Cancer Research CR Surrogates  Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 67, 9322, October 1, 2007. doi: 10.1158/0008-5472.CAN-07-1743
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paliwal, S.
Right arrow Articles by Grossman, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paliwal, S.
Right arrow Articles by Grossman, S. R.

Cell, Tumor, and Stem Cell Biology

The Alternative Reading Frame Tumor Suppressor Antagonizes Hypoxia-Induced Cancer Cell Migration via Interaction with the COOH-Terminal Binding Protein Corepressor

Seema Paliwal1, Ramesh C. Kovi1, Bharath Nath1, Ya-Wen Chen3, Brian C. Lewis3,4 and Steven R. Grossman1,2,4

Departments of 1 Cancer Biology and 2 Medicine; 3 Program in Gene Function and Expression; 4 Gastrointestinal Cancer Program, University of Massachusetts Medical School and UMass Memorial Cancer Center, Worcester, Massachusetts

Requests for reprints: Steven R. Grossman, Department of Cancer Biology, University of Massachusetts Medical School, 364 Plantation Street, Worcester, MA 01605. Phone: 508-856-6423; Fax: 508-856-1699; E-mail: steven.grossman{at}umassmed.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The alternative reading frame (ARF) tumor suppressor exerts both p53-dependent and p53-independent activities critical to the prevention of cancer in mice and humans. Recent evidence from mouse models suggests that when p53 is absent, further loss of ARF can widen the tumor spectrum, and potentiate invasion and metastasis. A major target of the p53-independent activity of ARF is the COOH-terminal binding protein (CtBP) family of metabolically regulated transcriptional corepressors, which are degraded upon acute exposure to the ARF protein. CtBPs are activated under conditions of metabolic stress, such as hypoxia, to repress epithelial and proapoptotic genes, and can mediate hypoxia-induced migration of cancer cells. The possibility that ARF could suppress tumor cell migration as part of its p53-independent activities was thus explored. Small-interfering RNA (siRNA)–mediated knockdown of ARF in human lung carcinoma cells led to increased cell migration, especially during hypoxia, and this effect was blocked by concomitant treatment with CtBP2 siRNA. Introduction of ARF into p53 and ARF-null human colon cancer cells inhibited hypoxia-induced migration. Furthermore, overexpression of CtBP2 in ARF-expressing cells enhanced cell migration, and an ARF mutant defective in CtBP-family binding was impaired in its ability to inhibit cell migration induced by CtBP2. ARF depletion or CtBP2 overexpression was associated with decreased PTEN expression and activation of the phosphatidylinositol 3-kinase pathway, and a phosphatidylinositol 3-kinase inhibitor blocked CtBP2-mediated cell migration. Thus, ARF can suppress cell migration by antagonizing CtBP2 and the phosphatidylinositol 3-kinase pathway, and these data may explain the increased aggressiveness of ARF-null tumors in mouse models. [Cancer Res 2007;67(19):9322–9]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Of the many physiologic barriers that must be overcome in the process of tumor invasion and metastasis (1), an obvious prerequisite is the need for cell movement (2, 3). In many settings, tumor hypoxia is a critical stimulus for cancer cell migration (4). The mechanism by which hypoxia activates cell migration is complex, and depending on context, activation of either or both the hypoxia-inducible factor transcription factor (4) and the COOH-terminal binding protein 1 (CtBP1) transcription corepressor (5) may be involved.

Like hypoxia-inducible factor, the CtBP corepressors (CtBP1 and CtBP2) directly sense and respond to the intracellular metabolic changes that accompany hypoxia. They encode a regulatory dehydrogenase domain that recognizes NADH, which can accumulate during hypoxia (6). NADH binding, in turn, activates the corepressor activity of CtBP at target promoters (7, 8). Notably, CtBP1-mediated stimulation of hypoxia-induced cancer cell migration may be due, in part, to repression of epithelial adhesion genes such as E-cadherin (5).

CtBP2 is a target for inhibition by the alternative reading frame (ARF) tumor suppressor, where via direct interaction, ARF relocalizes it to the nucleolus promoting its proteasome degradation (9). Although ARF was first described as an activator of the p53 pathway via inactivation of MDM2 (10, 11), recent evidence has also suggested that it exerts p53-independent effects (reviewed in ref. 12). These p53-independent effects of ARF are seen in mouse p53/Arf double-knockout models as a broadened tumor spectrum that includes epithelial tumors (1315), and in transgenic oncogene models for skin and brain cancer, as a potentiation of invasion and metastasis (16, 17).

Mouse ARF can regulate cell migration via a presumed p53-dependent mechanism in mouse embryo fibroblasts (MEF; ref. 18). Based on its physical and functional interaction with CtBP1/2, and the ability of CtBP1 to promote hypoxic cell migration, we investigated whether human ARF could regulate tumor cell migration, in hypoxia or normoxia, independent of p53. Knockdown of endogenous ARF in lung cancer cells lacking p53 function caused increased migratory behavior, especially under hypoxic conditions. Restoration of ARF expression in ARF-null/p53-null colon cancer cells blocked migration induced by hypoxia. Consistent with a direct role for CtBP1 in stimulating migration, simultaneous CtBP2 knockdown reversed the induction of migration seen with ARF knockdown, whereas CtBP2 overexpression induced migratory behavior in cells expressing ARF. ARF inhibition of CtBP2-induced migration required an intact CtBP interaction domain on ARF, demonstrating that ARF/CtBP2 interaction is required to attenuate tumor cell migration. ARF depletion or CtBP2 overexpression was associated with decreased PTEN levels and activation of phosphatidylinositol 3-kinase and the motility-associated rac1 GTPase. ARF/CtBP2 interaction thus affects cell migration via the phosphatidylinositol 3-kinase pathway, suggesting a novel mechanism for p53-independent tumor suppression by ARF.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and transfections. Human H1299 (lung carcinoma; p53 null) cells were cultured in complete DMEM. HCT116 human colon cancer cells (ARF silenced) with targeted deletion of p53 (19) were grown in McCoy's medium. Medium was supplemented with 10% fetal bovine serum and 100 units/mL penicillin and incubated in humidified 5% CO2 at 37°C. Expression plasmids were transfected using Fugene (Roche), and small interfering RNA (siRNA) duplexes were transfected with Oligofectamine (Invitrogen). The siRNA concentration used for transfection was 40 nmol/L, except where noted. The siRNA sequence for human CtBP2 (hCtBP2) was AAGCGCCUUGGUCAGUAAUAG and for human ARF was AAAUCAGGUAGCGCUUCGAUU. Nontargeting control siRNA (IX) was from Dharmacon. CtBP2- or CtBP2 mutant–expressing stable H1299 cells were generated using geneticin selection.

Plasmids. V5-tagged CtBP2 expression plasmid Pc-V5CtBP2 has been described (9). Pc-T7ARF was generated by insertion of a PCR-amplified ARF coding sequence with a T7 tag sequence embedded in the 5' primer into pCDNA3. The expression plasmid containing the NADH-binding defective allele (G189A) of CtBP2 was generated from Pc-V5CtBP2 using PCR as per the QuikChange protocol (Stratagene).

Antibodies and Western blotting. Antibodies used were as follows: CtBP2 (BD Transduction Laboratories), hARF (AbCam), V5 tag (Invitrogen), T7 tag (Novagen), glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Advanced Immunochemical), phosphorylated Akt (p-Akt), total Akt, and PTEN (Cell Signaling). Anti-rabbit IgG–horseradish peroxidase and anti-mouse IgG-horseradish peroxidase conjugates (Amersham) were used with enhanced chemiluminescence detection (Amersham) for Western blotting.

Cell motility and migration assays. For wound assays, equal numbers of cells were plated at 50% confluency in six-well plates, and 24 h after plating, the cells were transfected with either siRNA or expression plasmids. Twenty-four hours after transfection, the confluent monolayer of cells was scraped to introduce a wound, and the cells were incubated under either normoxic or hypoxic (0.1% O2) conditions for another 24 h. Captured images were used to compare and quantify the mean relative migration distances by measuring the migration distance of cells found in the cleared area from the point the cells were scraped to the migration front in inches in five independent x100 fields per experiment as described (18) and normalizing the values to the negative control set at 1 for each experiment. Each experiment was conducted in triplicate, and SD from the mean migration distance among the three experiments was calculated. P values to establish 95% confidence intervals were calculated by Student's t test. For transwell migration assays, H1299 cells were transfected with either control or ARF siRNA, and 24 h later, 2.5 x 104 cells were plated in 0.5 mL of serum-free DMEM into inserts (BD) and the inserts were placed in wells with 0.75 mL of DMEM with serum. Cells were then incubated under hypoxic or normoxic conditions for 24 h, fixed with methanol for 10 min at room temperature, and stained with Giemsa stain for 50 min. The membranes were removed from the inserts and mounted on glass slides. Cells found within a total of 10 x400 microscopic fields per insert were counted and the experiment was done in triplicate.

Phosphatidylinositol 3-kinase inhibitor assay. H1299 cells stably expressing CtBP2 and exposed to 24 h of hypoxia were treated with 20 µmol/L LY294002 (Sigma) or vehicle (DMSO) alone for 10 h before migration distance was measured by wound assay.

Endogenous Rac GTPase activity assay. Endogenous Rac1-GTP activity in control and ARF-siRNA treated H1299 cell lysates exposed to hypoxia for 24 h was determined by glutathione S-transferase (GST)-PAK1 interaction analysis as described (18). The amount of total input and GST-PAK1–bound Rac1 was determined by Western blotting with anti-Rac1 antibody (UBI/Millipore).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Loss of ARF results in increased cell migration in normoxia and hypoxia. Based on the promotion of cell migration by the ARF target CtBP1 (5, 9), the effect of ARF on cell migration was investigated by siRNA-mediated inhibition of endogenous ARF expression in human lung carcinoma cells (H1299) followed by migration assay. As hypoxia was previously reported to be a potent stimulus of CtBP1-mediated cell migration (5), migration assays were done under both normoxic and hypoxic (0.1% O2) conditions. H1299 cells were transfected with either control or human ARF siRNA, the confluent cell monolayer was scraped to mimic a wound, and the average migration distance of cells into the cleared area created by the wound was determined 24 h after scraping.

As expected (9), CtBP2 protein levels were increased in cells with ARF knockdown under hypoxic or normoxic conditions (Fig. 1A ). ARF siRNA–treated normoxic cells migrated 4-fold more compared with the control siRNA–treated cells (P = 0.03; Fig. 1B and C). Thus, ARF negatively regulates cell migration. Whereas hypoxia alone only marginally enhanced the migration of control siRNA-treated H1299 cells (~2-fold, but P = 0.12), ARF knockdown under hypoxic conditions caused an almost 6-fold increase in migration compared with the migration observed in hypoxic control siRNA–treated cells (P = 0.02; Fig. 1B and C). Qualitatively similar results were obtained when the assay was done with the same cells and conditions using migration through a porous filter as the assay for migration instead of a wounding assay (Fig. 1D). In this case, the marginal induction of migration by hypoxia in control siRNA–treated cells did achieve significance (P = 0.01). As a result of the higher baseline migration of hypoxic control cells in this assay, the induction of migration by ARF was quantitatively smaller than observed by wound assay (2-fold) but remained significant (P = 0.002). Thus, ARF inhibition and hypoxia synergistically enhance cell migration in H1299 cells.


Figure 1
View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Loss of ARF results in increased cell migration. H1299 cells were transfected with control (Con) or ARF siRNA and cultured to confluency. Cells were scraped to create a wound and incubated in either normoxic or hypoxic (0.1% O2) conditions for 24 h. A, levels of CtBP2, ARF, and GAPDH (loading control) were determined by Western blot analysis. N, normoxia; H, hypoxia; Con, control. B, a phase-contrast photomicrograph of a representative low-power field (x100) is shown for each experimental condition. C, migration distances were determined as described in Materials and Methods. Each experiment was conducted in triplicate. Bars, ±1 SD. D, ARF inhibits cell migration in H1299 cells. The migration activity of H1299 cells transfected with control or ARF siRNA and cultured under hypoxic or normoxic conditions for 24 h was measured using a transwell migration assay. Each experiment was done in triplicate and the data represent an average from three independent experiments. Bars, ±1 SD. The cell number is the average number of migrated cells per field from 10 x400 microscopic fields per insert. *, P < 0.05; **, P < 0.01 for the comparison of values within the normoxic or hypoxic groups.

 
Exogenous ARF suppresses hypoxia-induced cell migration. To determine if the effect of ARF knockdown was a specific and direct effect of a change in ARF expression alone, normoxic or hypoxic ARF-null HCT116;p53–/– colon cancer cells (19) were transduced with ARF-expressing or control retroviruses, and a migration assay was done. Of note, significant apoptosis, as determined by direct observation for morphologic changes of apoptosis and loss of cell viability, was not observed in cells expressing ARF (Fig. 2B and data not shown). ARF expression in the transduced cells was confirmed by immunoblot (Fig. 2A). Of note, cells expressing ARF exhibited lower levels of CtBP2, as expected (ref. 9; Fig. 2A).


Figure 2
View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. ARF expression blocks migration. HCT116;p53–/– (ARF-null) cells were infected with a retrovirus expressing ARF or an empty vector control retrovirus as indicated. Twenty-four hours after infection, a monolayer wound was introduced and cells were incubated a further 24 h in either hypoxic or normoxic conditions. A, levels of CtBP2, ARF, and GAPDH (loading control) were determined by Western blot analysis. B, phase-contrast photomicrographs of representative x100 fields are shown from each experimental condition. C, average migration distances were calculated and displayed as noted in Fig. 1. Each experiment was done in triplicate. Bars, ±1 SD. *, P < 0.05 for comparisons within normoxic and hypoxic groups; {dagger}, P < 0.05 for the comparison between control (vector-expressing) hypoxic and normoxic cells.

 
As opposed to H1299 cells, HCT116;p53–/– cells transduced with control retrovirus exhibited a significant induction of migration (2.5-fold) in response to hypoxia (P = 0.02; Fig. 2B and C), suggesting that the ability of cells to exhibit hypoxia-induced migration may be correlated with their ARF expression status. With exogenous ARF expression, migration of these cells was reduced 2-fold compared with control virus-transduced cells under normoxic conditions (P = 0.04), and 10-fold under hypoxic conditions (P = 0.01; Fig. 2B and C). Because the HCT116 cells used in these experiments were p53-null, the ARF effect on cell migration was p53-independent, as was seen in the p53-defective H1299 cells. Moreover, the effect of ARF expression on cell migration was exactly as predicted by the results of ARF knockdown in H1299 cells, suggesting that ARF, itself, is a potent inhibitor of cell migration, especially under hypoxic conditions.

CtBP2 is required for the induction of migration by ARF silencing. To support the hypothesis that ARF suppresses cell migration by negative regulation of CtBP proteins, H1299 cells were assayed for migration after CtBP2 and ARF were depleted separately or together, under both normoxic and hypoxic conditions (Fig. 3 ). ARF and CtBP2 knockdown by their respective siRNAs was confirmed by immunoblot, although the knockdown of ARF achieved in this set of experiments was not as robust as observed in the experiment detailed in Fig. 1 (Fig. 3A). Under normoxic conditions, ARF depletion caused a near significant (P = 0.06) but only 2-fold increase in migration, likely reflecting the effect of only partial knockdown as noted above (Fig. 3B and C). Notably, CtBP2 or combined ARF/CtBP2 knockdown also caused minor increases in migration as well (P = 0.01 for both; Fig. 3B and C), suggesting that the effects of ARF depletion on cell migration in normoxia cannot necessarily be accounted for by a mechanism involving modulation of CtBP2 function.


Figure 3
View larger version (47K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. CtBP2 requirement for cell migration induced by acute silencing of ARF. H1299 cells transfected with control, ARF, CtBP2, or ARF and CtBP2 siRNA (20 nmol/L each siRNA per transfection) were assayed for cell migration using a wound-healing assay as in Fig. 1. A, levels of CtBP2, ARF, and GAPDH (loading control) were determined by Western blot analysis. B, phase-contrast photomicrographs of representative x100 fields from each experimental condition. C, average migration distances were calculated and displayed as noted in Fig. 1. Each experiment was done in triplicate. Bars, ±1 SD. *, P < 0.05; **, P < 0.01 for comparisons of the indicated values with the control siRNA treatment within normoxic and hypoxic groups.

 
Under hypoxic conditions, however, ARF knockdown dramatically increased cell migration (12-fold; P = 0.003; Fig. 3B and C) as expected. When ARF and CtBP2 were simultaneously silenced, cell migration was reduced almost back to baseline levels (Fig. 3B and C). Migration of hypoxic cells with CtBP2 knockdown alone was also similar to that seen with control siRNA treatment (Fig. 3B and C). Thus, the increase in hypoxic cell migration seen as a result of ARF depletion was reversed by simultaneous CtBP2 depletion, consistent with the idea that the two proteins lie in a linear regulatory pathway, with ARF placed upstream of CtBP2 in the control of cell migration.

Stimulation of cell migration by CtBP requires an intact NADH binding domain. If hypoxic cell migration is abrogated by ARF via its interaction with CtBPs, then raising the level of cellular CtBP should override any inhibitory effects of ARF and induce migration. To test the effect of CtBP2 overexpression on cell migration, control or wild-type V5-tagged CtBP2 cDNA expression vectors incorporating a G418-selectable marker were transfected into (endogenous) ARF-expressing H1299 cells, and pooled G418-resistant cells were isolated. A V5 immunoblot of cell lysates confirmed the expression of V5-CtBP2 in the relevant pool of cells (Fig. 4C ). Under normoxic conditions, CtBP2-expressing H1299 cells showed an ~10-fold induction in migration over control cells (P = 0.01), and under hypoxic conditions CtBP2 overexpression caused a similar 7-fold induction in migration (P = 0.003; Fig. 4A and B). Although the fold induction of migration by CtBP2 was lower in hypoxia due to a higher baseline, the absolute level of migration induced by CtBP2 was 2-fold higher in hypoxia than normoxia (P = 0.01). These results show that CtBP2 potently promotes cell migration even in the setting of endogenous ARF expression, and that hypoxic conditions are not necessary for, but strongly promote, CtBP2-dependent migration.


Figure 4
View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. NADH binding and ARF interaction modulate CtBP2-induced cell migration. A to C, monolayers of H1299 cells stably expressing empty vector (Pc), V5-CtBP2, or the NADH-binding defective allele V5-CtBP2-G189A were wounded and incubated in hypoxic or normoxic conditions for 24 h. A, phase-contrast photomicrographs of representative x100 fields from each experimental condition. B, average migration distances were calculated and displayed as noted in Fig. 1. Bars, ±1 SD. {dagger}, P < 0.05 for the comparison between CtBP2-expressing hypoxic and normoxic cells. C, V5, ARF, and GAPDH immunoblots. D, top, H1299 cells stably expressing V5-CtBP2 were transfected with vector, T7-ARF, or T7-ARF-L50D (CtBP-binding defective) expression vectors, and cell migration distance was determined, as noted in Fig. 1, 24 h after monolayer wounding with incubation under normoxic or hypoxic conditions; bottom, T7 immunoblot of cell lysates from each transfection demonstrating T7-ARF and T7-ARFL50D expression. Migration distances were normalized to the migration of cells in the negative control, which was vector transfected (stably in A and B or transient in D normoxic cells). Each experiment was done in triplicate. Bars, ±1 SD. *, P < 0.05; **, P < 0.01 for comparisons of the indicated values with the control treatment within the normoxic or hypoxic groups.

 
Given the ability of CtBPs to sense the cellular metabolic state via NADH interaction, a CtBP2 mutant unable to recognize NADH (CtBP2-G189A) was tested for its ability to induce migration (6, 8, 20). A pool of V5-CtBP2-G189A stably expressing H1299 cells was established, and the expression of V5-CtBP2-G189A was comparable with that of wild-type V5-CtBP2 (Fig. 4C). Compared with control cells, V5-CtBP2-G189A–expressing cells were significantly defective for migration under normoxic conditions, and only marginally migratory under hypoxic conditions (2-fold over control, P = 0.03; Fig. 4A and B). Moreover, they migrated 3-fold less than V5-CtBP2–expressing cells under both normoxic and hypoxic conditions (Fig. 4A and B). Thus, NADH interaction with CtBP2, and presumably activation of repressor function (8), significantly contributes to CtBP2-dependent cell migration.

ARF negates CtBP-driven cell migration in a manner dependent on CtBP interaction. Given that (human) ARF inhibits CtBP family function via targeting it for degradation (9), a CtBP-binding defective ARF mutant with a mutation of conserved leucine-50 to aspartate (ARF-L50D; ref. 9) was tested for its ability to suppress CtBP2-induced cell migration in H1299 cells. Pooled G418-resistant H1299 cells stably expressing V5-CtBP2 were transfected with vector, T7-ARF, or T7-ARFL50D expression vectors, followed by cell migration analysis under normoxic or hypoxic conditions (Fig. 4D). Morphologic analysis of T7-ARF– or T7-ARFL50D–transfected cells at the time point used for migration analysis revealed no changes consistent with apoptosis or loss of cell viability (data not shown). Equivalent expression of T7-tagged ARF and ARFL50D was confirmed by T7 immunoblot (Fig. 4D).

When ARF was expressed in CtBP2-expressing H1299 cells, suppression of migration under normoxic (2-fold; P = 0.05), and especially, hypoxic (5-fold; P = 0.007) conditions, was observed (Fig. 4D). In contrast, ARFL50D was defective for suppressing cell migration in normoxic CtBP2-expressing cells, and exhibited only marginal (1.6-fold; P = 0.02) inhibition of migration in hypoxic cells (Fig. 4D). Thus, a potential for CtBP-family interaction is required for ARF-mediated suppression of CtBP2-induced migration.

ARF and CtBP effects on cell migration are mediated via the phosphatidylinositol 3-kinase pathway. To determine the molecular mechanism by which ARF and CtBP2 were modulating cell migration, the potential effect of ARF depletion or CtBP2 overexpression on the activity of the phosphatidylinositol 3-kinase pathway, a major regulator of cell migration (21), was studied. Notably, microarray analysis of CtBP1/2 knockout MEFs revealed that expression of the phosphatidylinositol 3-kinase–negative regulator PTEN (21) was increased relative to its expression in matched wild-type MEFs (22), suggesting that CtBPs may normally repress PTEN transcription. Vector, V5-CtBP2, or V5-CtBP2-G189A stably expressing H1299 cells exposed to normoxia or hypoxia were assayed for expression and activity of phosphatidylinositol 3-kinase pathway components (Fig. 5A ). As a measure of activity of the pathway, levels of phosphatidylinositol 3-kinase activated p-Akt were dramatically higher in CtBP2-expressing cells under hypoxic conditions (Fig. 5A). Otherwise, p-Akt was undetectable in normoxic cells under all conditions, and in hypoxic control cells or hypoxic cells expressing mutant CtBP2 lacking NADH binding activity (Fig. 5A).


Figure 5
View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Role of the phosphatidylinositol 3-kinase pathway in regulation of cell migration by ARF and CtBP2. A, effect of CtBP2 overexpression on PTEN expression and phosphatidylinositol 3-kinase activity. H1299 cells stably expressing vector alone, V5-CtBP2, or V5-CtBP2-G189A were grown under normoxic or hypoxic conditions and 24 h later the relative amounts of total Akt and p-Akt (S473), PTEN, V5-CtBP2, and GAPDH in the cell lysates were determined by Western blotting. B, effect of phosphatidylinositol 3-kinase inhibitor on CTBP2-mediated cell migration in a wound assay. H1299 cells stably expressing V5-CtBP2 were treated with 20 mmol/L LY294002 or DMSO for 10 h before the migration distances were measured. Each experiment was done in triplicate. Bars, ±1 SD. **, P < 0.01. C, effect of ARF silencing on PTEN expression and phosphatidylinositol 3-kinase pathway activity. H1299 cells transfected with either control or ARF siRNA were grown under hypoxic conditions, and 24 h later, the levels of total and p-Akt (S473), PTEN, ARF, and GAPDH in the cell lysates were determined by Western blotting. D, analysis of Rac activation after ARF silencing. Endogenous Rac1 activity in siARF-treated H1299 cells was assayed by incubating the cells under normoxic or hypoxic conditions for 24 h followed by capture of active Rac1-GTP complexes in cell lysates by GST-PAK1 pulldown. Levels of total Rac1 (10% of the amount used for pulldowns) and Rac1 bound in the GST-PAK1 pulldowns were then analyzed by anti-Rac1 immunoblot.

 
To understand the potential mechanism for p-Akt activation in these cells, PTEN protein levels were analyzed. PTEN was decreased (~2-fold by densitometric analysis) in cells expressing CtBP2 under hypoxic conditions, with no change noted in normoxic cells or hypoxic cells expressing mutant CtBP2 (Fig. 5A). Thus, consistent with microarray data obtained from MEFs (22), overactive CtBP2 caused decreased PTEN levels, which is correlated in these cells with activation of phosphatidylinositol 3-kinase activity.

To determine the functional significance of phosphatidylinositol 3-kinase activation for CtBP2-mediated migration, hypoxic CtBP2-expressing H1299 cells were treated with vehicle or the specific phosphatidylinositol 3-kinase inhibitor LY294002, followed by migration assay (Fig. 5B). Phosphatidylinositol 3-kinase inhibition resulted in an ~60% inhibition of migration (P = 0.009) of these cells, indicating that phosphatidylinositol 3-kinase activity plays a key role in their migratory behavior.

As ARF regulates the migration of hypoxic cells in a manner dependent on physiologic levels of CtBP2 (Fig. 3) and an intact CtBP interaction domain (Fig. 4), the effect of ARF silencing on phosphatidylinositol 3-kinase activity and PTEN levels in hypoxic H1299 cells was investigated (Fig. 5C). As seen with CtBP2 overexpression, silencing of endogenous ARF in H1299 cells with siRNA resulted in a profound reduction in PTEN levels, and increased p-Akt (~2-fold by densitometric analysis). Thus, relief of ARF suppression of CtBPs with ARF siRNA results in a reduction in PTEN expression and activation of phosphatidylinositol 3-kinase.

As phosphatidylinositol 3-kinase regulates numerous cellular functions, including growth, movement, and survival, the specific effect of ARF depletion on a downstream effector of phosphatidylinositol 3-kinase regulation of cell movement, the rac1 small GTPase (23), was determined (Fig. 5D). H1299 cells treated with control or ARF siRNA were exposed to hypoxic conditions and cell lysates were analyzed for evidence of rac GTPase activation via the ability of GST-fused Pak1 kinase to capture active rac1 (rac1-GTP) molecules in a pulldown assay (18). As compared with control siRNA-treated cells, ARF depletion resulted in the robust induction of activated rac1-GTP (Fig. 5D), consistent with the activation of phosphatidylinositol 3-kinase (Fig. 5C) and the induction of migration seen in H1299 cells after ARF silencing (Fig. 1).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The physiologic mechanism(s) of p53-independent ARF tumor suppression remain obscure. Prior in vitro work in various cell systems has shown that ARF can induce either growth arrest or apoptosis, depending on context, in cells lacking p53 (9, 24, 25). More recently, ARF has been associated with tumor aggressiveness and tumor progression in various model systems (16, 17). In this report, we show that in a variety of epithelial cancer cell lines defective for p53 activity, ARF can block cell migration, a necessary property, among others, for neoplastic invasion and metastasis (2, 3). The effect of ARF was most robustly observed under hypoxic conditions, in which cells are induced to migrate through activation of (at least) the CtBP1 corepressor (5). As ARF is an inhibitor and direct binding partner of CtBPs, we showed that its inhibition of migration depended on its ability to interact with CtBPs. Mechanistically, CtBP2 could repress PTEN, correlating with activation of phosphatidylinositol 3-kinase, a major mediator of cell motility in transformed cells (21). ARF silencing also caused phosphatidylinositol 3-kinase activation and increased activity of the rac1 GTPase, a major effector of phosphatidylinositol 3-kinase effects on cell motility (23).

The CtBP corepressors have been directly implicated in two pro-oncogenic cell autonomous functions, namely survival and hypoxia-induced migration (5, 22). Some reports have also suggested that CtBPs can mediate an epithelial-mesenchymal transition (22, 26). The structure of CtBPs make them well suited to respond to environmental cues that alter cell metabolism, such as hypoxia, as they encode a vestigial dehydrogenase that senses the NADH/NAD+ ratio in cells, with increased NADH causing up-regulation of corepressor function (27). In this report, NADH binding was required for CtBP2-induced cell migration whether in normoxia or hypoxia, likely reflecting the loss of NADH-dependent corepressor activity induced by this mutation (28).

We have previously reported that acute expression of ARF can induce apoptosis in ARF/p53-null HCT116 cells (9). Under the higher cell density conditions used for the migration analysis, appreciable apoptosis and loss of viability were not observed in the same cells exposed to ARF via retroviral transduction (Fig. 2). Previous experiments (9) were done with cell densities well below confluency at all steps. However, for reasons that remain unclear, the proapoptotic effect of ARF wanes considerably in HCT116;p53–/– cells as they approach confluency,5 explaining the lack of apoptosis seen on ARF expression in the current experiments.

Although the antiapoptotic function of CtBPs rely on their ability to repress the transcription of proapoptotic BH3-only proteins (e.g., noxa, puma; ref. 22), the transcriptional targets involved in its regulation of cell migration are not well understood. E-cadherin repression by CtBP1 (5, 22) could certainly foster a permissive environment for cell migration, but further stimuli are needed that will ultimately activate small GTPases, such as rac and rho, and cause the necessary cytoskeletal reorganization associated with migration (23, 29). Notably, PTEN was also found in the prior microarray analysis of CtBP1/2-repressed genes (22), and could mediate, in part, CtBP-family effects on migration via activation of the phosphatidylinositol 3-kinase pathway (21, 30), as is now supported by our data in a human lung cancer cell line. The PTEN promoter contains a number of sites for the basic Kruppel-like factor transcription factor,6 which in other promoters, can recruit CtBPs to chromatin, and mediate CtBP-family transcriptional repression (31). Our data are also consistent with previous reports showing that Arf-null (p53 wild-type) MEFs showed increased phosphatidylinositol 3-kinase and rac1 activity, along with actin cytoskeletal reorganization and increased motility, compared with their wild-type counterparts (18).

Given that hypoxia has been proposed as one stimulus that drives the malignant progression of tumors (4), our data suggest a mechanism by which ARF could act at an early hypoxia-dependent step in tumor progression, in a p53-independent manner. The promotion of hypoxic cell migration by ARF inactivation may also serve as a potent selective force for the epigenetic silencing of ARF expression early in tumorigenesis. Indeed, analysis of a p53 and Arf doubly null mouse hepatocellular cancer model suggests that Arf can block both migration and invasion in vitro in a p53-independent and CtBP2-dependent manner, consistent with a tumor-suppressive activity at an early step(s) in the invasion/metastasis sequence.7 Further careful analysis and correlation of ARF and CtBP1/2 expression in human tumors may thus yield significant correlations with tumor aggressiveness and prognosis.


    Acknowledgments
 
Grant support: Howard Temin Award (S.R. Grossman; K01-CA89548); a Fellowship from the Our Danny Cancer Fund (S. Paliwal); and a Career Development Award in the Biomedical Sciences from the Burroughs Wellcome Fund and a Liver Scholarship Award from the American Liver Foundation (B.C. Lewis).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    Footnotes
 
5 S. Paliwal, S.R. Grossman, unpublished observations. Back

6 R. Kovi, S. Paliwal, and S.R. Grossman, unpublished observations. Back

7 Y-W. Chen, S. Paliwal, S.R. Grossman, and B. Lewis, unpublished observations. Back

Received 5/11/07. Revised 7/17/07. Accepted 7/20/07.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gupta PB, Mani S, Yang J, Hartwell K, Weinberg RA. The evolving portrait of cancer metastasis. Cold Spring Harb Symp Quant Biol 2005;70:291–7.[CrossRef][Medline]
  2. Yamaguchi H, Wyckoff J, Condeelis J. Cell migration in tumors. Curr Opin Cell Biol 2005;17:559–64.[CrossRef][Medline]
  3. Kopfstein L, Christofori G. Metastasis: cell-autonomous mechanisms versus contributions by the tumor microenvironment. Cell Mol Life Sci 2006;63:449–68.[CrossRef][Medline]
  4. Bernards R. Cancer: cues for migration. Nature 2003;425:247–8.[CrossRef][Medline]
  5. Zhang Q, Wang SY, Nottke AC, Rocheleau JV, Piston DW, Goodman RH. Redox sensor CtBP mediates hypoxia-induced tumor cell migration. Proc Natl Acad Sci U S A 2006;103:9029–33.[Abstract/Free Full Text]
  6. Kumar V, Carlson JE, Ohgi KA, et al. Transcription corepressor CtBP is an NAD(+)-regulated dehydrogenase. Mol Cell 2002;10:857–69.[CrossRef][Medline]
  7. Balasubramanian P, Zhao LJ, Chinnadurai G. Nicotinamide adenine dinucleotide stimulates oligomerization, interaction with adenovirus E1A and an intrinsic dehydrogenase activity of CtBP. FEBS Lett 2003;537:157–60.[CrossRef][Medline]
  8. Zhang Q, Piston DW, Goodman RH. Regulation of corepressor function by nuclear NADH. Science 2002;295:1895–7.[Abstract/Free Full Text]
  9. Paliwal S, Pande S, Kovi RC, Sharpless NE, Bardeesy N, Grossman SR. Targeting of C-terminal binding protein (CtBP) by ARF results in p53-independent apoptosis. Mol Cell Biol 2006;26:2360–72.[Abstract/Free Full Text]
  10. Kamijo T, Zindy F, Roussel MF, et al. Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19ARF. Cell 1997;91:649–59.[CrossRef][Medline]
  11. Quelle DE, Zindy F, Ashmun RA, Sherr CJ. Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell 1995;83:993–1000.[CrossRef][Medline]
  12. Sherr CJ. Divorcing ARF and p53: an unsettled case. Nat Rev Cancer 2006;6:663–73.[CrossRef][Medline]
  13. Sharpless NE. INK4a/ARF: a multifunctional tumor suppressor locus. Mutat Res 2005;576:22–38.[Medline]
  14. Sharpless NE, Ramsey MR, Balasubramanian P, Castrillon DH, DePinho RA. The differential impact of p16(INK4a) or p19(ARF) deficiency on cell growth and tumorigenesis. Oncogene 2004;23:379–85.[CrossRef][Medline]
  15. Kamijo T, Bodner S, van de Kamp E, Randle DH, Sherr CJ. Tumor spectrum in ARF-deficient mice. Cancer Res 1999;59:2217–22.[Abstract/Free Full Text]
  16. Kelly-Spratt KS, Gurley KE, Yasui Y, Kemp CJ. p19Arf suppresses growth, progression, and metastasis of Hras-driven carcinomas through p53-dependent and -independent pathways. PLoS Biol 2004;2:E242.[CrossRef][Medline]
  17. Tchougounova E, Kastemar M, Brasater D, Holland EC, Westermark B, Uhrbom L. Loss of Arf causes tumor progression of PDGFB-induced oligodendroglioma. Oncogene. Epub 2007 Apr 16.
  18. Guo F, Gao Y, Wang L, Zheng Y. p19Arf-p53 tumor suppressor pathway regulates cell motility by suppression of phosphoinositide 3-kinase and Rac1 GTPase activities. J Biol Chem 2003;278:14414–9.[Abstract/Free Full Text]
  19. Bunz F, Dutriaux A, Lengauer C, et al. Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science 1998;282:1497–501.[Abstract/Free Full Text]
  20. Mirnezami AH, Campbell SJ, Darley M, Primrose JN, Johnson PW, Blaydes JP. Hdm2 recruits a hypoxia-sensitive corepressor to negatively regulate p53-dependent transcription. Curr Biol 2003;13:1234–9.[CrossRef][Medline]
  21. Brader S, Eccles SA. Phosphoinositide 3-kinase signalling pathways in tumor progression, invasion and angiogenesis. Tumori 2004;90:2–8.[Medline]
  22. Grooteclaes M, Deveraux Q, Hildebrand J, Zhang Q, Goodman RH, Frisch SM. C-terminal-binding protein corepresses epithelial and proapoptotic gene expression programs. Proc Natl Acad Sci U S A 2003;100:4568–73.[Abstract/Free Full Text]
  23. Yamazaki D, Kurisu S, Takenawa T. Regulation of cancer cell motility through actin reorganization. Cancer Sci 2005;96:379–86.[CrossRef][Medline]
  24. Weber JD, Jeffers JR, Rehg JE, et al. p53-independent functions of the p19(ARF) tumor suppressor. Genes Dev 2000;14:2358–65.[Abstract/Free Full Text]
  25. Hemmati PG, Gillissen B, von Haefen C, et al. Adenovirus-mediated overexpression of p14(ARF) induces p53 and Bax-independent apoptosis. Oncogene 2002;21:3149–61.[CrossRef][Medline]
  26. Grooteclaes ML, Frisch SM. Evidence for a function of CtBP in epithelial gene regulation and anoikis. Oncogene 2000;19:3823–8.[CrossRef][Medline]
  27. Bergman LM, Blaydes JP. C-terminal binding proteins: emerging roles in cell survival and tumorigenesis. Apoptosis 2006;11:879–88.[CrossRef][Medline]
  28. Thio SS, Bonventre JV, Hsu SI. The CtBP2 co-repressor is regulated by NADH-dependent dimerization and possesses a novel N-terminal repression domain. Nucleic Acids Res 2004;32:1836–47.[Abstract/Free Full Text]
  29. Vasiliev JM. Cytoskeletal mechanisms responsible for invasive migration of neoplastic cells. Int J Dev Biol 2004;48:425–39.[CrossRef][Medline]
  30. Liliental J, Moon SY, Lesche R, et al. Genetic deletion of the Pten tumor suppressor gene promotes cell motility by activation of Rac1 and Cdc42 GTPases. Curr Biol 2000;10:401–4.[CrossRef][Medline]
  31. Turner J, Crossley M. Cloning and characterization of mCtBP2, a co-repressor that associates with basic Kruppel-like factor and other mammalian transcriptional regulators. EMBO J 1998;17:5129–40.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
G. Chinnadurai
The Transcriptional Corepressor CtBP: A Foe of Multiple Tumor Suppressors
Cancer Res., February 1, 2009; 69(3): 731 - 734.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y.-W. Chen, S. Paliwal, K. Draheim, S. R. Grossman, and B. C. Lewis
p19Arf Inhibits the Invasion of Hepatocellular Carcinoma Cells by Binding to C-terminal Binding Protein
Cancer Res., January 15, 2008; 68(2): 476 - 482.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paliwal, S.
Right arrow Articles by Grossman, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paliwal, S.
Right arrow Articles by Grossman, S. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online