| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology, and Genetics |
1 The Wistar Institute, Philadelphia, Pennsylvania; 2 Department of Medicine, Washington University School of Medicine, St. Louis, Missouri; 3 Blood and Marrow Transplantation Program, Children's Hospital of Pittsburgh, Pittsburgh, Pennsylvania; 4 Center for Molecular Biology and Biotechnology, Department of Biological Sciences, Florida Atlantic University, Boca Raton, Florida
Requests for reprints: Frank J. Rauscher III, The Wistar Institute, 3601 Spruce Street, Philadelphia, PA 19104-4268. Phone: 215-898-0995; Fax: 215-898-3929; E-mail: rauscher{at}wistar.org.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The SNAG repression domain (Snail/GFI-1) is present in the vertebrate homologues of the Snail/Slug and in the growth factor independence-1 (GFI-1) ZFPs (7–10). The GFI-1 proto-oncogene was cloned by using an insertional mutagenesis strategy wherein Moloney murine leukemia virus–infected T cells selected for interleukin 2 independence showed non–random integration of the provirus at the GFI-1 locus (11). Remarkably, GFI-1 was independently cloned as a gene, which could cooperate with myc and pim1 in transgenic models of B- and T-cell lymphoma (12). GFI-1 is a nuclear localized ZFP which recognizes a 12 bp DNA consensus sequence (13, 14). The GFI-1 ZFP encodes the 20–amino acid SNAG domain in its NH2 terminus. This segment is sufficient for repression, and single amino acid substitutions in the SNAG domain abolish repression (10). Consistent with its role as a T cell–tropic oncogene, overexpression of GFI-1 in immortalized T cells allowed them to escape the G1 arrest induced by interleukin 2 withdrawal and, interestingly, a SNAG domain mutant of GFI-1 was inactive in this capacity (10). Gene knockout studies have shown that mammalian GFI-1 genes are essential for the development of erythroid and megakaryocytic lineages as well as neutrophil differentiation (15–17).
The vertebrate homologues of the fly Snail and Slug genes encode SNAG domains and their roles in development and disease have been extensively studied (18). In Xenopus, the Snail/Slug family has been shown to play essential roles in both mesoderm differentiation and in neural crest induction/migration, and these functions require a competent SNAG domain. Both fibroblast growth factor and hepatocyte growth factor induce expression of Slug, which in turn, induces epithelial-mesenchymal transitions (19). The E2A-HLF fusion protein has been shown to activate the human Slug gene with resultant interleukin-3–independent survival and transformation of pro–B cells (20). Snail family members also play crucial roles in the development of mesoderm and nervous system by triggering epithelial-mesenchymal transition. Recent studies have shown that the human and mouse E-cadherin promoters are direct targets for Snail ZFPs and the loss of E-cadherin expression is a major contributor to the acquisition of an invasive, highly malignant phenotype during human tumor progression (21, 22). Thus, it is clear that the SNAG-ZFPs play important and diverse roles in embryonic development and in human disease. Despite these advances in defining the roles of SNAG domain proteins in biological processes, the molecular mechanisms of SNAG-mediated transcriptional repression are still largely undefined.
In this article, we identify Ajuba (23, 24) and LIMD1 (25) proteins as SNAG domain–interacting proteins and provide strong evidence that they function as corepressors for the SNAG domain.
| Materials and Methods |
|---|
|
|
|---|
-PAX3 (27) and
-LEXA IgGs (Santa Cruz Biotechnology) are rabbit and goat polyclonal antibodies which recognize the PAX3 and LEXA DNA-binding domains, respectively. The
-Ajuba and
-LIMD1 are polyclonal antibodies raised by immunizing rabbits with 6-His fusion proteins of mouse Ajuba (amino acids 1–216) and mouse LIMD1 (amino acids 1–158) as antigens. These antibodies only recognize their cognate antigens and do not cross-react in the assays tested. The
-MYC tag monoclonal antibody (clone 9E10),
-AcH3,
-AcH4 (raised against acetylated histone H3 and H4), and
-H3-MeK9 (raised against trimethylated lysine 9, histone H3) antibodies were purchased from Upstate. Construction of a SNAG domain minigene and its derivatives. A synthetic SNAG domain coding sequence derived from GFI-1 was constructed by standard overlap-extension PCR. A Kozak consensus was added prior to the initiator methionine of the 20–amino acid SNAG domain (MPRSFLVKSKKAHSYHQPRS) followed by a 6–amino acid spacer (PGPDYS). In-frame EcoRI (5') and SalI (3') sites were included for cloning into the pSP73 vector. Alanine substitution mutagenesis was done via PCR using appropriate mutant oligonucleotides. The wild-type and mutant SNAG minigenes were subcloned into PAX3-, LEXA-, and pBTM116-LEXA containing plasmids to create NH2 terminal fusions.
