| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
Np63
Acquires Invasive Phenotype of Human Squamous Cell CarcinomaDepartment of Oral and Maxillofacial Surgery, Division of Cervico-Gnathostomatology, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima, Japan
Requests for reprints: Koichiro Higashikawa, Department of Oral and Maxillofacial Surgery, Division of Cervico-Gnathostomatology, Graduate School of Biomedical Sciences, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553, Japan. Phone: 81-82-257-5673; Fax: 81-82-257-5671; E-mail: khigashi{at}hiroshima-u.ac.jp.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Np63
is the predominantly expressed p63 isoform in SCC cells. Np63 promoter activity required a CAAT/enhancer binding protein (C/EBP) binding element and was reduced remarkably by Snail. Down-regulation of Np63 and reduction of C/EBP were observed in EMT phenotype cells, which exhibited invasive activity in vitro. p63 knockdown in cells enhanced invasive activity in the presence of E-cadherin. Conversely, forced expression of Np63 blocked invasive activity of cells with the EMT phenotype. These findings indicate that Snail down-regulates Np63, leading to acquisition of the invasive phenotype by SCC. The invasive activity caused by down-regulation of Np63 does not require down-regulation of E-cadherin. [Cancer Res 2007;67(19):9207–13] |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
p63 (TP73L/TP63) is a member of the p53 gene family (15, 16) and has two different promoter usage-generating proteins containing (TA) or lacking (N) an NH2 terminus, which is homologous to the transactivation domain of p53. Np63 isoforms act as transcription repressors in a dominant-negative fashion to oppose p53- or TAp63-mediated transactivation in vitro and in vivo (17). However, Np63 isoforms also display transcriptional activity that is independent of the transactivating domain (18). p63–/– mice have striking developmental defects, including complete lack of all stratified squamous epithelia, epidermal appendages, and mammary, lacrimal, and salivary glands (19, 20). Heterozygous germ-line mutations in p63 are the cause of ectrodactyly, ectodermal dysplasia, and facial clefts syndrome (EEC syndrome; 21). Thus, p63 plays essential roles during development in the formation of epithelial structures. In contrast to p53, p63 is rarely mutated in human cancers, and the role of p63 in tumors is still unclear (reviewed in ref. 22), although some links to the DNA damage response pathway have been reported (15, 23). Upstream transcriptional regulators for the p63, particularly of Np63, are poorly understood in contrast to the many downstream target genes of the p63 that have recently been reported (reviewed in ref. 22). Here, we report a novel mechanism whereby down-regulation of Np63 by Snail enhances invasiveness of SCC cell in parallel with down-regulation of E-cadherin.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Np63 full-length cDNA (Genbank accession number AB042841) was amplified by reverse transcription-PCR (RT-PCR) with Pfx polymerase (Invitrogen) and cloned into the NheI and XbaI sites of pcDNA6-V5/His-tagged expression vector (Invitrogen). Primers for amplification were 5'-GCTAGCAACATGTTGTACCTGGAAAACAATGCCC-3' and 5'-TCTAGAGGAACTCCCCCTCCTCTTTGATGC-3'. CAAT/enhancer binding protein (C/EBP) full-length cDNA (Genbank accession number M37197) was amplified by RT-PCR with LA Taq polymerase with GC buffer (TaKaRa BIO) and cloned into the KpnI and XhoI sites of pcDNA3.1-V5/His-tagged expression vector (Invitrogen). Primers for amplification were 5'-GGTACCATGGAGTCGGCCGACTTCTA-3' and 5'-CTCGAGTCTCGCGCAGTTGCCCATG-3'. The sequence of these PCR products was verified by sequencing.
Cell lines and cell culture. The human vulval epidermal cell line A431 and four human oral SCC cell lines, OM-1, HOC719, HOC313, and TSU, have been described previously (9). HOC719-PE (positive E-cadherin) and HOC719-NE (negative E-cadherin) cells were isolated from HOC719 cells, which express E-cadherin heterogeneously (9). All SCC cell lines lost the functional p53 genetically (24). A431-SNA1 and OM-1-SNA1 cells were generated by transfection with pcDNA3-mm SnailHA (Genbank accession number BC034857), kindly provided by Dr. de Herreros (Universitat Pompeu Fabra, Barcelona, Spain), as described previously (25). GT-1 cells are immortalized fibroblasts derived from human gingiva by transfection with an hTERT expression vector (26). The Np63 expression vector or the empty pcDNA6-V5/His vector as control was transfected into HOC313 cells, and stable cell clones were established by blasticidin selection. All cell lines were cultured at 37°C in a humidified atmosphere of 5% CO2 in air and maintained with DMEM (Sigma) supplemented with 10% fetal bovine serum (FBS; Sigma).
RNA extraction and first-strand cDNA synthesis. Total RNAs were isolated from the cells in 70% to 80% confluence with Trizol (Invitrogen). First-strand synthesis was done with First-Strand cDNA Synthesis kit (Roche).
Semiquantitative RT-PCR. RT-PCRs (20 µL) were amplified with 30 cycles of denaturing at 95°C for 30 s, annealing for 30 s, and extension at 72°C for 1 min. For amplification of specific regions of TAp63 and Np63, the primers and annealing temperatures used were described previously (15). For other amplifications, primers and annealing temperatures were follows: p63, 5'-TCCTCAGGGAGCTGTTATCC-3' and 5'-ACATACTGGGCATGGCTGTT-3', 56°C; Np63, 5'-ATGTTGTACCTGGAAAACAATG-3' and 5'-ATCTGATAGATGGTGGTCAGCC-3', 56°C; p63ß, 5'-GGCCGTTGAGACTTATGAAATGC-3' and 5'-GCTCAGGGATTTTCAGACTTGC-3', 56°C; p63
, 5'-GGCCGTTGAGACTTATGAAATGC-3' and 5'-CTCTATGGGTACACTGATCGGTTT-3', 56°C; C/EBP, 5'-CAGACCACCATGCACCTG-3' and 5'-TTGTCACTGGTCAGCTCCAG-3', 58°C; and G3PDH, 5'-ACCACAGTCCATGCCATCAC-3' and 5'-TCCACCACCCTGTTGCTGTA-3', 52°C. PCR products were analyzed by 1.8% agarose gel electrophoresis and sequenced to verify their identity.
RNA interference. Small DNA fragment encoding a short hairpin RNA (shRNA) targeting all of the p63 isoforms was cloned into pRNA-U6.1 (GeneScript). The sequences of the short interfering RNAs (siRNA) were follows: p63 siRNA, GGUACCAGCACACUCUGUCUU; control siRNA, GUCGAUCCGAACACUCUCUGU. Vectors were transfected into A431 and OM-1 cells, and stable cell clones were selected with hygromycin.
Cell lysates and immunoblotting. Cells were harvested and lysates were prepared according to standard methods. Immunoblotting was also done according to a standard method. Antibodies were anti-p63, which are specific for Np63 isoforms (Ab-1, Oncogene Research Products), anti-E-cadherin (H-108, Santa Cruz Biotechnology), and anti--tubulin (Zymed Laboratories).
Luciferase reporter assay. The Np63 promoter region of nucleotide –558 to +262 (construct 1) was amplified with Pfx polymerase from genomic DNA of normal human fibroblasts with primers as described previously (27). Other fragments of the Np63 promoter region were also amplified by PCR. The sense primer sequences for each fragment were follows: nucleotide –203 (construct 2), 5'-GGTACCGAAATGCCTTCTGTAAATCG-3'; nucleotide –167 (construct 3), 5'-GGTACCTGTTTGGGGAGATTTGTTTTGTTTT-3'; nucleotide –160 (construct 4), 5'-GGTACCGGAGATTTGTTTTGTTTTTAAAAGACAGTGCA-3'; nucleotide –115 (construct 5), 5'-GGTACCGAGACAGGGAAAGTTTTACC-3'; and nucleotide –44 (construct 6), 5'-GGTACCGATTGGTGATAAGGAATTC-3'.
Each PCR product was cloned into the KpnI and XhoI sites of pGL3-basic vector (Promega). The mutant C/EBP binding element clone (pGL3-Np63_C/EBP mt) was also generated by changing AGATTT (italicized: nucleotide –158 to –155 on a putative C/EBP binding element) to GCTAGC in the construct 1. A431 cells were cotransfected with 4 µg of the reporter construct containing the Np63 promoter sequence and 1 ng of phRL-CMV (Promega) as an inner control for transfection efficiency with LipofectAMINE 2000 (Invitrogen). Either empty pcDNA3, pcDNA3.1_C/EBP His/V5, or pcDNA3-mm SnailHA was further transfected. At 48 h after transfection, cells were lysed with passive lysis buffer, and the promoter activity was measured with a Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's protocol. Briefly, a Firefly-derived luciferase activity of interest was measured by addition of the Firefly-specific substrate to the transfected cell extract. Subsequently, Renilla-derived luciferase activity was measured by further addition of the Renilla-specific substrate. Transfection efficiency was normalized to cytomegalovirus-driven Renilla-derived luciferase activity. The Firefly-derived luciferase activity of interest was normalized against transfection efficiency and presented in fold change toward normalized activity of the construct 1. The results correspond to the mean of at least three independent experiments.
Immunocytochemistry. The cells cultured on Lab-Tek II Chamber Slides (Nalgene Nunc) were fixed with 4% paraformaldehyde and treated with 0.1% Triton X-100 for 5 min and 1% bovine serum albumin in PBS for 30 min. To detect localization of filamentous actin (F-actin) and E-cadherin in cells, Alexa Fluor 488 phalloidin (Invitrogen) and rabbit anti-E-cadherin antibody (H-108) were used for staining. The cells were further incubated with Alexa Fluor 568–labeled goat anti-rabbit IgG (Invitrogen) for 45 min. After mounting with Vectashield (Vector Laboratories), the cells were subjected to fluorescent microscopy.
Matrigel cell invasion assay. Cell invasion activity was measured with BioCoat Matrigel Invasion Chamber (Becton Dickinson) according to the manufacturer's protocol. Briefly, cells were suspended in DMEM containing 5 x 105/mL. Cell suspension (500 µL) was added to each chambers containing an 8-µm pore size PET membrane with Matrigel basement membrane and incubated for 12 to 48 h at 37°C and 5% CO2 atmosphere. Cells on the bottom surface of the membrane were fixed with 4% paraformaldehyde and stained with trypan blue and counted as the invading cells.
In vitro three-dimensional culture. Three-dimensional cultures of epithelial cells with contracted collagen gel containing fibroblasts were prepared as described (28). GT-1 fibroblasts were suspended in a mixture of type I collagen (Koken) and DMEM containing 10% FBS and seeded in 12-well culture dishes. The collagen was allowed to solidify by incubating at 37°C for 1 h. The final concentrations of collagen and GT-1 fibroblasts were 1 mg/mL and 1 x 106 cells/mL, respectively. SCC cells (1 x 106) suspended in 1 mL of culture medium were seeded on the collagen gel. After incubation at 37°C for 1 h, the gels were removed from the sides and bottoms of dishes and floated in the medium. After 1 week of incubation, the contracted gel was placed on a nylon mesh, and culture medium was added until the fluid level reached the upper edge of the gel. The gels were incubated under air-liquid interface culture for 1 more week. Culture medium was changed every second day. The gel was fixed with Mildform (Wako), embedded in paraffin, and stained with H&E as described previously (29).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
First, we examined expression of p63 and its isoforms in A431 and OM-1 cells by semiquantitative RT-PCR. Primers specific for p63 isoforms are shown in Fig. 1A
. A primer set to amplify all transcripts from p63 clearly detected p63 mRNA in A431 and OM-1 cells (Fig. 1B). The series of primer sets to detect a specific isoform revealed dominant N isoforms expression in these cells (Fig. 1B). Using the specific primer sets that discriminate the COOH-terminal variants, -form was dominantly detected (Fig. 1C). Therefore, Np63 is the p63 isoform specifically expressed in SCC cells with epithelial phenotype, which is consistent with previous reports (30).
|
Np63 in A431 and OM-1 cells (Fig. 1B and D).
Suppression of C/EBP-dependent Np63 promoter activity by Snail. To confirm that Np63 expression is influenced by Snail, the Np63 promoter activity in response to Snail was monitored by luciferase reporter assay. A431 cells were transiently cotransfected with the Np63 promoter constructs and Snail expression vector (Snail (+)) or empty vector (Snail (–); Fig. 2A
). A major basal transcriptional activity was observed in A431 cells, which were transfected with the longer reporter genes (constructs 1 to 3 in Fig. 2A). A responsible element for the clear basal activity was narrowed down between constructs 3 and 4 as indicated in Fig. 2A, although a minor transcriptional activity was still observed in reporter genes lacking the elements (constructs 4 and 5) compared with the shortest TATA-less reporter gene (construct 6). Putative RREB-1, C/EBP, and GATA-1 binding elements were found around 5' of the construct 3 (TFSEARCH1; Fig. 2B). Because the construct 4 containing the intact GATA-1 binding element exhibited only minor transcriptional activity (Fig. 2A), we determine whether the close-by C/EBP binding element or RREB-1 binding element was required for the major basal transcriptional activity. A reporter gene (construct 1) with a mutated element only for C/EBP binding (C/EBP mt construct in Fig. 2B) exhibited significantly lower activity than the wild-type promoter construct in A431 cells (Fig. 2C). These data identify the C/EBP, a member of the C/EBP family of transcription factors, abundantly expressed in keratinocytes and modulates squamous differentiation (31), as a positive regulatory transcriptional factor for the Np63 expression. Indeed, the C/EBP binding to the Np63 promoter was specifically observed in electrophoretic mobility shift assay2 and exogenous C/EBP expression enhanced the major transcriptional activity of the Np63 reporter gene (2.13-fold) but not the C/EBP mt construct (Fig. 2C).
|
Np63 longer reporter genes (constructs 1 to 3 in Fig. 2A) to the extent of the C/EBP-independent minor activities (constructs 4 and 5 in Fig. 2A). Moreover, the minor activity of the C/EBP mt construct failed to be suppressed by coexpressed Snail (Fig. 2C). These data indicate that exogenously expressed Snail exerted its suppressive activity to the Np63 promoter in control of C/EBP.
Because Snail suppresses expression of E-cadherin by its binding to the E-cadherin promoter directly (7, 8), we next determined whether Snail directly controls the C/EBP expression to suppress Np63 expression. Despite that exogenous Snail was able to reduce the C/EBP-dependent transcriptional activity of the Np63 promoter, the abundance of C/EBP in A431 and OM-1 cells was not altered by Snail (Fig. 2D).
The C/EBP abundances in SCC cell lines correlated to Np63 expressions and reversely correlated to EMT phenotype. We next analyzed p63 expression in cells with naturally acquired EMT phenotype by semiquantitative RT-PCR and immunoblotting (Fig. 3
). The cells with EMT showed complete suppression of all transcripts encoded by p63 (Fig. 3). Intriguingly, concomitant reduction of C/EBP was clearly observed in these cells, although cells without the EMT features obviously express both C/EBP and Np63 (Fig. 3). These data suggest that the spontaneous loss of C/EBP in invasive cells accelerated the Np63 reduction instead of Snail mediated the suppression to C/EBP and that Snail might exert its suppressive activity toward E-cadherin.
|
Np63 to tumor invasion, we generated p63 knockdown SCC cell lines. A431 and OM-1 cells displayed slight changes in cell shape, cell-cell adhesion, or cell growth after p63 knockdown (Supplementary Fig. S1A and B). Expression of vimentin was not elevated remarkably by the forced depletion of Np63 in these cells (Supplementary Fig. S3). Under these conditions, E-cadherin expression was observed (Fig. 4A
). To confirm the functional expression of E-cadherin, immunocytochemistry was done. E-cadherin was localized properly on the cell membrane (Fig. 4B). These findings indicate that loss of p63 did not result in EMT.
|
Suppression of the invasiveness by Np63. HOC313 cells exhibited the EMT features and invasiveness in vitro, which is characterized by fibroblastoid shape and scattered growth due to release of cell-cell adhesions (9). Because HOC313 did not express any transcripts despite its intact p63 allele (data not shown), we generated forced Np63-expressing HOC313 cells as a gain-of-function approach. The exogenous Np63 did not affect cell morphology, growth rate, or vimentin expression in HOC313 cells (Supplementary Figs. S2A and B and S3, respectively). E-cadherin expression was not induced by the exogenous Np63 (Fig. 5A
). Therefore, HOC313 cells still show the EMT features even in the reexpression of Np63. However, the number of invading HOC313 cells significantly decreased 0.42-fold in response to the reexpression of Np63 in the Matrigel invasion assay (Fig. 5B). Moreover, most forced Np63-expressing cells were unable to invade the gel layer and formed stratified layers on the collagen gel in in vitro three-dimensional cultures (Fig. 5C). Taken together, these findings indicate that Np63 prevents the invasiveness of SCC cells with the spontaneous EMT phenotype and, conversely, loss of p63 leads to acquisition of an invasive activity regardless of functional E-cadherin expression.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Np63 and that forced depletion of Np63 enhances invasiveness of SCC cell, whereas reexpression of Np63 in Np63-deficient cell suppresses its invasive activity in vitro. Furthermore, the invasive activity caused by the depletion of Np63 does not require down-regulation of E-cadherin and up-regulation of vimentin and vice versa. These findings suggest that loss of Np63 provides an invasive phenotype to SCC cell in parallel with complete EMT.
The molecular mechanism of tumor invasion involves altered interactions between tumor cells and their environment as well as intracellular and intercellular events, such as cell proliferation, loss of cell-cell adhesion, acquisition of cell motility, and loss of cell polarity. How does down-regulation of Np63 acquire an invasive activity in SCC? In our data, Np63-deficient SCC cells formed a single layer on the collagen gel and invaded into the gel layer in in vitro three-dimensional cultures. During development of the epidermis, Np63 is expressed during a late stage of the single-layered surface ectoderm and allows basal keratinocytes to commit to epidermal maturation and terminal differentiation (32). p63–/– mice have striking developmental defects, including complete lack of all stratified squamous epithelia, epidermal appendages, and mammary, lacrimal, and salivary glands (19, 20), which suggests that p63 plays fundamental roles in formation of epithelial structures. The fact that ectoderm extends epithelial sheets to form buds into the mesoderm during development of epidermal appendages and derivative organs (33) seems to contradict our present results; however, extended epithelial sheets or buds maintain the stratified epithelial structure. The localized expression of Np63 in basal keratinocytes strongly suggests its role in formation of stratified squamous epithelial structures by regulating asymmetrical division (34). Polarity of epithelial cells directs the apical basal and planar axes and plays crucial roles for cell-cell adherens and tight junctions and asymmetrical cell division (35). We speculate that down-regulation of Np63 occurs in SCC cells at the invasive front, which may cause loss of cell polarity, and loss of cell polarity then promotes invasion into the adjacent connective tissue.
Because p63 is a member of the p53 family, many studies of p63 functions have been reported; nonetheless, the role of p63 in tumors is not well understood (reviewed in ref. 22). Fluorescent in situ hybridization analysis revealed frequent amplification of the p63 locus in primary SCC of the lung and head and neck cancer cell lines (36). Recently, a genome-wide microarray analysis revealed that the 3q26-29 locus encompassing p63 is frequently amplified in SCCs of the lung, suggesting that overexpression of p63 facilitates tumorigenesis (37). Barbieri et al. (38) reported that microarray analysis identified genes associated with invasion and metastasis due to loss of p63 in keratinocytes. Loss of p63 caused down-regulation of cell adhesion–associated genes, cell detachment, and anoikis in mammary epithelial cells and keratinocytes (39). Furthermore, Np63 expression is directly correlated with the clinical response to cisplatin in SCCs of head and neck (40). These reports indicate that varied levels of Np63 expression might decide cell fate. Our present study provides enforced evidence that loss of p63 directly involves tumor invasion. Taken together, these reports and our novel findings suggest that the overexpression of Np63 might involve tumorigenesis of keratinocyte, and its suppression by Snail during progression of SCC leads to the tumor invasion.
Figure 6
here shows the schematic representation of our novel findings, indicating that Snail down-regulates Np63 via suppression of C/EBP-dependent transcription, leading to acquisition of an invasive phenotype, in parallel with down-regulation to E-cadherin. Reduction of C/EBP itself also results in loss of Np63. During progression of SCC toward a more malignancy, Snail is expressed as an initial event and then down-regulates both E-cadherin, resulting in the EMT features, and Np63, resulting in acquisition of the invasiveness. The precise mechanism by which loss of Np63 exerts the invasiveness or Snail interferes in the C/EBP-dependent Np63 expression remains defined and we currently investigate these issues. However, our results might provide a new strategy for therapeutics for progressive SCC through the modulation of Np63 expression.
|
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Fumiko Higashikawa for critical discussion and encouragement.
|
Footnotes |
|---|
1 http://mbs.cbrc.jp/research/db/TFSEARCH.html 
2 Higashikawa et al., unpublished data.
Received 3/ 9/07. Revised 7/23/07. Accepted 7/30/07.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Np63 levels correlate with clinical tumor response to cisplatin. Cell Cycle 2005;4:1313–5.[Medline]This article has been cited by other articles:
|
|
 |
|
  R. Kommagani, M. K. Leonard, S. Lewis, R.-A. Romano, S. Sinha, and M. P. Kadakia Regulation of VDR by {Delta}Np63{alpha} is associated with inhibition of cell invasion J. Cell Sci., August 15, 2009; 122(16): 2828 - 2835. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
