| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
Department of Pharmacology, Drug Discovery Institute, and University of Pittsburgh Cancer Institute, University of Pittsburgh, Pittsburgh, Pennsylvania
Requests for reprints: John S. Lazo, Department of Pharmacology, University of Pittsburgh, Biomedical Science Tower 3, Suite 10040, 3501 Fifth Avenue, Pittsburgh, PA 15260. Phone: 412-648-9200; Fax: 412-648-9009; E-mail: lazo{at}pitt.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
, PTP1B, or PTP-PEST, have been implicated in processes that are essential for tumor cell metastasis due to their ability to affect focal adhesion regulation and cell migration (35). The phosphatase of regenerating liver (PRL) family of PTPs also seems to have an important role in the basic biology of cancer cell development and metastasis (6). PRL-1 (also known as PTP4A1 and PTPCAAX) was first identified as an immediately-early gene whose expression was induced in rat regenerating liver (7); this was followed by the identification of PRL-2 and PRL-3, with which PRL-1 shares 87% and 75% sequence identity, respectively (8). Saha et al. (9) compared gene expression profiles in colon cancers that had metastasized to the liver with those in primary tumors and normal colon cells and found that PRL-3 was overexpressed (9, 10). In addition, high PRL-3 mRNA expression was reported in metastatic lesions derived from colorectal cancers regardless of the site of metastasis, whereas low PRL-3 mRNA levels were observed in non-colorectal cancer metastases to the lung or the liver (10). PRL-1 is expressed in normal lung bronchiolar epithelium (11) and is overexpressed in many histologically distinct, cultured, human, tumor cell lines, including lung cancer cells (12). Several studies show that cells expressing high levels of PRL-1 exhibit an enhanced proliferation rate (11, 13, 14). Chinese hamster ovary cells stably expressing PRL-1 or PRL-3 have enhanced cell motility and invasiveness; cells with elevated PRL-1 or PRL-3 have an increased capacity to produce metastatic tumors in mice (15). Furthermore, pancreatic ductal epithelial cells stably overexpressing PRL-1 and PRL-2 exhibited a transformed phenotype in culture and tumor growth in nude mice (16). Initially, the substrates for PRL-1 were thought to be nuclear because PRL-1 was originally described as a nuclear protein when ectopically expressed in transfected cells (17). Subsequently, Zeng et al. (13) reported that PRL phosphatases were localized to the plasma membrane and early endosomes, and that the localization pattern was dependent on their posttranslational farnesylation. Recently, Fiordalisi et al. (18) reported that PRL-1 and PRL-3 promoted motility and invasion in colon cancer cells by stimulating Rho signaling pathways using transfection approaches. Kato et al. (19) also found that transient reduction of PRL-1 or PRL-3 abrogated colon cancer cell motility and hepatic colonization. To elucidate the functional role of PRL-1 phosphatase in tumor metastasis, we have studied lung cancer cells in which PRL-1 has been depleted using short hairpin RNA (shRNA) technology.
Herein, we report that endogenous PRL-1 silencing inhibited lung cancer cell invasion with decreased expression of c-Src and p130Cas and inactivation of Rac1 and Cdc42. These results reveal a novel role of PRL PTPs in regulating fundamental signals important for cancer cell metastasis and encourage greater attention on this class of PTP.
| Materials and Methods |
|---|
|
|
|---|
shRNA. To deplete endogenous PRL-1, we selected three different 21-nucleotide sequences according to the manufacturer's instructions and software:1 AAGCAACTTATGACACTACTC (PRL-1 silencing site 149), AACCAGATTGTTGATGACTGG (PRL-1 silencing site 232), AACAGCAAGCAACTTCTGTAT (PRL-1 silencing site 424). The numbers 149, 232, and 424 indicate the starting nucleotide number of shRNA-targeting sequences on the coding PRL-1 mRNA based on the published sequence data from Genbank (accession no. NM_003463). The specificity of each sequence was verified by a BLAST search of the public databases. pSilencer 4.1-CMV puro expression vectors (Ambion, Austin, TX) that produce shRNAs targeted against PRL-1 (named PRL-1-149i, PRL-1-232i, and PRL-1-424i) were also prepared according to the manufacturer's instructions. In brief, three sets of oligonucleotides were chemically synthesized: PRL-1-149 sense, 5'-GATCCGCAACTTATGACACTACTCTTCAAGAGAGAGTAGTGTCATAAGTTGCTTA-3'; PRL-1-149 antisense, 5'-AGCTTAAGCAACTTATGACACTACTCTCTCTTGAAGAGTAGTGTCATAAGTTGCG-3'; PRL-1-232 sense, 5'-GATCCCCAGATTGTTGATGACTGGTTCAAGAGACCAGTCATCAACAATCTGGTTA-3'; PRL-1-232 antisense, 5'-AGCTTAACCAGATTGTTGATGACTGGTCTCTTGAACCAGTCATCAACAATCTGGG-3'; PRL-1-424 sense, 5'-GATCCCAGCAAGCAACTTCTGTATTTCAAGAGAATACAGAAGTTGCTTGCTGTTA-3'; and PRL-1-424 antisense, 5'-AGCTTAACAGCAAGCAACTTCTGTATTCTCTTGAAATACAGAAGTTGCTTGCTGG-3' (the underlined sequences contribute to forming shRNAs). The annealed oligonucleotides encoding shRNAs were then subcloned into the BamHI-HindIII site of the pSilencer 4.1-CMV puro vector. For transfection, 1 x 105 cells were plated in six-well plates 24 before transfection in normal growth medium. Four micrograms of plasmid DNA and 250 µL LipofectAMINE 2000 (Invitrogen, Carlsbad, CA) were combined with 500 µL Opti-MEM I reduced-serum media (Invitrogen), incubated for 20 min at room temperature, and added to each well. After 24 h, the medium was replaced with basal medium Eagle (Invitrogen) with 2 µg/mL puromycin and 10% fetal bovine serum (FBS). After 2 weeks, stable round colonies were harvested and cloned by limiting dilution method.
RNA isolation and reverse transcription-PCR. Total RNA was extracted with the RNeasy Mini kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. Reverse transcription-PCR (RT-PCR) for PRL-1, PRL-2, PRL-3, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control was carried out in a volume of 50 µL by SuperScript III One-step RT-PCR System (Invitrogen) as per manufacturer's instruction. Following primer pairs were used for each reaction: PRL-1, 5'-ACCTGGTTGTTGTATTGCTGTT-3' (forward) and 5'-GTTGTTTCTATGACCGTTGGAA-3' (reverse); PRL-2, 5'-AGCCAGGTTGCTGTGTTGCAG-3' (forward) and 5'-CACAGCAATGCCCATTGGTA-3' (reverse); PRL-3, 5'-AAGGTAGTGGAAGACTGGCT-3' (forward) and 5'-GGTGAGCTGCTTGCTGTTGAT-3' (reverse); GAPDH, 5'-GATGGGTGTGAACCATGAGA-3' (forward) and 5'-CAGGGATGATGTTCTGGAGA-3' (reverse).
Lysis buffers, immunoprecipitations, Western blotting, and GTPase activation assay. Cells were lysed in modified radioimmunoprecipitation assay (RIPA) buffer containing 0.1% SDS, 1% Triton X-100, protease inhibitors (10 µg/mL leupeptin, 10 µg/mL apoprotein, 100 µg/mL AEBSF, 10 µg/mL soybean trypsin inhibitor, 1 mmol/L phenylmethylsulfonyl fluoride), and phosphatase inhibitors (2 mmol/L Na3VO4, 12 mmol/L ß-glycerol phosphate, and 10 mmol/L NaF). For immunoprecipitation, cells were lysed in modified RIPA buffer containing 0.05% SDS, 1% Triton X-100, protease inhibitors, and phosphatase inhibitors. Antibodies for immunoprecipitation (12 µg) were incubated with lysates (500 µg of protein) for 1 h at 4°C and were collected with 20 µL of Protein A/G PLUS-Agarose (Santa Cruz Biotechnology) for 1 h at 4°C. The immunoprecipitates were washed thrice with PBS followed by standard Western blotting procedures. The Rac and Cdc42 activation assays were done according to the manufacturer's instructions (Upstate Biotechnology). Briefly, cells were plated and lysed after 2 days of growth on fibronectin or noncoated dishes using a Mg lysis buffer supplemented with phosphatase inhibitors and protease inhibitors as described above. The cell lysate for the Rac activation assay was precleared for 10 min with glutathione S-transferase (GST) agarose beads (BD PharMingen, San Diego, CA). Lysates were then incubated with PAK-1 PBD-agarose for 45 min at 4°C. Beads were washed thrice with Mg lysis buffer, and samples were prepared for Western blotting. GTP-bound Rac1 and Cdc42 were identified by blotting with anti-Rac1 and anti-Cdc42 antibodies, respectively.
Cell proliferation, migration, and invasion assays. Cell proliferation was determined by trypan blue staining and cell counting. Cell motility assay was done using Transwell (6.5-mm diameter, 8-µm pore size polycarbonate membrane) obtained from Corning (Cambridge, MA). Cells (1 x 105) in 0.5 mL serum-free medium were placed in the upper chamber, and the lower chamber was loaded with 0.8 mL medium containing 10% FBS. Cells that migrated to the lower surface of filters were stained with Wright Giemsa solution, and five fields of each well were counted after 4 to 24 h of incubation at 37°C with 5% CO2. Three wells were examined for each condition and cell type, and the experiments were repeated thrice. The cell invasion assay was conducted using BD Biocoat Matrigel 24-well invasion chambers with filters coated with extracellular matrix on the upper surface (BD Biosciences, Bedford, MA). Control inserts were used for migration control. The experiments were done according to the manufacturer's protocol. We added 2.5 x 104 cells in 0.5 mL of serum-free culture medium to the upper chamber, and after incubation at 37°C for 24 h, we stained cells and determined total cell invasion and migration as described above. Invasiveness was expressed as the percent invasion for each cell type through the Matrigel matrix and membrane relative to the migration through the control membrane.
Cell adhesion and spreading assays. For cell adhesion, 2 x 105 cells were plated on noncoated, collagen I, fibronectin-, or laminin-precoated 12-well culture plates (BD Biosciences) at 37°C with 5% CO2. After a 60-min incubation, nonadherent cells were removed by washing twice with PBS. Adherent cells were stained with Wright Giemsa solution. For cell spreading assay, 1 x 106 cells were plated on extracellular matrixprecoated 35-mm culture dishes (BD Biosciences). Cells were allowed to spread for 30 to 120 min. Spread cells were defined as cells with extended process, lacking a round morphology and phase dim, whereas nonspread cells were rounded and phase bright under a phase-contrast microscope. For both adhesion and spreading assays, five fields in three wells or dishes were counted, and each experiment was repeated thrice.
Immunofluorescence. Cells were seeded on fibronectin-coated culture plate and fixed at the indicated time points with 4% paraformaldehyde at room temperature for 10 min. After three washes with PBS, cells were permeabilized for 5 min with 0.1% Triton X-100. After blocking with 1% bovine serum albumin, cells were incubated with the anti-pTyr397 FAK antibody for 2 h followed by incubation with Alexa Fluor 488conjugated anti-rabbit IgG for pTyr397 FAK and rhodamine phalloidin for actin organization (Invitrogen). The fluorescence images of cells were captured and analyzed using an ArrayScan VTI (Cellomics, Inc., Pittsburgh, PA).
| Results |
|---|
|
|
|---|
|
PRL-1 silencing decreased cell invasiveness. To investigate the role of PRL-1 in cancer cell metastatic processes, we did cell migration and invasion assays using Transwell migration and Matrigel invasion chambers, respectively. Surprisingly, PRL-1silenced clones migrated faster at 4 and 8 h than did control cells in the cell migration assay (Fig. 2A and B ). By 24 h, however, control cells achieved the same number of migrated cells per field as did the PRL-1 shRNA clones, suggesting that the initial elevated migration in PRL-1 knockdown cells might reflect altered adhesion. With the invasion assay, PRL-1silenced clones invaded significantly less than the parental cells or scramble cells (Fig. 2C and D).
|
|
PRL-1 knockdown decreased c-Src and p130Cas expression independent of FAK. To investigate the molecular mechanisms of PRL-1 cell adhesion, spreading, migration, and invasion, we examined the effect of PRL-1 knockdown on focal adhesion and downstream pathways. As shown in Fig. 4A , PRL-1 knockdown did not influence FAK expression, FAK phosphorylation status, and pTyr397 FAK or FAK interaction with c-Src as measured by coimmunoprecipitation. Interestingly, c-Src expression was markedly decreased in PRL-1 knockdown clones both with and without fibronectin stimulation. To examine c-Src stimulative (pTyr418) or regulatory (pTyr529) phosphotyrosine status, we immunoprecipitated c-Src. Overall, c-Src tyrosine phosphorylation seemed not to change. We found in cells grown on noncoated plates that both pTyr418 and pTyr529 Src levels decreased approximately proportional to the decrease in c-Src protein levels in PRL-1depleted cells (Fig. 4A). We conclude suppression of PRL-1 protein levels decreased c-Src expression with no apparent modification in the phosphorylation status of c-Src. Reduction of PRL-1 protein levels also decreased p130Cas levels in cells both with and without fibronectin stimulation. Paxillin expression was undetectable in cells grown in the absence of extracellular matrix, irrespective of the PRL-1 levels, whereas cells stimulated with fibronectin had prominent paxillin expression that was suppressed in PRL-1 knockdown cells.
|
We next examined microscopically the distribution of phosphorylated FAK and actin organization following PRL-1 silencing (Fig. 5A ). In PRL-1 knockdown 149i cells attached to fibronectin for 60 min, pTyr397 FAK distributed throughout the entire cell with high intensity spots in the cell periphery (Fig. 5A, f), and after 240 min, it distributed along with the actin stress fibers (Fig. 5A, l). This contrasted with SCR cells, which showed a peripheral distribution at 60 min but subsequently distributed predominantly to the central area and lamellipodium at 240 min (Fig. 5A, g and i). Remarkably, pTyr397 FAK staining predominated over actin staining in the cell spreading leading edge in 149i cells especially when compared with SCR cells (Fig. 5A, c and i), which would be consistent with focal adhesion occurring before actin extension and lamellipodium protrusion with the spreading of PRL-1 knockdown cells.
|
| Discussion |
|---|
|
|
|---|
1 and regulates integrin ß1 and extracellular signal-regulated kinase 1/2 (Erk1/2) phosphorylation. The preference of PRL-1depleted cells to bind to fibronectin suggests PRL-1 regulates a different extracellular matrix interaction than PRL-3 because integrins
1 and ß1 are receptors for collagen and laminin but not fibronectin. Kato et al. (19) examined DLD-1 colorectal cells after transient transfection and observed no difference in cell morphology and cell growth rate and a decrease in cell migration. Like Kato et al. (19), we found no significant difference in cell growth rate 48 h after cell plating. In contrast to Kato et al. (19), however, who only reported cell growth at one time point, we extended our study and found growth suppression 3 and 4 days after cell plating (Fig. 1D). We also examined cell migration at multiple time points and found that the initial migratory rate was elevated (Fig. 2A); we did not study cell migration at 48 h as did Kato et al. (19) but noted a saturation of cell migration at 24 h. It is possible that the difference between our results and those of Kato et al. (19) could reflect differences in the cell types or the methodologies employed. Nonetheless, both studies support an important role for PRL-1 in tumor cell adherence and invasion. To better explain the roles of PRL-1 in cell adhesion, spreading, and invasion, we focused on focal adhesion molecules and Rho family GTPases. Several phosphatases can control cell motility by modulating the phosphorylation status of focal adhesion molecules and cell-extracellular matrix interactions, which can alter actin cytoskeletal dynamics by regulating Rho family GTPase (35). For example, PTP-PEST dephosphorylates p130Cas and paxillin (21, 22). Tyrosine-phosphorylated paxillin recruits Crk to p130Cas (2325), which enlists the Rac GEF DOCK180-ELMO complex (26, 27), leading to Rac-GTP and actin polymerization in lamellipodia. PTP-PEST have recently been reported to couple membrane protrusion and tail retraction in cell migration by acting on VAV2 and p190RhoGAP to reciprocally modulate the activity of Rac1 and RhoA (28). Several phosphatases are also involved in the regulation of Src family kinases (SFK), which play key roles in cell differentiation, proliferation, survival, and motility. The chief phosphorylation sites of SFKs are Tyr418, which results in activation from autophosphorylation, and Tyr529, which results in inhibition from Csk phosphorylation. Under physiologic condition, Csk is known to be an upstream negative regulator of SFKs (29, 30). Dephosphorylation of pTyr529 increases SFKs activity. In our study, c-Src protein levels were decreased in PRL-1 knockdown cells. Initially, we thought PRL-1 knockdown might have influenced the c-Src tyrosine phosphorylation status, but our subsequent results indicated that fibronectin-stimulated regulation of c-Src phosphorylation status was independent of PRL-1 status. Furthermore, Csk expression correlated with c-Src expression (Fig. 4A and B), suggesting that PRL-1 was not directly associated with c-Src phosphorylation.
Upon extracellular matrix-integrin engagement, FAK autophosphorylation occurs at Tyr397, which creates a binding motif that is recognized by various SH2-domain containing protein, including SFKs (31). In our study, FAK expression and tyrosine phosphorylation, including pY397 FAK, were similar in control and PRL-1 knockdown cells (Fig. 4A). Time course experiments showed that they increased in a time-dependent manner in SCR cells, whereas they were persistently elevated in PRL-1 knockdown cells (Fig. 4B). This was consistent with the notion that adhesion turnover was delayed or deficient in PRL-1 knockdown cells. Tyr925 of FAK has been reported to be a Src-dependent phosphorylation site, and Src is required for adhesion turnover associated with cell migration in cancer cells (32). Src-mediated phosphorylation of FAK at Tyr925 creates an SH2-binding site for the growth factor receptorbound protein 2 (GRB2) adaptor proteins, which leads to the activation of Ras and the ERK2 cascade. The GRB2 and paxillin binding sites overlap and pTyr925 FAK might be selectively released from focal adhesion complexes (33). In nearly confluent cells, there were no differences in total tyrosine phosphorylation or phosphorylation at Tyr397 of FAK between control and PRL-1 knockdown cells (Fig. 4A). On the other hand, in the early phase of cell adherence, both total tyrosine and Tyr397 FAK phosphorylation in SCR cells were increased in a time-dependent manner, but they showed persistently higher levels in 149i cells compared with SCR cells (Fig. 4B). Differences were also noted in the kinetics of Tyr925 phosphorylation on FAK. In SCR cells, time-dependent Tyr925 phosphorylation was seen after placement on fibronectin presumably due to Src activation (32), whereas PRL-1depleted cells lacked significant phosphorylation of Tyr925 FAK in the early phase of cell adherence consistent with the lack of Src (Fig. 4B). This could contribute in FAK being localized persistently at focal adhesion complexes. Taken together, we speculate that the continuous FAK phosphorylation reflected decreased focal adhesion turnover.
Rac1 and Cdc42 activation were strongly inhibited in PRL-1depleted cells placed on fibronectin. This suggests that PRL-1 was directly involved with Rac1 or Cdc42 activation. Rho family GTPases, such as Rac1 and Cdc42, play central roles in controlling cell migration and actin cytoskeletal reorganization. Rho GTPases are closely associated with regulation of integrin signals and adhesion turnover (3437). Unexpectedly, reduction of PRL-1 increased cell spreading. Immunofluorescence of focal adhesion structure and actin organization suggested that focal adhesion staining was more diffusely spread in PRL-1 knockdown cells. The actin formation and lamellipodia extensions were decreased and seemed to lag behind focal adhesion after PRL-1 knockdown. The inhibition in Rac1 and Cdc42 activation after PRL-1 reduction would be consistent with delayed adhesion turnover and increased cell spreading due to continuous activation of focal adhesion complexes after PRL-1 knockdown.
Collectively, our results provide firm support for the involvement of PRL-1 in cell adhesion and migration processes via Rho family GTPases, which can regulate actin cytoskeletal rearrangement and focal adhesion turnover. Moreover, we document for the first time a functional role of PRL-1 in the processes of cell migration and invasion in nonsmall cell lung cancer. These findings suggest that therapies targeting PRL-1 may diminish the propensity for invasion and metastases in NSCLC.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Robert Tomko and Dr. Brian Reese for thoughtful comments.
| Footnotes |
|---|
Received 7/ 3/06. Revised 10/19/06. Accepted 11/16/06.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Gutierrez-Fernandez, A. Fueyo, A. R. Folgueras, C. Garabaya, C. J. Pennington, S. Pilgrim, D. R. Edwards, D. L. Holliday, J. L. Jones, P. N. Span, et al. Matrix Metalloproteinase-8 Functions as a Metastasis Suppressor through Modulation of Tumor Cell Adhesion and Invasion Cancer Res., April 15, 2008; 68(8): 2755 - 2763. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Daouti, W.-h. Li, H. Qian, K.-S. Huang, J. Holmgren, W. Levin, L. Reik, D. L. McGady, P. Gillespie, A. Perrotta, et al. A Selective Phosphatase of Regenerating Liver Phosphatase Inhibitor Suppresses Tumor Cell Anchorage-Independent Growth by a Novel Mechanism Involving p130Cas Cleavage Cancer Res., February 15, 2008; 68(4): 1162 - 1169. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Stephens, H. Han, G. Hostetter, M. J. Demeure, and D. D. Von Hoff Small interfering RNA-mediated knockdown of PRL phosphatases results in altered Akt phosphorylation and reduced clonogenicity of pancreatic cancer cells Mol. Cancer Ther., January 1, 2008; 7(1): 202 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Sun, Y. Luo, X. Yu, W.-Q. Wang, B. Zhou, F. Liang, and Z.-Y. Zhang Phosphatase Activity, Trimerization, and the C-terminal Polybasic Region Are All Required for PRL1-mediated Cell Growth and Migration J. Biol. Chem., September 28, 2007; 282(39): 29043 - 29051. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |