation in the nucleus where it functions as a transcriptional activator. Significantly, this interaction requires the three LIM domains present at the COOH terminus of Zyxin (50); and (e) the lipoma-preferred partner protein exhibits nucleocytoplasmic distribution and possesses focal adhesion and nuclear targeting capabilities. It does not contain any consensus nuclear localization signals suggesting that it may be imported into the nucleus via a nuclear localization signal containing transport protein (51).

The colocalization studies also suggested that upon SNAG-mediated translocation, Ajuba along with its (unidentified) associated proteins could constitute a macromolecular repression complex at the target promoter. Based on our findings from the ChIP experiments, we favor the notion that the initial DNA-binding by the SNAG-PAX3 repressor at the PAX3 binding sites leads to the subsequent recruitment of Ajuba, and associated proteins to the promoter region. Because we also observed significant hypoacetylation of histone tails at the promoter region and reversal of SNAG-mediated repression in the presence of TSA, we believe that SNAG repression involves histone deacetylases (HDAC) and that HDAC may be constituents in the SNAG-holo repression complex. HDAC and Sin3A have been found in SNAIL complexes, which repress E-cadherin (52). However, our preliminary data suggests that arginine methyltransferases also play an important role.5

It is well established that HDACs can be found in both the cytoplasm and the nucleus. Ajuba may interact with a cytosolic HDAC and recruit it to the nucleus, or it may interact with an HDAC1 existing in the nucleus and recruit it to the repression complex. The RLIM has been shown to interact with members of the HDAC corepressor complex (53). It would be interesting to identify the nature of the HDAC involved, and to decipher the hitherto unidentified associated proteins that constitute the macromolecular repressor complex. This necessitates the isolation and characterization of interacting proteins that are present in both cytoplasmic and nuclear compartments, experiments which are ongoing. These findings provide another example whereby a small conserved repression domain, the 21–amino acid (SNAG) functions by recruiting a large macromolecular complex. These results are particularly relevant to the SNAIL-SNAG proteins which are up-regulated during the processes of epithelial-mesenchymal transition and metastases in many epithelial cancers. A small molecule strategy to block the SNAIL-SNAG-Ajuba interaction may be a feasible and attractive target to provide either preventive or therapeutic efficacy during tumor progression.


    Acknowledgments
 
Grant support: K. Ayyanathan is supported by the NIH (KO1-CA095620). G.D. Longmore is supported by the American Heart Association (9940116N), the Edward Mallinckrodt, Jr., Foundation, and the NIH (RO1-CA75315). G.D. Longmore is an Established Investigator of the American Heart Association. F.J. Rauscher is supported in part by NIH grants, Core grant CA10815, CA92088, CA095561, DAMD17-96-1-6141, 17-02-1-0631, the Irving A. Hansen Memorial Foundation, the Susan G. Komen Breast Cancer Foundation, and the Emerald Foundation. Support from the Commonwealth Universal Research Enhancement Program, Pennsylvania Department of Health is gratefully acknowledged.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank S. Hollenberg for the murine embryonic (E9-E11) VP16 fusion library, P. Tsichlis for many helpful discussions, and D.C. Schultz for the LEXA-luciferase reporter plasmid.


    Footnotes
 
5 Z. Hou et al., unpublished data. Back

Received 8/ 6/07. Accepted 8/17/07.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hamilton AT, Huntley S, Kim J, Branscomb E, Stubbs L. Lineage-specific expansion of KRAB zinc-finger transcription factor genes: implications for the evolution of vertebrate regulatory networks. Cold Spring Harb Symp Quant Biol 2003;68:131–40.[CrossRef][Medline]
  2. Berger SL. The complex language of chromatin regulation during transcription. Nature 2007;447:407–12.[CrossRef][Medline]
  3. Kim S, Na JG, Hampsey M, Reinberg D. The Dr1/DRAP1 heterodimer is a global repressor of transcription in vivo. Proc Natl Acad Sci U S A 1997;94:820–5.[Abstract/Free Full Text]
  4. Fisher AL, Ohsako S, Caudy M. The WRPW motif of the hairy-related basic helix-loop-helix repressor proteins acts as a 4-amino-acid transcription repression and protein-protein interaction domain. Mol Cell Biol 1996;16:2670–7.[Abstract]
  5. You A, Tong JK, Grozinger CM, Schreiber SL. CoREST is an integral component of the CoREST-human histone deacetylase complex. Proc Natl Acad Sci U S A 2001;98:1454–8.[Abstract/Free Full Text]
  6. Friedman JR, Fredericks WJ, Jensen DE, et al. KAP-1, a novel corepressor for the highly conserved KRAB repression domain. Genes Dev 1996;10:2067–78.[Abstract/Free Full Text]
  7. Hemavathy K, Guru SC, Harris J, Chen JD, Ip YT. Human Slug is a repressor that localizes to sites of active transcription. Mol Cell Biol 2000;20:5087–95.[Abstract/Free Full Text]
  8. Nakakura EK, Watkins DN, Schuebel KE, et al. Mammalian Scratch: a neural-specific Snail family transcriptional repressor. Proc Natl Acad Sci U S A 2001;98:4010–5.[Abstract/Free Full Text]
  9. Nibu Y, Zhang H, Bajor E, Barolo S, Small S, Levine M. dCtBP mediates transcriptional repression by Knirps, Kruppel and Snail in the Drosophila embryo. EMBO J 1998;17:7009–20.[CrossRef][Medline]
  10. Grimes HL, Chan TO, Zweidler-McKay PA, Tong B, Tsichlis PN. The Gfi-1 proto-oncoprotein contains a novel transcriptional repressor domain, SNAG, inhibits G1 arrest induced by interleukin-2 withdrawal. Mol Cell Biol 1996;16:6263–72.[Abstract]
  11. Gilks CB, Bear SE, Grimes HL, Tsichlis PN. Progression of interleukin-2 (IL-2)-dependent rat T cell lymphoma lines to IL-2-independent growth following activation of a gene (Gfi-1) encoding a novel zinc finger protein. Mol Cell Biol 1993;13:1759–68.[Abstract/Free Full Text]
  12. Zornig M, Schmidt T, Karsunky H, Grzeschiczek A, Moroy T. Zinc finger protein GFI-1 cooperates with myc and pim-1 in T-cell lymphomagenesis by reducing the requirements for IL-2. Oncogene 1996;12:1789–801.[Medline]
  13. Zweidler-Mckay PA, Grimes HL, Flubacher MM, Tsichlis PN. Gfi-1 encodes a nuclear zinc finger protein that binds DNA and functions as a transcriptional repressor. Mol Cell Biol 1996;16:4024–34.[Abstract]
  14. Grimes HL, Gilks CB, Chan TO, Porter S, Tsichlis PN. The Gfi-1 protooncoprotein represses Bax expression and inhibits T-cell death. Proc Natl Acad Sci U S A 1996;93:14569–73.[Abstract/Free Full Text]
  15. Karsunky H, Zeng H, Schmidt T, et al. Inflammatory reactions and severe neutropenia in mice lacking the transcriptional repressor Gfi1. Nat Genet 2002;30:295–300.[CrossRef][Medline]
  16. Saleque S, Cameron S, Orkin SH. The zinc-finger proto-oncogene Gfi-1b is essential for development of the erythroid and megakaryocytic lineages. Genes Dev 2002;16:301–6.[Abstract/Free Full Text]
  17. Hock H, Hamblen MJ, Rooke HM, et al. Intrinsic requirement for zinc finger transcription factor Gfi-1 in neutrophil differentiation. Immunity 2003;18:109–20.[CrossRef][Medline]
  18. Manzanares M, Locascio A, Nieto MA. The increasing complexity of the Snail gene superfamily in metazoan evolution. Trends Genet 2001;17:178–81.[CrossRef][Medline]
  19. Mayor R, Morgan R, Sargent MG. Induction of the prospective neural crest of Xenopus. Development 1995;121:767–77.[Abstract]
  20. Inukai T, Inoue A, Kurosawa H, et al. SLUG, a ces-1-related zinc finger transcription factor gene with antiapoptotic activity, is a downstream target of the E2A-HLF oncoprotein. Mol Cell 1999;4:343–52.[CrossRef][Medline]
  21. Cano A, Perez-Moreno MA, Rodrigo I, et al. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol 2000;2:76–83.[CrossRef][Medline]
  22. Batlle E, Sancho E, Franci C, et al. The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol 2000;2:84–9.[CrossRef][Medline]
  23. Goyal RK, Lin P, Kanungo J, Payne AS, Muslin AJ, Longmore GD. Ajuba, a novel LIM protein, interacts with Grb2, augments mitogen-activated protein kinase activity in fibroblasts, and promotes meiotic maturation of Xenopus oocytes in a Grb2- and Ras-dependent manner. Mol Cell Biol 1999;19:4379–89.[Abstract/Free Full Text]
  24. Kanungo J, Pratt SJ, Marie H, Longmore GD. Ajuba, a cytosolic LIM protein, shuttles into the nucleus and affects embryonal cell proliferation and fate decisions. Mol Biol Cell 2000;11:3299–313.[Abstract/Free Full Text]
  25. Kiss H, Kedra D, Yang Y, et al. A novel gene containing LIM domains (LIMD1) is located within the common eliminated region 1 (C3CER1) in 3p21.3. Hum Genet 1999;105:552–9.[CrossRef][Medline]
  26. Ayyanathan K, Lechner MS, Bell P, et al. Regulated recruitment of HP1 to a euchromatic gene induces mitotically heritable, epigenetic gene silencing: a mammalian cell culture model of gene variegation. Genes Dev 2003;17:1855–69.[Abstract/Free Full Text]
  27. Ayyanathan K, Fredericks WJ, Berking C, et al. Hormone-dependent tumor regression in vivo by an inducible transcriptional repressor directed at the PAX3-FKHR oncogene. Cancer Res 2000;60:5803–14.[Abstract/Free Full Text]
  28. Ryan RF, Schultz DC, Ayyanathan K, et al. KAP-1 corepressor protein interacts and colocalizes with heterochromatic and euchromatic HP1 proteins: a potential role for Kruppel-associated box-zinc finger proteins in heterochromatin-mediated gene silencing. Mol Cell Biol 1999;19:4366–78.[Abstract/Free Full Text]
  29. Schultz DC, Ayyanathan K, Negorev D, Maul GG, Rauscher FJ III. SETDB1: a novel KAP-1-associated histone H3, lysine 9-specific methyltransferase that contributes to HP1-mediated silencing of euchromatic genes by KRAB zinc-finger proteins. Genes Dev 2002;16:919–32.[Abstract/Free Full Text]
  30. Fredericks WJ, Ayyanathan K, Herlyn M, Friedman JR, Rauscher FJ III. An engineered PAX3-KRAB transcriptional repressor inhibits the malignant phenotype of alveolar rhabdomyosarcoma cells harboring the endogenous PAX3-FKHR oncogene. Mol Cell Biol 2000;20:5019–31.[Abstract/Free Full Text]
  31. Hollenberg SM, Sternglanz R, Cheng PF, Weintraub H. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol Cell Biol 1995;15:3813–22.[Abstract]
  32. Freyd G, Kim SK, Horvitz HR. Novel cysteine-rich motif and homeodomain in the product of the Caenorhabditis elegans cell lineage gene lin-11. Nature 1990;344:876–9.[CrossRef][Medline]
  33. Kadrmas JL, Beckerle MC. The LIM domain: from the cytoskeleton to the nucleus. Nat Rev Mol Cell Biol 2004;5:920–31.[CrossRef][Medline]
  34. Nix DA, Beckerle MC. Nuclear-cytoplasmic shuttling of the focal contact protein, zyxin: a potential mechanism for communication between sites of cell adhesion and the nucleus. J Cell Biol 1997;138:1139–47.[Abstract/Free Full Text]
  35. Peng H, Begg GE, Schultz DC, et al. Reconstitution of the KRAB-KAP-1 repressor complex: a model system for defining the molecular anatomy of RING-B box-coiled-coil domain-mediated protein-protein interactions. J Mol Biol 2000;295:1139–62.[CrossRef][Medline]
  36. Peng H, Begg GE, Harper SL, Friedman JR, Speicher DW, Rauscher FJ III. Biochemical analysis of the Kruppel-associated box (KRAB) transcriptional repression domain. J Biol Chem 2000;275:18000–10.[Abstract/Free Full Text]
  37. Peng H, Gibson LC, Capili AD, et al. The structurally disordered KRAB repression domain is incorporated into a protease resistant core upon binding to KAP-1-RBCC domain. J Mol Biol 2007;370:269–89.[CrossRef][Medline]
  38. Li X, Peng H, Schultz DC, Lopez-Guisa JM, Rauscher FJ III, Marmorstein R. Structure-function studies of the BTB/POZ transcriptional repression domain from the promyelocytic leukemia zinc finger oncoprotein. Cancer Res 1999;59:5275–82.[Abstract/Free Full Text]
  39. Wadman IA, Osada H, Grutz GG, et al. The LIM-only protein Lmo2 is a bridging molecule assembling an erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and Ldb1/NLI proteins. EMBO J 1997;16:3145–57.[CrossRef][Medline]
  40. Visvader JE, Mao X, Fujiwara Y, Hahm K, Orkin SH. The LIM-domain binding protein Ldb1 and its partner LMO2 act as negative regulators of erythroid differentiation. Proc Natl Acad Sci U S A 1997;94:13707–12.[Abstract/Free Full Text]
  41. McLoughlin P, Ehler E, Carlile G, Licht JD, Schafer BW. The LIM-only protein DRAL/FHL2 interacts with and is a corepressor for the promyelocytic leukemia zinc finger protein. J Biol Chem 2002;277:37045–53.[Abstract/Free Full Text]
  42. Morlon A, Sassone-Corsi P. The LIM-only protein FHL2 is a serum-inducible transcriptional coactivator of AP-1. Proc Natl Acad Sci U S A 2003;100:3977–82.[Abstract/Free Full Text]
  43. Sugihara TM, Bach I, Kioussi C, Rosenfeld MG, Andersen B. Mouse deformed epidermal autoregulatory factor 1 recruits a LIM domain factor, LMO-4, and CLIM coregulators. Proc Natl Acad Sci U S A 1998;95:15418–23.[Abstract/Free Full Text]
  44. Howard PW, Maurer RA. A point mutation in the LIM domain of Lhx3 reduces activation of the glycoprotein hormone {alpha}-subunit promoter. J Biol Chem 2001;276:19020–6.[Abstract/Free Full Text]
  45. Chang DF, Belaguli NS, Iyer D, et al. Cysteine-rich LIM-only proteins CRP1 and CRP2 are potent smooth muscle differentiation cofactors. Dev Cell 2003;4:107–18.[CrossRef][Medline]
  46. Muller JM, Metzger E, Greschik H, et al. The transcriptional coactivator FHL2 transmits Rho signals from the cell membrane into the nucleus. EMBO J 2002;21:736–48.[CrossRef][Medline]
  47. Ng EK, Chan KK, Wong CH, et al. Interaction of the heart-specific LIM domain protein, FHL2, with DNA-binding nuclear protein, hNP220. J Cell Biochem 2002;84:556–66.[CrossRef][Medline]
  48. Taniguchi Y, Furukawa T, Tun T, Han H, Honjo T. LIM protein KyoT2 negatively regulates transcription by association with the RBP-J DNA-binding protein. Mol Cell Biol 1998;18:644–54.[Abstract/Free Full Text]
  49. Brown S, McGrath MJ, Ooms LM, Gurung R, Maimone MM, Mitchell CA. Characterization of two isoforms of the skeletal muscle LIM protein 1, SLIM1. Localization of SLIM1 at focal adhesions and the isoform slimmer in the nucleus of myoblasts and cytoplasm of myotubes suggests distinct roles in the cytoskeleton and in nuclear-cytoplasmic communication. J Biol Chem 1999;274:27083–91.[Abstract/Free Full Text]
  50. Degenhardt YY, Silverstein S. Interaction of zyxin, a focal adhesion protein, with the e6 protein from human papillomavirus type 6 results in its nuclear translocation. J Virol 2001;75:11791–802.[Abstract/Free Full Text]
  51. Petit MM, Fradelizi J, Golsteyn RM, et al. LPP, an actin cytoskeleton protein related to zyxin, harbors a nuclear export signal and transcriptional activation capacity. Mol Biol Cell 2000;11:117–29.[Abstract/Free Full Text]
  52. Peinado H, Ballestar E, Esteller M, Cano A. Snail mediates E-cadherin repression by the recruitment of the Sin3A/histone deacetylase 1 (HDAC1)/HDAC2 complex. Mol Cell Biol 2004;24:306–19.[Abstract/Free Full Text]
  53. Bach I, Rodriguez-Esteban C, Carriere C, et al. RLIM inhibits functional activity of LIM homeodomain transcription factors via recruitment of the histone deacetylase complex. Nat Genet 1999;22:394–9.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
D. E. Montoya-Durango, C. S. Velu, A. Kazanjian, M. E. B. Rojas, C. M. Jay, G. D. Longmore, and H. L. Grimes
Ajuba Functions as a Histone Deacetylase-dependent Co-repressor for Autoregulation of the Growth Factor-independent-1 Transcription Factor
J. Biol. Chem., November 14, 2008; 283(46): 32056 - 32065.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Z. Hou, H. Peng, K. Ayyanathan, K.-P. Yan, E. M. Langer, G. D. Longmore, and F. J. Rauscher III
The LIM Protein AJUBA Recruits Protein Arginine Methyltransferase 5 To Mediate SNAIL-Dependent Transcriptional Repression
Mol. Cell. Biol., May 15, 2008; 28(10): 3198 - 3207.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ayyanathan, K.
Right arrow Articles by Rauscher, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ayyanathan, K.
Right arrow Articles by Rauscher, F. J., III


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online