Immunoprecipitation and electrophoretic mobility shift assays. Each expression plasmid was verified for stable protein expression in vivo as previously described (26). The myc-AJUBA and LIMD1 plasmids have also been described (23). Briefly, [35S]-L-methionine–labeled whole cell extracts prepared from transiently transfected COS-1 cells were immunoprecipitated with
-PAX3 IgG or
-LEXA IgG, and proteins analyzed by SDS-PAGE and fluorography. In coimmunoprecipitation experiments, subsequent to cotransfection of either SNAG-PAX3 or SNAG-LEXA with the MYC-Ajuba plasmid (1:1 ratio), immunoprecipitation was carried out using ELB buffer (28). Nuclear extracts were prepared using a rapid protocol (27) and used in electrophoretic mobility shift assays with a 32P-labeled e5 site (a PAX3-binding site derived from the engrailed gene) probe.
Transcriptional repression assays. To monitor the repression potentials of the chimeric SNAG repressor proteins, 2 x 105 NIH3T3 cells were transfected with 1 µg of the expression plasmid along with 0.5 µg of PAX3- or LEXA-luciferase reporter plasmids, and 0.25 µg of pCMV-LacZ plasmids, using LipofectAMINE (Life Technologies). Whole cell extracts were assayed for luciferase activities and then normalized to ß-galactosidase values for transfection efficiency (26, 27). Fold repression was determined as the ratio of normalized light units in vector versus SNAG-expression plasmid–transfected cells. To examine the effect of Ajuba on SNAG-PAX3 or SNAG-LEXA–mediated repression, cotransfection was done as described above.
Immunofluorescence and colocalization. Immunocytochemistry was done essentially as previously described (28). NIH3T3 cells were transfected with the indicated expression plasmids. The cells were fixed, permeabilized, and then incubated with
-LEXA (1:100 dilution) or
-MYC (1:1,000 dilution) antibodies. The proteins were detected with FITC-conjugated
-rabbit IgG (1:500 dilution) or Texas red–conjugated
-mouse IgG (1:1,000 dilution), respectively. Finally, the cells were stained for DNA with Hoechst (2 ng/mL) and mounted on glass slides using Fluoromount G (Southern Biotechnology Associates, Inc.). Cells were visualized using a Leica confocal laser-scanning microscope with the help of the Wistar Institute Cancer Center Microscopy Core Facility. Images were captured using QED Imaging software.
Chromatin immunoprecipitation. SPHL11 or SPHL20 cells were plated at 5 x 106 cells/150 mm dish, treated continuously with either 500 nmol/L of 4-hydroxytamoxifen (4-OHT; +OHT dishes) or 0.1% ethanol (–OHT dishes) for 2 days, and then fixed in 1% formaldehyde (EM Biosciences) for 20 min at 37°C. Solubilized and sonicated chromatin was prepared as previously described (29), and immunoprecipitated with
-PAX3,
-Ajuba,
-LIMD1,
-AcH3,
-AcH4, or
-H3-MeK9 antibodies. Usually, 10% of the clarified chromatin was saved as input. The immunocomplexes were processed as previously described (29). Both the input and the immunoprecipitated DNAs were used in quantitative PCR reactions with the primer pairs illustrated in Fig. 5A. The PBS1 (5' GATCGATAATTCGAGCTACTG 3') and PBS2 (5' GAGCTCGGTACCCGGGTCG 3') primer pair amplify the PAX3 binding sites; the primer pair TKP1 (5' GCGCGGTCCCAGGTCCACTT 3') and LUC1 (5' TCCAGGAACCAGGGCGTATCTCT 3') amplify the HSV-TK promoter region (26). The DNA fragments were electrophoresed on 1.5% agarose gels and either photographed or subjected to Southern blotting and autoradiography.
|
| Results |
|---|
|
|
|---|
20 amino acids with the NH2-terminal first seven amino acids being strictly conserved between the different members (Fig. 1B). Furthermore, the SNAG domains of GFI-1 and GFI-1B genes also possess a well-conserved nuclear localization signal (KSKK). To determine if the synthetic SNAG domain would function as a transferable, modular repression domain, we fused it to the NH2 terminus of the minimal PAX3 DNA-binding domain (PAX3; Fig. 1C). We have used PAX3 as a recipient (26, 27, 30) for the following reasons: PAX3 (a) binds DNA as a monomer and recognizes an extended nondegenerate DNA binding site due to paired and homeodomain-DNA binding motifs, (b) is easily detectable using PAX3 antibodies, and (c) is transcriptionally neutral when bound to DNA in the absence of an effector domain. We used alanine scanning mutagenesis to map the amino acid sequence requirements for SNAG repression. We targeted both the NH2 terminal block of seven amino acids, which is identical among all SNAG domains and the more COOH-terminal region, which is not as highly conserved (Fig. 1C). Each protein was comparably expressed (Fig. 1D) and showed comparable DNA binding activity to the e5 site (Fig. 1E). Expression plasmids encoding SNAG-PAX3 fusions were cotransfected with the PAX3-luciferase reporter plasmid and cell extracts assayed for activity. Fusion of the SNAG domain to the NH2-terminus of PAX3 created a potent repressor (Fig. 1F). Repression was dose-dependent and was strictly contingent on PAX3-binding sites in the reporter plasmid (data not shown). The mutants varied in their abilities to repress the PAX3-luciferase in reporter assays (Fig. 1F). The FLV-AAA substitution severely reduced repression. However, the S-A and KK-AA mutants retained significant repression activity, whereas the single substitution F-A severely reduced repression. Thus, a phenylalanine to alanine substitution in the highly conserved SNAG domain converts a normally powerful repressor of transcription into a neutral DNA binding protein. Whether the seven–amino acid NH2 terminal segment is sufficient for repression remains to be tested. Interestingly, a modular repression domain as small as four amino acids (WRPW) present in the hairy and achaete-scute bHLH transcription factors is sufficient to confer repression by recruiting the Groucho corepressor (4). We suggest that the SNAG domain may function in a similar manner.
|
|
200 primary hits that were obtained upon screening,
40 million library clones, we isolated
20 that interacted strongly with the wild-type SNAG domain. Several of these were re-screened by reintroduction into naïve yeast with a variety of other baits. SNAG domain–associated proteins, SNAP13 and SNAP20, interacted very strongly with wild-type SNAG but failed to interact with the SNAG (FLV-AAA) mutant, LEXA, or any of the other negative control baits including KAP-1, Lamin, Rho, and protein kinase C (Fig. 2B). We further characterized SNAP13 and SNAP20 by introducing them into naïve yeast along with each of the pBTM116-SNAG-LEXA baits (Fig. 2C). The interactions were almost completely concordant with repression activity; each SNAP interacted with active SNAG repressors (wild-type and S-A mutants) but did not interact with the mutants (FLV-AAA and F-A), which abolish repression. The exception to this concordance is KK-AA, which is expressed at a much-reduced level in yeast (data not shown). Thus, by these criteria, these SNAPS are strong candidates for mediators of SNAG function.
The DNA sequence of the SNAPs showed that the proteins were in-frame with the VP16 activation domain encoded by the vector. In the primary screen, we obtained two independent isolates of SNAP13 and multiple, identical isolates of SNAP20. BLAST searches revealed that SNAP13 and SNAP20 were identical to the two NH2-terminal LIM domains of Ajuba and LIMD1, respectively. LIM is an acronym of three transcription factors, Lin11, Isl-1, and Mec-3, in which the motif was first identified (32). The LIM domain protein subfamily, which includes Ajuba and LIMD1, is illustrated in Fig. 2D. The Ajuba, LIMD1, and three other LIM domain proteins such as Zyxin, TRIP6, and lipoma-preferred partner proteins contain characteristic glycine/proline-rich regions and nuclear export signals. They belong to the group 3 LIM domain family, the members of which exhibit nucleocytoplasmic distribution and mediate both cellular and nuclear signaling events (33). LIM domains are bona fide protein-protein interaction motifs, which encode a signature Cys2-His1-Cys3-Cys Zn2+ binding domain as shown for the three individual LIM domains of Ajuba (Fig. 2E). A dendrogram analysis constructed from the LIM domains of the three LIM domain proteins revealed that a distinct phylogenetic relationship exists only between the LIM domains of Ajuba and LIMD1 (Fig. 2F). The SNAG-interacting LIM domains of Ajuba and LIMD1 (
134 amino acids) fell into a single group with a similarity index of 62.7, implying that they evolved from a common ancestral gene.
Ajuba interacts with SNAG in vivo and functions as a corepressor. To verify that SNAG-LIM domain interactions occur in vivo in mammalian cells, we used expression vectors for SNAG-PAX3, SNAG-LEXA, and MYC epitope–tagged, full-length Ajuba (MYC-Ajuba). Proper expression of the MYC-Ajuba protein was confirmed by immunoprecipitation with
-MYC monoclonal antibody (data not shown). Next, we cotransfected the MYC-Ajuba and wild-type or mutant SNAG-LEXA plasmids into COS-1 cells. The 35S-methionine-labeled cell lysates were immunoprecipitated with either
-MYC or
-LEXA IgG. Figure 3A
shows that the
-MYC detects a 66 kDa MYC-Ajuba protein whereas the
-LEXA detects a 25 kDa LEXA protein in the MYC-Ajuba + LEXA vector cotransfected cells. However, in the wild-type SNAG-LEXA + MYC-Ajuba cotransfected cells, the
-LEXA also detects the MYC-Ajuba protein. As expected, the
-MYC also detects the wild-type SNAG-LEXA protein. Coimmunoprecipitation experiments with mutant SNAG-LEXA plasmids indicated that the repression-incompetent mutants of the SNAG domain fail to bind the Ajuba, strongly suggesting that this interaction is functionally relevant (Fig. 3A).
|
We did cotransfection experiments to determine if Ajuba could modify the transcriptional repression function of the SNAG domain. We transfected CMV vectors for SNAG-PAX3 or SNAG-LEXA constructs into NIH3T3 cells, with or without CMV-Ajuba. SNAG-LEXA repressed the LEXA-luciferase reporter, and this repression was enhanced by CMV-Ajuba. As expected, Ajuba also enhanced SNAG-PAX3–mediated repression of the PAX3 luciferase reporter (Fig. 3B). These results suggest that Ajuba mediates SNAG repression and functions as a SNAG corepressor.
Recruitment and nuclear colocalization of Ajuba and SNAG in NIH3T3 cells. The functional studies prompted us to investigate the subcellular localization patterns of the MYC-Ajuba, the wild-type and mutant SNAG-LEXA proteins. Immunofluorescence analysis revealed that cells transfected with MYC-Ajuba showed predominant cytoplasmic staining and those that were transfected with SNAG-LEXA (wild-type and mutants) showed intense nuclear staining (Fig. 4A ). However, cells that received both Ajuba and SNAG-LEXA plasmids showed abundant nuclear staining of Ajuba that was solely dependent on the repression competency of the SNAG domain (Fig. 4B). A majority of cells in this doubly transfected population showed the pattern observed in Fig. 4B. These remarkable images strongly corroborate our functional studies described earlier. These results also suggest that the SNAG domain can recruit and/or retain Ajuba in the nucleus, and are consistent with our earlier observations that Ajuba is both cytoplasmic and nuclear. Recent reports suggest that group 3 LIM proteins like Zyxin and Ajuba can shuttle between the cytoplasm and the nucleus, and thus, may form a novel intracellular signaling system. It has been hypothesized that there are nuclear "anchors" for this class of shuttling LIM proteins (34). We hypothesize and present evidence that the SNAG domain may be such an anchor for the Ajuba protein.
|
6-fold repression was observed (26); however, in the presence of both 4-OHT and TSA, this repression was totally relieved in both clones (26). This experiment suggests that one of the mechanisms of SNAG domain repression may involve histone deacetylation. To confirm that the SNAG-Ajuba machinery was recruited to the target gene, we did comprehensive ChIP experiments using a battery of antibodies: chromatin-associated proteins were cross-linked to DNA in vivo with formaldehyde in mock or 4-OHT–treated SPHL11 and SPHL20 cells and immunoprecipitated with
-PAX3,
-Ajuba,
-LIMD1,
-AcH3,
-AcH4, and
-H3-MeK9 antibodies. The immunoprecipitated DNA was analyzed by quantitative PCR, using primer pair targeting the 6xPAX3 binding sites (PBS1 and PBS2), the TK promoter regions (TKP1 and LUC1) or the CD19-TK-LUC zeocinR locus (26). Fragments, which bracket the PAX3-binding sites, were considerably enriched in the PAX3 immunoprecipitates after 4-OHT treatment, indicating that there was a strong enrichment of the SPHBD protein at the PAX3 sites. This experiment was controlled by the presence of similar levels of the PAX3 binding site fragment in the input chromatin (Fig. 5B). Likewise, we observed a strong 4-OHT–dependent enrichment of the 257 bp TK promoter fragment in
-Ajuba,
-LIMD1, and
-H3-MeK9 chromatin immunoprecipitates (Fig. 5C). Thus, in addition to the DNA-binding component, other components of the SNAG repression complex (i.e., Ajuba, LIMD1, and H3-MeK9) were inducibly recruited to the target gene. Based on these results, we conclude that the SPHBD fusion protein, Ajuba, LIMD1, and H3-MeK9 are strongly recruited to the chromatin regions comprising the PAX3 binding site, and the TK promoter region, respectively. In parallel ChIP experiments, we observed a significant reduction in the levels of acetylated histones H3 and H4 at the TK promoter region following 4-OHT-treatment, indicating that histone hypoacetylation occurs upon recruitment of SPHBD protein to the upstream PAX3 sites (Fig. 5D). These results are in agreement with the repression of this locus by SPHBD following hormone treatment. Future ChIP experiments will unravel the identity of the enzymes involved in SNAG repression. We expect these experiments to yield clues about the nature of the unique nucleocytoplasmic signaling mechanism used by Ajuba and LIMD1 proteins.
| Discussion |
|---|
|
|
|---|
After the initial identification of LIM domain proteins, Ajuba and LIMD1, as SNAG-domain interactors in the yeast two-hybrid assay, we did extensive biochemical analyses to confirm this interaction. Our striking results from coimmunoprecipitation experiments indicate that the SNAG domain interacts avidly with Ajuba in vivo and also that Ajuba can enhance SNAG-mediated repression. As expected, we observed these results only with repression-competent SNAG domains. The KAP-1 corepressor, which interacts only with repression-competent KRAB domains, also enhance KRAB-mediated repression. Because Ajuba possesses these important characteristics of corepressor proteins similar to KAP-1, we designate Ajuba as a SNAG corepressor.
LIM domain interactions have been observed in several classes of transcription factors and cofactors. Specific examples include: (a) the nuclear LIM-only (LMO) protein interact with GATA-1, GATA-2, and Tal1/Scl transcription factors (39); (b) the LIM domain–binding protein Ldb1, its LIM-only protein partner LMO2, and the DNA-binding SCL/E12, exist in a multiprotein complex that negatively regulates erythroid function (40); (c) FHL2/DRAL interacts with the promyelocytic leukemia zinc finger protein (a sequence-specific transcriptional repressor) and functions as a corepressor by augmenting promyelocytic leukemia zinc finger–mediated transcriptional repression (41); (d) FHL2 associates with Jun and Fos and serves as a coactivator of activator protein by stimulating Fos- and Jun-dependent transcription (42); (e) the CLIM forms a protein complex consisting of LIM-HD, LMO, bHLH, and GATA at the target promoters (43); (f) the LIM-homeodomain transcription factor Lhx3 binds to the pituitary-specific transcription factor Pitx-1 and also interacts with several coactivator/adapter proteins including the selective LIM-binding protein (44); and (g) cysteine-rich LIM-only proteins (CRP1 and CRP2) play important roles in organizing multiprotein complexes, both in the cytoplasm, where they participate in cytoskeletal remodeling, and in the nucleus, where they strongly facilitate smooth muscle differentiation (45). These studies clearly show that nuclear LIM proteins can function as adapter molecules in the formation of large multiprotein complexes that form on DNA and that influence transcription.
Our colocalization studies show that Ajuba by itself remains totally cytoplasmic, however, in the presence of a repression-competent SNAG domain, its localization completely shifted to the nucleus. The SNAG domain may facilitate both the import of Ajuba into the nucleus and its subsequent retention by serving as a nuclear anchor in chromatin. Similar nuclear targeting functions have been observed for other LIM proteins. For example, (a) stimulation of the Rho signaling pathway induces translocation of the transcriptional LIM-only coactivator FHL2 to the nucleus (46); (b) in heart, FHL2 interacts with hNP220, a DNA-binding nuclear protein to serve as a molecular adapter in the formation of a multiprotein complex (47); (c) the LIM protein KyoT2, an alternatively spliced murine isoform of SLIM1 has been shown to negatively regulate transcription by interacting with RBP-J DNA-binding protein and displacing it from the DNA (48, 49); (d) interaction of Zyxin (usually found in focal adhesions) with the human papillomavirus–derived E6 protein leads to its accumulation in the nucleus where it functions as a transcriptional activator. Significantly, this interaction requires the three LIM domains present at the COOH terminus of Zyxin (50); and (e) the lipoma-preferred partner protein exhibits nucleocytoplasmic distribution and possesses focal adhesion and nuclear targeting capabilities. It does not contain any consensus nuclear localization signals suggesting that it may be imported into the nucleus via a nuclear localization signal containing transport protein (51).
The colocalization studies also suggested that upon SNAG-mediated translocation, Ajuba along with its (unidentified) associated proteins could constitute a macromolecular repression complex at the target promoter. Based on our findings from the ChIP experiments, we favor the notion that the initial DNA-binding by the SNAG-PAX3 repressor at the PAX3 binding sites leads to the subsequent recruitment of Ajuba, and associated proteins to the promoter region. Because we also observed significant hypoacetylation of histone tails at the promoter region and reversal of SNAG-mediated repression in the presence of TSA, we believe that SNAG repression involves histone deacetylases (HDAC) and that HDAC may be constituents in the SNAG-holo repression complex. HDAC and Sin3A have been found in SNAIL complexes, which repress E-cadherin (52). However, our preliminary data suggests that arginine methyltransferases also play an important role.5
It is well established that HDACs can be found in both the cytoplasm and the nucleus. Ajuba may interact with a cytosolic HDAC and recruit it to the nucleus, or it may interact with an HDAC1 existing in the nucleus and recruit it to the repression complex. The RLIM has been shown to interact with members of the HDAC corepressor complex (53). It would be interesting to identify the nature of the HDAC involved, and to decipher the hitherto unidentified associated proteins that constitute the macromolecular repressor complex. This necessitates the isolation and characterization of interacting proteins that are present in both cytoplasmic and nuclear compartments, experiments which are ongoing. These findings provide another example whereby a small conserved repression domain, the 21–amino acid (SNAG) functions by recruiting a large macromolecular complex. These results are particularly relevant to the SNAIL-SNAG proteins which are up-regulated during the processes of epithelial-mesenchymal transition and metastases in many epithelial cancers. A small molecule strategy to block the SNAIL-SNAG-Ajuba interaction may be a feasible and attractive target to provide either preventive or therapeutic efficacy during tumor progression.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank S. Hollenberg for the murine embryonic (E9-E11) VP16 fusion library, P. Tsichlis for many helpful discussions, and D.C. Schultz for the LEXA-luciferase reporter plasmid.
| Footnotes |
|---|
Received 8/ 6/07. Accepted 8/17/07.
| References |
|---|
|
|
|---|
-subunit promoter. J Biol Chem 2001;276:19020–6.This article has been cited by other articles:
![]() |
D. E. Montoya-Durango, C. S. Velu, A. Kazanjian, M. E. B. Rojas, C. M. Jay, G. D. Longmore, and H. L. Grimes Ajuba Functions as a Histone Deacetylase-dependent Co-repressor for Autoregulation of the Growth Factor-independent-1 Transcription Factor J. Biol. Chem., November 14, 2008; 283(46): 32056 - 32065. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Hou, H. Peng, K. Ayyanathan, K.-P. Yan, E. M. Langer, G. D. Longmore, and F. J. Rauscher III The LIM Protein AJUBA Recruits Protein Arginine Methyltransferase 5 To Mediate SNAIL-Dependent Transcriptional Repression Mol. Cell. Biol., May 15, 2008; 28(10): 3198 - 3207. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |