Cancer Research Translational Cancer Medicine 2008: Cancer Clinical Trials and Personalized Medicine  Susan G. Komen for the Cure-AACR Outstanding Investigator Award for Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation

Cancer Research 67, 520-527, January 15, 2007. doi: 10.1158/0008-5472.CAN-06-1608
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morrison, H.
Right arrow Articles by Herrlich, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morrison, H.
Right arrow Articles by Herrlich, P.

Cell, Tumor, and Stem Cell Biology

Merlin/Neurofibromatosis Type 2 Suppresses Growth by Inhibiting the Activation of Ras and Rac

Helen Morrison1,2, Tobias Sperka1,2, Jan Manent3, Marco Giovannini3, Helmut Ponta2 and Peter Herrlich1,2

1 Institute of Age Research, Fritz-Lipmann-Institute, Jena, Germany; 2 Forschungszentrum Karlsruhe, Institute of Toxicology and Genetics, Karlsruhe, Germany; and 3 Institut National de la Sante et de la Recherche Medicale U674 "Génomique Fonctionnelle des Tumeurs Solides," Fondation Jean Dausset-Centre d'Etude du Polymorphisme Humain, Paris, France

Requests for reprints: Helen Morrison, Institute of Age Research, Fritz-Lipmann-Institute, Herrlich Group, Beutenbergstr. 11, 07745 Jena, Germany. Phone: 49-3641-656139; E-mail: Helen{at}fli-leibniz.de.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The small G-protein Ras is a tightly controlled regulator of cell fate. Prolonged or persistent arrest in the activated GTP-loaded state by mutation of Ras as in lung cancer or in a Ras–GTPase-activating protein as in neurofibromatosis type 1 promotes tumorigenesis. We now show that the tumor-suppressor protein merlin (mutated in neurofibromatosis type 2) also controls Ras activity. Systematic analysis of growth factor signaling located the step of merlin interference to the activation of Ras and Rac. Merlin independently uncouples both Ras and Rac from growth factor signals. In the case of Ras, merlin acts downstream of the receptor tyrosine kinase-growth factor receptor binding protein 2 (Grb2)-SOS complex. However, merlin does not bind either SOS or Ras, but it counteracts the ERM (ezrin, radixin, moesin)–dependent activation of Ras, which correlates with the formation of a complex comprising ERM proteins, Grb2, SOS, Ras, and filamentous actin. Because efficient signaling from Ras requires Rac-p21-activated kinase–dependent phosphorylations of Raf and mitogen-activated protein/extracellular signal-regulated kinase kinase, merlin can also inhibit signal transfer from dominantly active Ras mutants. We propose that the interference of merlin with Ras- and Rac-dependent signal transfer represents part of the tumor-suppressive action of merlin. [Cancer Res 2007;67(2):520–7]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The autosomal dominant tumor-prone hereditary disorder neurofibromatosis type 2 (NF2) results from mutation of one copy of the nf2 gene. Upon loss of the second allele schwannomas, predominantly of the eighth cranial nerve, meningiomas and other brain tumors develop (1). Despite the benign nature of the tumors, the hereditary disease is severe in that close to 100% of all carriers die from multiple tumors. Disruption of the nf2 gene in the mouse caused a pregastrulation block of embryogenesis (2). Mice heterozygous for the nf2 deletion developed osteomas, aggressive osteosarcomas, and other tumors that had lost the second allele (3), indicating that nf2 suppresses not only tumorigenesis in Schwann cells, but more generally, and, possibly, metastatic growth.

The nf2 gene encodes the tumor-suppressor protein merlin. Merlin shares significant NH2-terminal sequence homology with ERM proteins (ezrin, radixin, moesin; ref. 4) and, therefore, binds to identical or similar proteins of the plasma membrane (5, 6). The ERM proteins and merlin seem to act antagonistically on growth: Merlin is inhibitory whereas ERM proteins seem to enhance proliferation (7, 8). The activities of ERM proteins and merlin are regulated by phosphorylation in an opposite manner: Merlin is activated by dephosphorylation at Ser518 (8, 9), whereas ERM proteins are active upon phosphorylation of a critical threonine residue (ezrinT567, radixinT564, moesinT558; ref. 10). Merlin is activated (and ERM proteins are inactivated) upon cell-to-cell or cell-to-matrix contact; this activation step restores contact inhibition of growth to tumor cells (8).

Overexpression of merlin can counteract transformation of cells by oncogenic Ras (11, 12) or Ras-mediated signaling (13, 14), suggesting that merlin can act at the level of or downstream of Ras. Conversely, reduction of merlin abundance mimics transformation in that nf2–/– cells lack growth control at cell-to-cell contact, loose proper adherens junctions, and maintain elevated extracellular signal-regulated kinase (ERK) and c-Jun-NH2-kinase (JNK) activity (9, 15). Although a number of properties of merlin have been revealed [e.g., merlin associates with the plasma membrane (8) and was coprecipitated with signaling components such as hepatic growth factor-regulated tyrosine kinase substrate (HRS; ref. 16) and p21-activated kinase 1 (PAK1; 17), with cytoskeletal components (18), and with components of the adherens junctions (15)], the mechanism of tumor suppression has remained unclear.

This study was initiated with the hypothesis that merlin would interfere with Ras-dependent proliferative signals. This hypothesis could be confirmed by showing that merlin blocks mitogen-activated protein/ERK kinase (MEK) and ERK activation induced by dominant active Ras. As expected, signal transduction from receptors that use the Ras pathway was also inhibited by merlin. However, the most important discovery is that merlin inhibits the activation of both Ras and Rac. Because Rac promotes Ras signaling, merlin can also inhibit the action of dominant-active Ras that cannot itself be blocked by merlin. Our data indicate that merlin exerts a specific effect relevant for tumor suppression—the inhibition of small G-protein activation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Growth factors, antibodies, and reagents. Recombinant human platelet-derived growth factor (PDGF) BB (Biomol, Hamburg, Germany), Lubrol 17A17 (Uniqema, Pool, United Kingdom), recombinant human interleukin-6 (IL-6), tumor necrosis factor-{alpha} (TNF-{alpha}), epidermal growth factor (EGF), insulin-like growth factor (IGF), lysophosphatidic acid (LPA), 12-O-tetradecanoyl-phorbol-13-acetate (TPA). Igepal CA-630, Triton X-100, and doxycycline (Sigma, Deisenhofen, Germany); hyaluronan (Healon, high molecular weight, Pharmacia & Upjohn, Erlangen, Germany); Raf-1 Ras binding domain glutathione agarose (Raf-1 RBD), glutathione S-transferase–growth factor receptor binding protein 2 (GST-Grb2; Upstate, Hamburg, Germany); CRIB-PAK glutathione agarose (Cytoskeleton tebu-bio, Offenbach, Germany); MEK inhibitor U0126 (Promega, Mannheim, Germany). Rabbit polyclonal antibodies against ERK1 (K23), p27 (C-19), SOS 1 (C-23), Raf-1 (C-12), PDGF receptor (PDGFR) ß (958), c-Src (SRC2). Rabbit polyclonal antibodies against phosphorylated proteins merlin (Ser518; Abcam, Cambridge, United Kingdom); ERK (Thr202/Tyr204); MEK1/2 (Ser217/221); I{kappa}B (Ser32/36); cyclic AMP (cAMP)–responsive element binding protein (CREB; Ser133); signal transducers and activators of transcription 3 (STAT3; Tyr705); Raf-1 (Ser338); and pan-specific antibodies against PLC{gamma}1, I{kappa}B, and CREB (New England Biolabs, Schwalbach, Germany). Mouse monoclonal antibodies hemagglutinin (HA) tag (12CA5; Boehringer Mannheim, Mannheim, Germany); phosphotyrosine (4G10), Grb-2 (3F2), Ras (RAS10), phosphatidylinositol 3-kinase (PI3K; Upstate); rabbit polyclonal antibodies against PI3K (Upstate); and Rac (Cytoskeleton).

Plasmids. Wild-type isoform 1 NF2 (pcDNA3; David Gutmann, Washington University School of Medicine, St. Louis, MO), RasL61 (19), RafBXB (ref. 20; Martin Schwartz, University of Virginia, Charlottesville, VA), MEK-1 DD (pcDNA3.1; ref. 21; Axel Knebel, University of Dundee, Dundee, United Kingdom), MEK-ERK fusion (Susanne Weg-Remers, Forschungszentrum Karlsruhe, Institute of Toxicology and Genetics, Karlsruhe, Germany), RacL61 and PakL107F (Alan Hall, University College, London, United Kingdom), and HA-tagged ERK-1 (Axel Ullrich, Max Planck Institute for Biochemistry, Martinsried, Germany).

Cell cultures. RT4-D6P2T schwannoma cell line and NIH3T3 mouse fibroblasts (European Collection of Animal Cell Cultures, Salisbury, United Kingdom). RT4tetNf2 cells (parental cell line RT4-D6P2T) carrying doxycycline-inducible merlin (wild-type and mutant 518A) were made as described by Morrison et al. (8). SC4-immortalized nf2–/– cell line and nf2+/+ primary Schwann cells were from respective mice. Cells were grown in DMEM (Gibco, Invitrogen, Karlsruhe, Germany) supplemented with 10% FCS (Life Technologies) or 10% calf serum (Life Technologies) for NIH3T3. Nf2+/+ primary Schwann cells were grown in DMEM+F12 (50:50) supplemented with N2 complement (Invitrogen), forskolin (Upstate), and heregulin ß1 (Sigma). All cells were maintained in a humidified atmosphere with 5% CO2 at 37°C. The dose of doxycycline in all cell culture experiments was 1 µg/mL.

Stable and transient transfection of cells. Transfections were done using FuGENE-6 (Boehringer Mannheim) or LipofectAMINE (Invitrogen). To generate stable clones or pooled clones, cells were cotransfected with pCEP4 (for hygromycin resistance; Invitrogen) and selected in 100 µg/mL hygromycin (Roche, Mannheim, Germany).

Definition of growth condition in culture dishes. Low cell density (i.e., logarithmic or exponential growth) is defined as the density recorded at 24 h after seeding 500 cells/cm2. High cell density (i.e., confluent growth condition) is defined as 24 h after seeding 5 x 103 cells/cm2. High cell density for NIH3T3 and SC4 nf2–/– is defined as 24 h after seeding 1 x 105 cells/cm2.

Affinity precipitation. For pulldowns with Raf-1 RBD-GST, PAK-CRIB-GST, and GST-Grb2, cells were lysed in 25 mmol/L HEPES (pH 7.5), 150 mmol/L NaCl, 10 mmol/L MgCl2, 1% Igepal CA-630, Lubrol 17A17 (Uniqema), 10% glycerol, 1 mmol/L EDTA 25 mmol/L NaF, 1 µmol/L sodium vanadate, 1 mmol/L phenylmethylsulfonyl fluoride, 10 µg/mL aprotinin, and 10 µg/mL leupeptin. Supernatants were incubated with 5 µg of recombinant fusion protein rotating at 4°C for 1 h. Immunoprecipitations are described in figure legends and in ref. 8.

Small interfering RNA. All small interfering RNA (siRNA) oligonucleotides were purchased from Ambion (Huntingdon, Germany). Merlin: mouse, sense, UACCGAGCUUCGACAUUAUUG; antisense, AUA AUGUCGAAGCUCGGUAUG. Ezrin: rat, sense, UCAACUAUUUCGAGAUCAAAA; antisense, UUGAUCUCGAAAUAGUUGAUC. Radixin: rat, sense, CUCGUCUGAGAAUCAAUAAGC; antisense, UUAUUGAUUCUCAGACGAGGU. Moesin: rat, sense, GGCUGAAACUCAAUAAGAAGG; antisense, UUCUUAUUGAGUUUCAGCCAA. Control 1: siRNA against firefly luciferase, sense, CGUACGCGGAAUACUUCGA; antisense, UCG AAGUAUUCCGCGUACG. Control 2: siRNA scrambled merlin, sense, AAUCCGGUUGCAUAGUUCAUG; antisense, UGAACUAUGCAACCGGAUUUG. Transfection of all siRNAs using LipofectAMINE (Invitrogen) were done as recommended by the manufacturer.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tumor-suppressive function of merlin through interference with the Ras-to-MEK transfer of signals. Immortalized nf2–/– Schwann cells are not contact inhibited but are nevertheless not tumorigenic. As we had shown previously that activated merlin reduced proliferation of cells (9), we examined whether reconstitution in nf2–/– Schwann cells with activated merlin at physiologic abundance would also inhibit proliferation. Reexpression of merlin at different levels indeed inhibited proliferation of nf2–/– Schwann cells in three independent clones [as measured by bromodeoxyuridine (BrdUrd) incorporation; strong BrdUrd staining represents cells in S phase (Fig. 1A )]. Figure 1B shows the levels of merlin in the three cell clones and a coarse comparison of clone 2 with merlin abundance in primary Schwann cells. The effect of merlin on BrdUrd incorporation resembled that achieved by a MEK inhibitor (Fig. 1A).


Figure 1
View larger version (41K):
[in this window]
[in a new window]

 
Figure 1. Down-regulation in NIH3T3 cells and reconstitution in nf2–/– cells of the tumor-suppressor function of merlin. A and B, physiologic levels of merlin inhibit proliferation. SC4-immortalized nf2–/– Schwann cells were stably transfected with a merlin expression construct. B, three independent clones were compared for merlin expression by immunoblotting (1, low; 2, medium; 3, high). The abundance of merlin in clone 2 resembled that of normal Schwann cells (nf2+/+). A, three independent clones compared with the parental nf2–/– cells were plated at high cell density, labeled with BrdUrd (20 µmol/L, 30 min), and stained for incorporation using a biotinylated BrdUrd antibody (oncogene). For comparison, the effect of the MEK activation inhibitor UO126 (10 µmol/L) was included. C, down-regulation of merlin by RNAi in NIH3T3 cells caused an increase in proliferation. NIH3T3 cells were treated with siRNA against merlin for 36 h, replated at high cell density, labeled with BrdUrd (20 µmol/L, 2 h), and stained for incorporation using a biotinylated BrdUrd antibody (oncogene). Lysates were immunoblotted with antibodies as indicated. Two independent experiments, each with control siRNAs: unrelated siRNA complementary to luciferase and scrambled merlin siRNA. D, interference of merlin with oncogenic Ras, Raf but not MEK-dependent agar colony growth. RT4tetNf2 cells were stably transfected with cytomegalovirus promoter-driven constructs encoding oncogenic Ras, Raf or MEK, and were grown in soft agar [without (–) and with (+) doxycycline (dox); ref. 8]. For comparison, the effect of the MEK activation inhibitor UO126 (10 µmol/L) was included. E, increased levels of p27 upon inhibition of the Ras-MEK pathway by either merlin or a MEK activation inhibitor. RT4tetNf2 cells were plated at high density and treated with either doxycycline or 10 µmol/L MEK inhibitor (U0126) for 8 h. Lysates were immunoblotted (8) as indicated. F and G, interference of merlin with oncogenic Ras, Raf but not MEK-dependent ERK phosphorylation. C, RT4tetNf2 cells were transiently cotransfected in a 5:1 ratio with constructs encoding oncogenic Ras, Raf or MEK and a HA-tagged ERK1. Cells were densely plated, treated with doxycycline, and serum starved overnight before lysis. HA-tagged ERK was immunoprecipitated; proteins were resolved by 8% SDS-PAGE and immunoblotted as indicated. D, NIH3T3 cells were cotransfected in a 5:5:1 ratio with constructs encoding merlin, oncogenic Ras or MEK, and with HA-tagged ERK1. Cells were densely plated and serum starved overnight before lysis, and HA-tagged ERK was immunoprecipitated. Immunoblots were as indicated.

 
We then asked if loss of merlin from a cell line such as NIH3T3 cells will have an opposite result (i.e., enhanced BrdUrd incorporation). Down-regulation of merlin in NIH3T3 cells by two independent sequences of RNA interference (RNAi) strongly increased proliferation (Fig. 1C). These data show that approximately physiologic levels of merlin control proliferation. Loss of proliferation control may be the basis of tumor formation in NF2 patients.

Merlin has been shown to counteract the cellular transformation by oncogenic Ras (12). In the transformed ErbB2-driven rat schwannoma cell line RT4-D6P2T (RT4; ref. 22), which maintains elevated Ras activity, merlin overexpression caused a reduction in colony numbers (cells supplied with a doxycycline-inducible merlin expression construct: RT4tetNf2; ref. 8; Fig. 1D, control). To define the step of merlin interference with transformation, we introduced dominant-active components of the Ras pathway. Dominant-active Ras could not block the effect of merlin on colony growth (Fig. 1D, RasLeu61), nor could dominant-active Raf (Fig. 1D, RafBXB). Introduction of dominant-active MEK, however, prevented the reduction of agar colonies by merlin (Fig. 1D, MEKDD and MEK-Erk). Thus, merlin interferes with agar colony growth at a step above MEK. As a control experiment, the MEK activation inhibitor caused a similar reduction of agar colonies, indicating that the influence of merlin on the Ras-MEK-ERK pathway is important for its tumor-suppressor function (Fig. 1D, MEK Inhibitor). The block of the Ras-MEK-ERK pathway is likely related to a G1 arrest caused by merlin as had been reported (23) and is reflected in the up-regulation of cell cycle inhibitors such as p21 (not shown) and p27 (Fig. 1E).

We have previously shown that the antiproliferative action of merlin is not a function simply of overexpression but requires merlin dephosphorylation (8, 9). Dephosphorylation is induced in soft agar (not shown) or by high cell density. To directly measure the action of merlin on the Ras signal transduction pathway, we studied oncogene-dependent activation of ERK in RT4tetNf2 (Fig. 1F) or NIH3T3 cells (Fig. 1G) transiently cotransfected with HA-tagged ERK and dominant-active oncogenes. Density-activated merlin prevented the phosphorylation of ERK by Ras and Raf, but not by MEK. This result suggests that merlin directly interferes with signal transduction, and, as in the agar colony experiment, merlin blocks at a level above MEK.

Specific interference of merlin with receptor tyrosine kinase–dependent signal transduction. Because Ras is involved in the signal transfer from numerous receptors, from receptor tyrosine kinases (RTK) to G-protein coupled receptors, we reasoned that merlin should interfere with several receptor-dependent signaling processes (as in the case of ErbB2 in RT4 cells). To examine this possibility, we determined activation of endogenous ERK by various RTKs in RT4tetNf2 under conditions of either low cell density, when merlin is inactive, or high cell density. The resulting activation of merlin by dephosphorylation under the latter condition is shown in Fig. 2A (right). Addition of FCS, which contains a number of receptor ligands, induced the phosphorylation of ERK that was reduced by active merlin (ref. 14; high cell density; Fig. 2A), but not by inactive merlin (low cell density; Fig. 2A). Moreover, the permanently inactive merlin point mutant L64P (8) did not inhibit signal transduction (not shown). We activated ERK by individual growth factors contained in FCS and determined the effect of merlin. Activated merlin inhibited the phosphorylation of ERK induced by LPA (addressing a G-protein coupled receptor), by PDGF, by IGF (Fig. 2B), or by hepatocyte growth factor (HGF; not shown). A constitutively active ErbB2 drives the RT4 schwannoma cells, and no further stimulation by EGF could be detected. Therefore, EGF-induced ERK phosphorylation was tested in other cell types where merlin indeed inhibited EGF-dependent signaling (not shown). Moreover, in the nf2–/– Schwann cells, expression and activation of merlin inhibited the PDGF-induced phosphorylation of ERK (Fig. 2E). The data are compatible with the existence of a common mechanism of merlin interference with signaling pathways that use Ras.


Figure 2
View larger version (54K):
[in this window]
[in a new window]

 
Figure 2. Specific interference of merlin with RTK-dependent signal transduction. A, active merlin inhibits serum-induced ERK phosphorylation. RT4tetNf2 cells were plated at low density (LCD) or high density (HCD), treated with doxycycline, and serum starved overnight before treatment with FCS (4% for 5 min). Immunoblots were as indicated. B, active merlin inhibits several receptor-dependent pathways. RT4tetNf2 cells were plated at high density, treated with doxycycline, and serum starved overnight before treatment with PDGF (10 ng/mL, 5 min), IGF (10 ng/mL, 5 min), or LPA (20 µmol/L, 3 min). Immunoblots as in Fig. 1D. C, specificity of merlin action. RT4tetNf2 cells were plated at high density, treated with doxycycline, and serum starved overnight before treatment with TNF-{alpha} (10 ng/mL, 5 min) or IL-6 (1 ng/mL, 5 min). Lysates were immunoblotted as indicated. D, merlin resistance by bypassing Ras with phorbol ester. RT4tetNf2 cells were plated at high density, treated with doxycycline, and serum starved overnight before treatment with TPA (100 ng/mL 5 min). Immunoblots as in Fig. 1D. E, physiologic levels of merlin inhibit PDGF-dependent ERK phosphorylation. SC4 nf2–/– cells and the merlin expression clones described in Fig. 1C were plated at high cell density, serum starved overnight before treatment with PDGF as in (B), and immunoblots were done as in Fig. 1D.

 
Merlin is, however, not a general inhibitor of signaling. Although TNF-{alpha}–dependent ERK phosphorylation was blocked by merlin, the TNF-{alpha}–induced phosphorylation of I{kappa}B was not (Fig. 2C). Moreover, ERK activation in response to IL-6 was inhibited, but not the IL-6 dependent activation of STAT3 (Fig. 2D, right). The cAMP-induced phosphorylation of CREB and the transcription of a reporter gene in response to glucocorticoid hormone were also merlin resistant (not shown). Because merlin could not block if signaling was initiated by dominant-active MEK (Fig. 1F and G), we asked whether activation of ERK by TPA, which bypasses Ras, would be merlin resistant. This was indeed the case: ERK activation by TPA was not affected by merlin (Fig. 2D, left).

Dissection of the PDGF-dependent signaling pathway: merlin inhibits Ras and Rac activation. The experiments thus far suggest that merlin interferes with signal transduction below Ras. To pinpoint this step of merlin interference with signaling within a specific RTK-dependent pathway, we examined in detail the signaling steps in response to PDGF in RT4tetNf2 cells as well as in the merlin-transfected nf2–/– Schwann cells. Tyrosine phosphorylation sites in the activated PDGFR serve to assemble a number of adaptor proteins and enzymes (24). We immunoprecipitated PDGFR and determined its tyrosine phosphorylation and the coprecipitation of several binding proteins within 5 min of PDGF stimulation. The autophosphorylation of the receptor as well as the association of all proteins interacting with phosphotyrosines, including Grb2-SOS, was not affected by the expression and activation of merlin (Fig. 3A, top ), indicating that merlin did not act at the receptor itself; it also did not interfere with the binding of components to the phosphotyrosines.


Figure 3
View larger version (63K):
[in this window]
[in a new window]

 
Figure 3. Dissection of the PDGF-dependent signaling pathway. A, autophosphorylation of the PDGFR as well as the binding of adaptor proteins and enzymes is not affected by active merlin. RT4tetNf2 cells were plated at a high density, treated with doxycycline, and serum starved overnight before treatment with PDGF for 3 min. From lysates, PDGFR was immunoprecipitated (8). Immunoblots were consecutively probed with antibodies against phosphorylated tyrosine, PDGFR, and the coimmunoprecipitated proteins Grb2, Sos, Src, PI3K, and PLC{gamma}. Merlin inhibits PDGF-induced activation of the small G-proteins Ras and Rac. Lysates from the same experiments were immunoblotted for the activation of MEK, ERK, and CREB as indicated, or treated with either Raf-1RBD (for Ras-GTP) or CRIB-PAK (for Rac-GTP) to coprecipitate activated Ras and Rac, which was then detected by immunoblotting. B, physiologic levels of merlin inhibit PDGF-induced activation of Ras. The merlin expression clones in SC4 nf2–/– cells described in Fig. 2B were treated as in (E). Lysates were treated with Raf-1RBD to coprecipitate Ras-GTP, which was subsequently detected by immunoblotting. C, down-regulation of merlin by RNAi in NIH3T3 cells caused an increase in Ras activity. NIH3T3 cells were treated with siRNA against merlin or control siRNAs (as in Fig. 2C) for 36 h, replated at high cell density, and lysed. The lysates were treated as in (B). D, Ras-GTP in low- and high-density cells. NIH3T3 cells were grown to different densities (see Materials and Methods) and treated or not with PDGF and EGF. Ras-GTP was determined as in (A and B). E, merlin blocks the formation in vitro of a putative Ras activation complex. Components involved in the activation of Ras were assembled in vitro with GST-Grb2 added to the lysates. Pulldowns were as described in Materials and Methods. Immunoblots of the components are shown. F, down-regulation of ERM by RNAi in RT4 cells inhibited Ras activity. RT4 cells were treated with siRNA against ERM or control siRNAs (as in Fig. 2C) for 36 h, replated at low cell density, and lysed. The lysates were treated as in (B).

 
In lysates from the same experiments, we determined the activity levels of downstream components. The phosphorylations of CREB, ERK, and MEK in response to PDGF were inhibited by merlin (Fig. 3A, bottom). The PDGF-induced phosphorylations of JNK (not shown; see also ref. 9), and of Akt and protein kinase C (not shown), were also merlin sensitive. These results could be expected because activation of these signaling components depends, at least in part, on the Ras pathway and on Ras-dependent Rac activity (25). An indirect action through protein turnover or receptor internalization was ruled out because immunoblotting and fluorescence-activated cell sorting analysis (not shown) showed equal abundance of the respective components. In addition, inhibition of signal transduction was also achieved immediately after rapid merlin activation as occurs after treatment with hyaluronan (not shown; hyaluronan mimics high cell density; ref. 8).

In conjunction with the previous data, an interference mechanism below Ras would be plausible. The further analysis of the PDGF-induced signaling pathway revealed, however, an unexpected result: The GTP-loading of Ras as well as of Rac (17) was severely reduced by merlin (RT4tetNf2 in Fig. 3A; nf2–/– Schwann cells in Fig. 3B). A quantitation of critical blots is shown in Supplementary Fig. S1. Conversely, RNAi-mediated down-regulation of merlin in NIH3T3 cells enhanced basal and PDGF-induced activation of Ras at high cell density (Fig. 3C). These data clearly imply that merlin acts above Ras and Rac. In addition, these data imply that cells at a high density, compared with cells at a low density, carry lower amounts of Ras-GTP and are less responsive to growth factors. This was indeed the case: Activity levels and responses to PDGF or EGF were lower in high-density cultures compared with low-density cultures (Fig. 3D).

Merlin blocks the formation in vitro of a complex between ezrin, SOS, and Ras in vitro. We have previously shown that merlin and ERM proteins are counterplayers in the control of cellular proliferation and that both require anchorage to the plasma membrane using identical binding sites (8). In the example of a coreceptor for the RTK, Met elimination of the common binding site interfered with HGF-dependent ERK activation (26). This led us to speculate that an ERM protein–containing complex was required for signaling and that merlin may disrupt this complex. Ras and Rac can be activated by the nucleotide exchange factor SOS. Based on our data obtained with merlin, the putative complex should contain the components needed for Ras activation (e.g., SOS and possibly Ras). In an attempt to form the putative ERM-SOS complex in vitro, we added GST-Grb2 to lysates and analyzed the pulled down components (Fig. 3E). The pulldowns revealed binding of SOS to Grb2 irrespective of whether the cells were treated with PDGF (Fig. 3E). This is in agreement with reported data showing constitutive association of Grb2 and SOS (27). Merlin did not disturb the association of Grb2 with SOS both in vivo (Fig. 3A) and in vitro (Fig. 3E). The apparent complex indeed contained ERM proteins, which were eliminated or reduced upon activation of merlin. Removal of ERM proteins from cells by RNAi prevented the formation of the pulldown complex in vitro (not shown) and prevented the activation of Ras (Fig. 3F). ERM knockdown normalized to actin in +PDGF samples reduced ERM expression by 77% and in –PDGF samples by 67%; the corresponding Ras-GTP levels were reduced by 90% (+PDGF) and 55% (–PDGF). Although the interaction of SOS with Ras is probably transient, we detected Ras in the pulldowns from lysates of cells treated with PDGF (Fig. 3E). Interestingly, similarly to that of the ERM proteins, the SOS Ras association was abolished by merlin. Although merlin expression is well detectable in the lysates, merlin did not associate with the Grb2-SOS–containing complex (Fig. 3E). We take these data as preliminary indications for a mechanism of Ras activation that involves a structured protein assembly, including ERM proteins, and that this assembly is disrupted by merlin.

Interference with Rac activation explains the inhibition of dominant-active Ras signaling by merlin. How can it be explained that merlin inhibits the activation of the small G-proteins Ras and Rac, but also blocks signaling and transformation by the dominant-active Ras? The GTP loading of the dominant-active Ras was not influenced by merlin (Fig. 4C ). It is thought that efficient signal transduction from normal or mutated Ras (28) requires the phosphorylations of Raf at Ser338 and of MEK at Ser298 by PAK (2931). PAK activity, in turn, depends on the activation of Rac, which is inhibited by merlin. The involvement of Rac-PAK regulation of the Raf-MEK-ERK pathway was confirmed in our cell systems: Indeed, a dominant-negative Rac (RacN17) inhibited the PDGF or dominant-active Ras-dependent ERK phosphorylation (Fig. 4D). Because merlin blocks the activation of Rac, we asked whether dominant-active Ras signaling and transformation could still be inhibited by merlin under conditions of persistent Rac or PAK activation. Although merlin inhibited dominant-active Ras–induced Raf and subsequent ERK phosphorylation (Fig. 4A, left and right, lanes 3 and 4), introduction of dominant-active Rac (RacL61; Fig. 4A, left, lanes 7 and 8) or dominant-active PAK (PakL107F; Fig. 4A, right, lanes 7 and 8) eliminated merlin action. Because PAK can inactivate merlin (phosphorylating at Ser518; refs. 32, 33), we repeated the experiment by introducing dominant-active merlin S518A and obtained the same result (Fig. 4A, bottom; and not shown). Interestingly, dominant-active Rac or dominant-active PAK alone induced some Raf-Ser338 phosphorylation and ERK activation despite very little spontaneous Ras activity (Fig. 4A, lanes 5 and 6). Furthermore, dominant-active Rac or dominant-active PAK reduced the inhibitory effect of merlin on agar colony growth in NIH3T3 cells as well as in RT4tetNf2 cells carrying inducible wild-type merlin or mutant S518A (Fig. 4B). Taken together, inhibition of Ras and Rac activation seems to be the major growth-suppressive function of merlin.


Figure 4
View larger version (67K):
[in this window]
[in a new window]

 
Figure 4. Interference with Ras and Rac activation is the only, or is the predominant, mechanism of merlin action. A, dominant-active Rac or dominant-active PAK prevents merlin inhibition of ERK phosphorylation triggered by dominant-active Ras. RT4 cells carrying inducible wild-type merlin (RT4tetNf2) or constitutively active mutant S518A (RT4tetNf2S518A), or NIH3T3 cells, were stably cotransfected with constructs encoding oncogenic Ras, Rac, and with a hygromycin resistance construct. Hygromycin-resistant cells were selected for 24 h. Cells were densely plated, treated with doxycycline, and serum starved overnight before lysis. Immunoblots are as indicated. B, dominant-active Rac or dominant-active PAK prevents merlin inhibition of dominant-active Ras–induced agar colony growth. Cells treated as in (A) were grown in soft agar (– and + doxycycline) for RT4tetNf2 and RT4tetNf2S518A (8). For NIH3T3 cells treated as in (A), 1.5 x 104 were grown in soft agar. C, GTP loading of dominant-active Ras is not inhibited by merlin. NIH3T3 cells were cotransfected with RasL61 and merlin (or vector control) and were plated at a high density. After 24 h, Ras-GTP was determined as in (A and B). D, the requirement for Rac in Ras signaling. Dominant-negative Rac blocks Ras or PDGF-dependent ERK activation. RacN17 (or vector control) were stably cotransfected with RasL61 (or vector control) as in (A) into RT4 or NIH3T3 cells. Twenty-four hours later, the phosphorylation of ERK was determined. Right, PDGF-induced ERK phosphorylation was determined in RacN17-transfected NIH3T3.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
As the most important finding reported here, the tumor-suppressor protein merlin (nf2) interferes with the activation of Ras and Rac. This result was derived from a systematic study of the PDGF-induced signaling pathway. Neither the activation of the PDGFR itself nor the binding of adaptor proteins, such as Grb2-SOS, PLC{gamma}, PI3K, or Src, was affected by merlin (shown in Fig. 3). The first detectable interference concerned the loading of Ras or Rac with GTP. It is well known that Rac can be activated after Ras activation (34). The reverse has also been reported for lymphoid cells (35, 36). This latter reverse signaling was not observed in our cell types (Supplementary Fig. S2). We conclude that merlin interferes with the activation of Rac and Ras independently for the following reasons: Interference by merlin with Rac activation was independent of the inhibition of Ras GTP loading as inhibition of Rac activation was not affected by either noninhibitable dominant-active Ras or dominant-negative Ras (not shown and Supplementary Fig. S3). Dominant-active Rac did not cause activation of Ras (Supplementary Fig. S2). We note, however, that dominant-active Rac caused some phosphorylations of Raf and ERK, both of which were resistant to merlin; this is quite in contrast to Raf and ERK activations by dominant-active Ras, which require the activation of Rac.

Coimmunoprecipitations did not reveal an association of merlin with either Ras or Rac (not shown). Merlin acts apparently after activation of an RTK that leads to guanine nucleotide-exchange factor (GEF) recruitment. Three possible reactions could be affected by merlin: (a) sequestering of GDP dissociation inhibitor (GDI). [This may be an attractive possibility because an interaction of merlin with RhoGDI has been reported (37)]; (b) activation of Ras-GAP and Rac-GAP activity; and (c) inhibition of the catalytic function or the association of GEF (e.g., SOS with Ras and Rac). Interestingly, an association of merlin with Ral-GDS, a GEF operating at the G-protein Ral, downstream of Ras, has been reported recently (38). Efficient tumor suppression by merlin may even be based on a combination of these molecular actions. Merlin function also permits the hypotheses on the action of the ERM proteins. The opposite effects of ERM proteins and merlin on proliferation control (8, 26) suggest that ERM proteins enhance Ras activation by one of the three steps proposed to be targeted by merlin. The RNAi data (Fig. 3F) strongly speak for a role of ERM proteins in Ras activation. The in vitro reconstitution experiments using GST-Grb2 suggest the existence of a Grb2-SOS-ERM-Ras complex [which also contains filamentous actin (F-actin); not shown], which is disrupted by merlin, thus favoring the hypothetical mechanism of an interference with GEF activity. Both ERM proteins and merlin require for their activity the association with membrane proteins, e.g., CD44 or integrins. Merlin competes for the same binding sites and thus releases the Grb2-SOS-ERM-Ras complex from the membrane anchorage (8). Although not yet proven, it is plausible that SOS requires the interaction with ERM proteins and F-actin to unfold and become catalytically active.

The inhibition of Ras and Rac activation (e.g., by interfering with their common GEF, SOS; ref. 34) also explains how merlin can interfere with transformation by a dominant-active Ras (Fig. 1; ref. 12) or dominant-active Rac (9). Dominant-active Rac or dominant-active PAK introduced together with dominant-active Ras abolished the inhibitory effect of merlin on signal transduction and on tumorigenic growth in soft agar (Fig. 4). We explain the result as follows: The efficient signal transduction and transformation by Ras requires PAK-dependent Raf and MEK phosphorylation (30, 3941). Dominant-active PAK or persistent activation of PAK by dominant-active Rac eliminates the step addressed by merlin, the interference of Rac activation that blocks Ras signaling. Inhibition of signaling from dominant-active Raf-BXB (Fig. 1), which is not dependent on phosphorylation of Ser338 for activation, can probably be explained similarly: Raf-dependent activation of MEK at Ser218 and Ser222 (42) requires that PAK phosphorylates MEK on Ser298. Dominant-active MEK is a 218D:222D double mutant and does not require PAK priming; thus, dominant-active MEK is merlin resistant. We conclude that the tumor-suppressive function of merlin is exerted by the combined inhibition of at least Ras and Rac activation (Fig. 5 ). The inhibition of Ras and Rac activation is consistent with data previously reported (e.g., the inhibition of PAK activity by merlin; ref. 17). PAK addresses several downstream signaling components, one of which is merlin itself (9, 32, 33). Like many other substrate-enzyme interactions that require high substrate specificity, e.g., JNK with Jun (43), PAK and merlin interact fairly stably and can be coprecipitated (17). Other substrates of the PAK family mediate the dramatic effect of Rac on the cytoskeleton (e.g., the formation of lamellipodia and the migration of cells). The block of Rac activation by merlin thus prevents the reorganization of the cytoskeleton, a feature of merlin that has been previously described (44).


Figure 5
View larger version (30K):
[in this window]
[in a new window]

 
Figure 5. Proposed scheme of merlin action. Merlin (NF2) is activated by dephosphorylation. It needs to be bound to a plasma membrane protein (e.g., TMR, transmembrane receptor). Merlin blocks the activation of Ras and Rac. In the absence of Rac activation, Raf and MEK are not phosphorylated by PAK, which is an essential step in Ras-dependent signal transduction. Therefore, merlin also inhibits signaling from constitutively active Ras.

 
Our results cannot explain the numerous interactions merlin is involved in. Most of these occur with the alternatively spliced merlin isoform 2. An interaction with some preference for isoform 2 has been reported recently: magicin, which forms a complex with merlin, Grb2, and F-actin (45). In our experiments, merlin isoform 1 was not associated with Grb2 (Fig. 3). Interacting proteins may be related to specific functions of this second splice variant, for example, HRS (16) that suggests a role in endocytosis or paxillin (18) that suggests a role in morphogenesis. That merlin can enhance endocytosis has been reported several years ago (46). In Drosophila, the absence of merlin increases the density on the cell surface of EGF receptor and Notch (47). A possible explanation for this finding could be that merlin-HRS promote the endocytic degradation pathway. In the absence of merlin, more activated receptors remain on or are recycled to the cell surface. In our RT4 cell system, we have not been able to see a merlin-induced reduction of PDGFR surface density (not shown). The Ras- and Rac-dependent pathways are targets of several tumor-suppressor proteins. Hamartin binds to ezrin and Rho (48), the neurofibromatosis type 1 protein is a Ras GAP (49), and the selective inhibitors of mitogenic signaling belonging to the family of mammalian sproutys prevent a Raf-activating step (50). Our results on merlin add to this list, underscoring the significance of proper Ras pathway control to prevent tumorigenic growth and metastases.


    Acknowledgments
 
Grant support: Deutsche Forschungsgemeinschaft grant He551/8-2 and the Association for International Cancer Research grant 01-144.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Claire Isacke and Monique Arpin for helpful comments and encouragement, Ute Petz for technical assistance, and Jürgen Wehland and Therese Stradal for support and discussions.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 5/ 3/06. Revised 9/25/06. Accepted 10/ 9/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Evans DG, Huson SM, Donnai D, et al. A genetic study of type 2 neurofibromatosis in the United Kingdom. I. Prevalence, mutation rate, fitness, and confirmation of maternal transmission effect on severity. J Med Genet 1992;29:841–6.[Abstract]
  2. McClatchey AI, Saotome I, Ramesh V, Gusella JF, Jacks T. The Nf2 tumor suppressor gene product is essential for extraembryonic development immediately prior to gastrulation. Genes Dev 1997;11:1253–65.[Abstract/Free Full Text]
  3. McClatchey AI, Saotome I, Mercer K, et al. Mice heterozygous for a mutation at the Nf2 tumor suppressor locus develop a range of highly metastatic tumors. Genes Dev 1998;12:1121–33.[Abstract/Free Full Text]
  4. Gautreau A, Louvard D, Arpin M. ERM proteins and NF2 tumor suppressor: the Yin and Yang of cortical actin organization and cell growth signaling. Curr Opin Cell Biol 2002;14:104–9.[CrossRef][Medline]
  5. Legg JW, Isacke CM. Identification and functional analysis of the ezrin-binding site in the hyaluronan receptor, CD44. Curr Biol 1998;8:705–8.[CrossRef][Medline]
  6. Obremski VJ, Hall AM, Fernandez-Valle C. Merlin, the neurofibromatosis type 2 gene product, and ß1 integrin associate in isolated and differentiating Schwann cells. J Neurobiol 1998;37:487–501.[CrossRef][Medline]
  7. Tran Quang C, Gautreau A, Arpin M, Treisman R. Ezrin function is required for ROCK-mediated fibroblast transformation by the Net and Dbl oncogenes. EMBO J 2000;19:4565–76.[CrossRef][Medline]
  8. Morrison H, Sherman LS, Legg J, et al. The NF2 tumor suppressor gene product, merlin, mediates contact inhibition of growth through interactions with CD44. Genes Dev 2001;15:968–80.[Abstract/Free Full Text]
  9. Shaw RJ, Paez JG, Curto M, et al. The Nf2 tumor suppressor, merlin, functions in Rac-dependent signaling. Dev Cell 2001;1:63–72.[CrossRef][Medline]
  10. Gautreau A, Louvard D, Arpin M. Morphogenic effects of ezrin require a phosphorylation-induced transition from oligomers to monomers at the plasma membrane. J Cell Biol 2000;150:193–203.[Abstract/Free Full Text]
  11. Hirokawa Y, Tikoo A, Huynh J, et al. A clue to the therapy of neurofibromatosis type 2: NF2/merlin is a PAK1 inhibitor. Cancer J 2004;10:20–6.[Medline]
  12. Tikoo A, Varga M, Ramesh V, Gusella J, Maruta H. An anti-Ras function of neurofibromatosis type 2 gene product (NF2/Merlin). J Biol Chem 1994;269:23387–90.[Abstract/Free Full Text]
  13. Kim H, Lim JY, Kim YH, et al. Inhibition of ras-mediated activator protein 1 activity and cell growth by merlin. Mol Cells 2002;14:108–14.[Medline]
  14. Lim JY, Kim H, Kim YH, et al. Merlin suppresses the SRE-dependent transcription by inhibiting the activation of Ras-ERK pathway. Biochem Biophys Res Commun 2003;302:238–45.[CrossRef][Medline]
  15. Lallemand D, Curto M, Saotome I, Giovannini M, McClatchey AI. NF2 deficiency promotes tumorigenesis and metastasis by destabilizing adherens junctions. Genes Dev 2003;17:1090–100.[Abstract/Free Full Text]
  16. Scoles DR, Nguyen VD, Qin Y, et al. Neurofibromatosis 2 (NF2) tumor suppressor schwannomin and its interacting protein HRS regulate STAT signaling. Hum Mol Genet 2002;11:3179–89.[Abstract/Free Full Text]
  17. Kissil JL, Wilker EW, Johnson KC, Eckman MS, Yaffe MB, Jacks T. Merlin, the product of the Nf2 tumor suppressor gene, is an inhibitor of the p21-activated kinase, Pak1. Mol Cell 2003;12:841–9.[CrossRef][Medline]
  18. Fernandez-Valle C, Tang Y, Ricard J, et al. Paxillin binds schwannomin and regulates its density-dependent localization and effect on cell morphology. Nat Genet 2002;31:354–62.[Medline]
  19. Medema RH, Wubbolts R, Bos JL. Two dominant inhibitory mutants of p21ras interfere with insulin- induced gene expression. Mol Cell Biol 1991;11:5963–7.[Abstract/Free Full Text]
  20. Bruder JT, Heidecker G, Rapp UR. Serum-, TPA-, and Ras-induced expression from Ap-1/Ets-driven promoters requires Raf-1 kinase. Genes Dev 1992;6:545–56.[Abstract/Free Full Text]
  21. Mansour SJ, Matten WT, Hermann AS, et al. Transformation of mammalian cells by constitutively active MAP kinase kinase. Science 1994;265:966–70.[Abstract/Free Full Text]
  22. Nikitin A, Ballering LA, Lyons J, Rajewsky MF. Early mutation of the neu (erbB-2) gene during ethylnitrosourea-induced oncogenesis in the rat Schwann cell lineage. Proc Natl Acad Sci U S A 1991;88:9939–43.[Abstract/Free Full Text]
  23. Xiao GH, Gallagher R, Shetler J, et al. The NF2 tumor suppressor gene product, merlin, inhibits cell proliferation and cell cycle progression by repressing cyclin D1 expression. Mol Cell Biol 2005;25:2384–94.[Abstract/Free Full Text]
  24. Claesson-Welsh L. Signal transduction by the PDGF receptors. Prog Growth Factor Res 1994;5:37–54.[CrossRef][Medline]
  25. Lamarche N, Tapon N, Stowers L, et al. Rac and Cdc42 induce actin polymerization and G1 cell cycle progression independently of p65PAK and the JNK/SAPK MAP kinase cascade. Cell 1996;87:519–29.[CrossRef][Medline]
  26. Orian-Rousseau V, Chen L, Sleeman JP, Herrlich P, Ponta H. CD44 is required for two consecutive steps in HGF/c-Met signaling. Genes Dev 2002;16:3074–86.[Abstract/Free Full Text]
  27. Li N, Batzer A, Daly R, et al. Guanine-nucleotide-releasing factor hSos1 binds to Grb2 and links receptor tyrosine kinases to Ras signalling. Nature 1993;363:85–8.[CrossRef][Medline]
  28. Walsh AB, Bar-Sagi D. Differential activation of the Rac pathway by Ha-Ras and K-Ras. J Biol Chem 2001;276:15609–15.[Abstract/Free Full Text]
  29. Beeser A, Jaffer ZM, Hofmann C, Chernoff J. Role of group A p21-activated kinases in activation of extracellular-regulated kinase by growth factors. J Biol Chem 2005;280:36609–15.[Abstract/Free Full Text]
  30. Li W, Chong H, Guan KL. Function of the Rho family GTPases in Ras-stimulated Raf activation. J Biol Chem 2001;276:34728–37.[Abstract/Free Full Text]
  31. Tang Y, Yu J, Field J. Signals from the Ras, Rac, and Rho GTPases converge on the Pak protein kinase in Rat-1 fibroblasts. Mol Cell Biol 1999;19:1881–91.[Abstract/Free Full Text]
  32. Kissil JL, Johnson KC, Eckman MS, Jacks T. Merlin Phosphorylation by p21-activated kinase 2 and effects of phosphorylation on merlin localization. J Biol Chem 2002;277:10394–9.[Abstract/Free Full Text]
  33. Xiao GH, Beeser A, Chernoff J, Testa JR. p21-activated kinase links Rac/Cdc42 signaling to merlin. J Biol Chem 2002;277:883–6.[Abstract/Free Full Text]
  34. Scita G, Nordstrom J, Carbone R, et al. EPS8 and E3B1 transduce signals from Ras to Rac. Nature 1999;401:290–3.[CrossRef][Medline]
  35. Caloca MJ, Zugaza JL, Matallanas D, Crespo P, Bustelo XR. Vav mediates Ras stimulation by direct activation of the GDP/GTP exchange factor Ras GRP1. EMBO J 2003;22:3326–36.[CrossRef][Medline]
  36. Reynolds LF, de Bettignies C, Norton T, Beeser A, Chernoff J, Tybulewicz VL. Vav1 transduces T cell receptor signals to the activation of the Ras/ERK pathway via LAT, Sos, and RasGRP1. J Biol Chem 2004;279:18239–46.[Abstract/Free Full Text]
  37. Maeda M, Matsui T, Imamura M, Tsukita S. Expression level, subcellular distribution and rho-GDI binding affinity of merlin in comparison with Ezrin/Radixin/Moesin proteins. Oncogene 1999;18:4788–97.[CrossRef][Medline]
  38. Ryu CH, Kim SW, Lee KH, et al. The merlin tumor suppressor interacts with Ral guanine nucleotide dissociation stimulator and inhibits its activity. Oncogene 2005;24:5355–64.[CrossRef][Medline]
  39. Tang Y, Chen Z, Ambrose D, et al. Kinase-deficient Pak1 mutants inhibit Ras transformation of Rat-1 fibroblasts. Mol Cell Biol 1997;17:4454–64.[Abstract]
  40. Slack-Davis JK, Eblen ST, Zecevic M, et al. PAK1 phosphorylation of MEK1 regulates fibronectin-stimulated MAPK activation. J Cell Biol 2003;162:281–91.[Abstract/Free Full Text]
  41. Frost JA, Steen H, Shapiro P, et al. Cross-cascade activation of ERKs and ternary complex factors by Rho family proteins. EMBO J 1997;16:6426–38.[CrossRef][Medline]
  42. Coles LC, Shaw PE. PAK1 primes MEK1 for phosphorylation by Raf-1 kinase during cross-cascade activation of the ERK pathway. Oncogene 2002;21:2236–44.[CrossRef][Medline]
  43. Kallunki T, Deng T, Hibi M, Karin M. c-Jun can recruit JNK to phosphorylate dimerization partners via specific docking interactions. Cell 1996;87:929–39.[CrossRef][Medline]
  44. Pelton PD, Sherman LS, Rizvi TA, et al. Ruffling membrane, stress fiber, cell spreading and proliferation abnormalities in human Schwannoma cells. Oncogene 1998;17:2195–209.[CrossRef][Medline]
  45. Wiederhold T, Lee MF, James M, et al. Magicin, a novel cytoskeletal protein associates with the NF2 tumor suppressor merlin and Grb2. Oncogene 2004;23:8815–25.[CrossRef][Medline]
  46. Fraenzer JT, Pan H, Minimo L, Jr., Smith GM, Knauer D, Hung G. Overexpression of the NF2 gene inhibits schwannoma cell proliferation through promoting PDGFR degradation. Int J Oncol 2003;23:1493–500.[Medline]
  47. Maitra S, Kulikauskas RM, Gavilan H, Fehon RG. The tumor suppressors Merlin and expanded function cooperatively to modulate receptor endocytosis and signaling. Curr Biol 2006;16:702–9.[CrossRef][Medline]
  48. Jozwiak J. Hamartin and tuberin: working together for tumour suppression. Int J Cancer 2006;118:1–5.[CrossRef][Medline]
  49. Cichowski K, Jacks T. NF1 tumor suppressor gene function: narrowing the GAP. Cell 2001;104:593–604.[CrossRef][Medline]
  50. Sasaki A, Taketomi T, Kato R, et al. Mammalian Sprouty4 suppresses Ras-independent ERK activation by binding to Raf1. Nat Cell Biol 2003;5:427–32.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
S. Ammoun, C. Flaiz, N. Ristic, J. Schuldt, and C. O. Hanemann
Dissecting and Targeting the Growth Factor-Dependent and Growth Factor-Independent Extracellular Signal-Regulated Kinase Pathway in Human Schwannoma
Cancer Res., July 1, 2008; 68(13): 5236 - 5245.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
C. O. Hanemann
Magic but treatable? Tumours due to loss of Merlin
Brain, March 1, 2008; 131(3): 606 - 615.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morrison, H.
Right arrow Articles by Herrlich, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morrison, H.
Right arrow Articles by Herrlich, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation