Cancer Research Meeting Calendar Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Cancer Research 67, 10406, November 1, 2007. doi: 10.1158/0008-5472.CAN-07-1228
© 2007 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Greeneltch, K. M.
Right arrow Articles by Abrams, S. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Greeneltch, K. M.
Right arrow Articles by Abrams, S. I.

Experimental Therapeutics, Molecular Targets, and Chemical Biology

Host Immunosurveillance Controls Tumor Growth via IFN Regulatory Factor-8–Dependent Mechanisms

Kristy M. Greeneltch1, Monika Schneider1, Seth M. Steinberg2, David J. Liewehr2, Trina J. Stewart1, Kebin Liu3 and Scott I. Abrams1

1 Laboratory of Tumor Immunology and Biology, 2 Biostatistics and Data Management Section, National Cancer Institute, NIH, Bethesda, Maryland; and 3 Department of Biochemistry and Molecular Biology, Medical College of Georgia, Augusta, Georgia

Requests for reprints: Scott I. Abrams, Laboratory of Tumor Immunology and Biology, Center for Cancer Research, National Cancer Institute, NIH, Building 10, Room 5B46, 10 Center Drive, Bethesda, MD 20892-1402. Phone: 301-496-4343; Fax: 301-496-2756; E-mail: sa47z{at}nih.gov.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IFN regulatory factor (IRF)-8 plays an important role in normal myelopoiesis. The loss of IRF-8 in myeloid cells results in a chronic myelogenous leukemia–like syndrome, suggesting that IRF-8 behaves as a tumor suppressor gene in certain hematopoietic malignancies. We have been investigating the molecular determinants of solid tumor progression, with an emphasis on apoptotic resistance. Recently, we showed that IRF-8 expression was directly correlated with Fas-mediated apoptosis, and inversely related to malignant phenotype. However, the functional role of IRF-8 in solid tumors is unresolved. We stably silenced IRF-8 expression via RNA interference in IRF-8–expressing mouse tumor cells, and evaluated them for changes in apoptotic phenotype and malignant behavior. Apoptosis induced by Fas engagement or irradiation was markedly reduced in IRF-8–deficient tumor cells, despite unaltered proliferation, cell surface Fas, or MHC class I expression. Moreover, in syngeneic immunocompetent mice, IRF-8–deficient tumor cells grew more aggressively than their control counterparts. However, in IFN-{gamma}– or Fas ligand–deficient mice, but not T cell–deficient mice, both control and IRF-8–deficient tumor populations grew similarly. Furthermore, both tumor populations grew similarly in mice with defects in innate immunity. Although subsequent studies precluded a role for natural killer cells, immunohistochemical analysis supported the involvement of macrophages. Overall, our findings show that IRF-8 expression in solid tumor cells is important for efficient host immunosurveillance and response to apoptotic stimuli. Therefore, IRF-8 down-regulation may represent a previously unrecognized tumor escape mechanism that facilitates tumor progression. Conversely, strategies aimed at up-regulating or restoring IRF-8 expression in neoplastic cells may improve therapeutic efficacy. [Cancer Res 2007;67(21):10406–16]


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The loss of sensitivity to cell death is considered one of several hallmarks of neoplastic growth and progression (1). We have been investigating whether increased resistance to Fas-mediated apoptosis is an important feature of tumor progression of solid malignancies. Fas down-regulation has been observed in the progression of various human cancers (2–6); however, the underlying mechanisms have remained unclear. If Fas-mediated cytotoxicity is an important innate or adaptive host defense mechanism that becomes compromised, this could lead to the emergence of Fas-resistant tumor escape variants (TEV) which exhibit enhanced neoplastic growth. Thus, the loss of Fas function has important implications for antitumor immune responses and tumor progression.

In human and mouse tumor cell line models, we (7–9) and others (3, 10–12) have shown that Fas-mediated apoptosis was induced or boosted after exposure to proinflammatory signals, i.e., IFN-{gamma} or low-dose {gamma}-irradiation. Using matched sets of poorly and highly malignant populations, we also showed an inverse relationship between Fas sensitivity and malignant phenotype (8). Moreover, Fas-refractory or Fas-resistant TEV, which displayed enhanced malignant abilities, were shown to emerge during CTL-tumor interactions in vivo (13). These observations suggest that (a) loss of sensitivity to Fas-mediated apoptosis is an important characteristic of more aggressive neoplastic subpopulations, and that (b) a Fas-dependent innate or adaptive immune response could promote the outgrowth of Fas-resistant TEV through a biologically imposed selection process. Characterization of the molecular basis for this differential Fas death response led to the identification of two genes: (a) IFN regulatory factor-8 (IRF-8), also known as IFN consensus sequence binding protein; and (b) caspase-1 of the Fas pathway.

IRF-8 is a member of the IFN-regulatory factor family of transcription factors, and is important for IFN-{gamma}–mediated signaling (14). IRF-8 expression is essential for myeloid cell development, differentiation, and function and was thought to be restricted to cells of the hematopoietic lineage (15, 16). This became evident in IRF-8-KO mice, which display a profound impairment in monocyte, macrophage, and dendritic cell functions, including deficiencies in IFN-{gamma} and interleukin-12 production, as well as a severely compromised capacity to resist various pathogenic challenges (17). Additionally, IRF-8 deficiency has been shown to alter normal hematopoiesis, leading to a marked accumulation of macrophages, neutrophils, and CD11b+Gr-1+ cells in both primary and secondary lymphoid compartments of IRF-8–null mice. Such IRF-8–deficient myeloid populations have also been shown to exhibit heightened levels of apoptotic resistance (18). Ultimately, IRF-8–null mice develop a chronic myelogenous leukemia (CML)–like syndrome (17). These manifestations reveal that IRF-8 plays a pivotal role in the regulation of cell death induction and the pathogenesis of certain hematologic malignancies. Together, these observations support the notion that, at least in certain myeloid malignancies, IRF-8 acts as a tumor suppressor gene.

Given the role of IRF-8 in the regulation of apoptosis in hematopoietic cells and CML development, we tested the hypothesis that the differential expression of IRF-8 in solid malignancies (19) governs their intrinsic tumorigenicity and/or their response to biological or immunomediated mechanisms of tumor destruction. Therefore, this study focused on the potential role of IRF-8 expression in the area of solid tumor cell biology. Specifically, we examined (a) whether IRF-8 expression in tumor cells was a causal determinant of apoptotic responsiveness, including Fas-mediated cytotoxicity and irradiation-induced death; (b) the consequences of the loss of IRF-8 expression on the cells' tumorigenic behavior in vivo; and (c) whether IRF-8–mediated alterations in tumor growth were due to intrinsic or extrinsic (host-dependent) factors. Our findings reveal that IRF-8 expression is important for responses to cell death, such as Fas-mediated apoptosis, lethal doses of {gamma}-irradiation, and host antitumor immunosurveillance mechanisms. Consequently, the loss or down-regulation of IRF-8 expression in cancerous cells may represent a previously unrecognized tumor escape mechanism that facilitates tumor progression through avoidance of, or resistance to, such forms of cell death induction.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice. Female BALB/c (H-2d), BALB/cAnNcr-nu/nu (henceforth termed BALB/c nude), athymic NCr-nu/nu (henceforth termed athymic nude), and bg-nu-XID mice were obtained from the National Cancer Institute-Frederick Cancer Research Animal Facility (Frederick, MD). Female IFN-{gamma}–deficient C.129S7(B6)IFNtm1Ts/J mice (henceforth termed IFN-{gamma} KO) and female FasL-deficient CPt.C3-Tnfsf6gld mice (henceforth termed gld), both on a BALB/c background, were obtained from The Jackson Laboratory (Bar Harbor, ME). Mice were maintained under specific pathogen–free conditions, and all experiments were conducted in accordance with NIH guidelines for animal care and use.

Cell lines. The CMS4 sarcoma cell line was provided by A. DeLeo (Department of Pathology, University of Pittsburgh, Pittsburgh, PA). All cells were maintained in complete RPMI 1640 containing 10% heat-inactivated fetal bovine serum (Gemini Bio-Products), 15 mmol/L of Hepes (Invitrogen), 2 mmol/L of L-glutamine (Biosource), 0.1 mmol/L of nonessential amino acids (Invitrogen), 100 units/mL of penicillin/100 µg/mL of streptomycin (Biosource), 1 mmol/L of sodium pyruvate (Invitrogen), and 50 µmol/L of 2-mercaptoethanol (Sigma-Aldrich).

Stable transfection of cells. CMS4 tumor cells were stably transfected with the following shRNA plasmids which contain the gene encoding green fluorescent protein (GFP): pshRNA-h7SKgz-control (ATACGCACTAAACACATCAA), pshRNA-h7SKgz-mIRF8-1 (GACCAGGCTTTCCGCATGTTT), and pshRNA-h7SKgz-mIRF8-2 (GCATGTTTCCGGATATCTGTA). All shRNA sequences were custom-designed using siRNA Wizard (InvivoGen). The shRNA-Control plasmids contained a scrambled, nontargeting sequence, whereas the shRNA-IRF8-1 and shRNA-IRF8-2 plasmids contained IRF-8–specific sequences. All sequences were cloned into psiRNA-h7SKgz plasmids by InvivoGen. Cells were stably transfected with shRNA plasmids using LipofectAMINE 2000 reagent (Invitrogen). Transfected cells were selected and maintained in culture media containing 2 mg/mL of zeocin (InvivoGen). GFP-high expressing tumor cells were sorted shortly after antibiotic selection on a FACSVantage SE cell sorter (Becton Dickinson). To verify the stability of the transfected phenotype, GFP expression by these cells was analyzed by flow cytometry prior to the initiation of all experiments.

Flow cytometric analysis. Transfection efficiency was determined by analyzing GFP expression in unfixed cells by flow cytometry using a FACSCalibur (Becton Dickinson). Transfected CMS4 cells (1 x 106) were cultured in complete RPMI media in the absence or presence of recombinant murine IFN-{gamma} (rmIFN-{gamma}, 200 units/mL; R&D Systems) for 24 h. MHC class I staining was done with anti–H-2Ld-PE (BioLegend), H-2Kd-PE (Becton Dickinson), and H-2Dd-PE (BioLegend) or isotype-matched control antibody (Becton Dickinson). Fas staining was done with anti–Fas-PE (Becton Dickinson) or isotype-matched control antibody (Becton Dickinson). Cells were fixed in 2% paraformaldehyde and analyzed by flow cytometry.

Reverse transcription-PCR analysis. Total RNA was isolated from cells using RNA STAT-60 reagent (Tel-Test), and used for first-strand cDNA synthesis using the ThermoScript reverse transcription-PCR (RT-PCR) system (Invitrogen). Reverse transcribed cDNA was used as a template for PCR amplification of mouse ß-actin, IRF-8, IRF-1, and caspase-1. PCR reactions were carried out in a PTC-200 thermal cycler (Bio-Rad Laboratories) with the following conditions: 94°C for 30 s, 30 cycles (94°C for 30 s, 60°C for 30 s, and 72°C for 1 min) and 72°C for 10 min. The PCR primers for ß-actin were as follows: forward primer (FP), 5'-ATTGTTACCAACTGGGACGACATG-3'; reverse primer (RP), 5'-CTTCATGAGGTAGTCTGTCAGGTC-3'. The PCR primers for IRF-8 were as follows: FP, 5'-CGTGGAAGACGAGGTTACGCTG-3'; RP, 5'-GCTGAATGGTGTGTGTCATAGGC-3'. The PCR primers for IRF-1 were as follows: FP, 5'-TAACTCCAGCACTGTCACCGTG-3'; RP, 5'-TATGCCTATCCCAATGTCCCC-3'. The PCR primers for caspase-1 were as follows: FP, 5'-AACATCTTTCTCCGAGGGTTGG-3'; RP, 5'-TCAGCAGTGGGCATCTGTAGC-3'.

Cell proliferation assays. CMS4, shRNA-Control, shRNA-IRF8-1, and/or shRNA-IRF8-2 cells were cultured in the absence or presence of rmIFN-{gamma} (200 units/mL) at varying cell densities. Cells were seeded in triplicate in flat-bottomed 96-well plates. Cells were incubated for 24 or 72 h. [3H]Thymidine (1 µCi/well) was added to cultures during the last 18 h of incubation. Postincubation, 10 mmol/L of EDTA was added and cells were incubated for 30 min at 37°C to facilitate cell detachment. Cells were harvested using an automated plate harvester (TOMTEC) and total [3H]thymidine incorporation was quantified by liquid scintillation using a 1205 Betaplate counter (Perkin-Elmer).

Colony formation assays. shRNA-Control and shRNA-IRF8-2 cells were cultured in triplicate at 500 cells/10 mL in complete RPMI 1640 in T-75 flasks. Cells were incubated for 7 days to allow colonies to form. Cells were washed gently with PBS and fixed with 100% methanol for 30 min at room temperature. Flasks were washed gently with PBS and colonies were stained with 1% crystal violet at room temperature for 10 min. Flasks were washed with water, air-dried, and the number of colonies quantified under light microscopy. Results are reported as the mean colonies/flask ± SE of triplicate determinations.

Cell death assays. For FasL-induced apoptosis assays, 1 x 105 tumor cells were cultured in six-well plates for 24 h in the presence of rmIFN-{gamma} (200 units/mL). Recombinant soluble human FasL (sFasL, 100 ng/mL; Peprotech) was subsequently added and cultures were incubated for an additional 24 h. For radiation-induced apoptosis assays, tumor cells were irradiated at 0 to 200 Gy using a Cs-137 source (Gammacell-1000 irradiator; AECL/Nordion) and cultured for 48 h prior to analysis. For all apoptotic assays, adherent and suspension cells were collected. Cells were resuspended in 100 µL of PBS containing 10 µL of propidium iodide (PI)/RNase solution (R&D Systems), incubated for 10 min at room temperature and analyzed by flow cytometry. For FasL-induced apoptosis assays, the percentage of cell death was calculated as follows: % cell death = (% PI+ cells treated with FasL and IFN-{gamma}) minus (% PI+ cells treated with IFN-{gamma}). Caspase-3 activation in untreated or irradiated tumor cells was assessed by flow cytometry using PE-conjugated rabbit anti-active caspase-3 monoclonal antibody, as described by the manufacturer (Becton Dickinson).

Tumor growth experiments. For subcutaneous tumor growth experiments, mice were injected with 5 x 105 tumor cells, suspended in HBSS, in the right flank. Tumor growth was measured thrice weekly in two dimensions, using a digital caliper. Tumor volumes were calculated as follows: tumor volume (cm3) = (width2 x length) / 2. For experimental lung metastasis experiments, 2.5 x 105 tumor cells (in 100 µL volume) were injected i.v. into the lateral tail vein of naïve, immunocompetent, BALB/c mice. Mice were euthanized 21 days after tumor inoculation. To stain tumor nodules, lungs were injected with a 15% solution of India ink, resected, and fixed in Fekete's solution (13, 20). Total tumor foci in all lung lobes were enumerated in a single-blind manner. For natural killer (NK) cell depletion experiments in vivo, athymic nude mice were treated with or without rabbit anti–asialo-GM1 antibody (Cedarlane), as previously described (21, 22), for the duration of the experiment using the protocols according to the manufacturer's instructions. Briefly, in the first experiment, mice were injected i.p. with 0.2 mL of an 8 mg/mL gammaglobulin fraction, commencing on the day of tumor implantation and continuing every 4 to 5 days thereafter. In a second independent experiment, mice were injected i.v. (at the same concentration), but commencing 4 days prior to tumor implantation. In control experiments, NK depletion was verified by flow cytometric analysis of splenocytes of saline-treated versus antibody-treated mice using anti–CD49b-PE monoclonal antibody (clone DX5; Becton Dickinson).

Immunohistochemistry. For immunohistochemical analysis, 5-µm sections were cut from formalin-fixed, paraffin-embedded tissues taken from explants of athymic nude mice bearing either shRNA-Control or shRNA-IRF8-2 tumor cells, which were mounted onto glass slides, as described previously (8). Tumors were resected at day 13 postimplantation. Specimens were stained with H&E for histology or prepared for immunohistochemistry using the following primary antibodies or the appropriate isotype control antibodies for rabbit anti-human CD3 (1:600 dilution; Dako), biotinylated rat anti-mouse CD45R/B220 (1:200 dilution; Becton Dickinson), rat anti-mouse F4/80 (1:50 dilution; Invitrogen), or rabbit anti-human myeloperoxidase (1:1,000 dilution; Dako). Previous experiments revealed that these anti-human antibodies cross-reacted well with mouse tissues. Prior to staining, the sections were deparaffinized and rehydrated with PBS. Specimens were then heat-treated for antigen retrieval. Endogenous peroxidase activity was blocked using a 2% hydrogen peroxide/methanol solution. Specimens were incubated for 30 to 60 min with the primary antibody, rinsed and stained with an appropriate secondary antibody (i.e., goat anti-rabbit, rabbit anti-rat, or rat anti-mouse biotinylated antibody, for another 30 min). Species-specific Vectastain Elite ABC kits were used for the blocking, secondary antibody, and immunoperoxidase steps, as described by the manufacturer (Vector Laboratories). Color was developed by incubation with 3'3-diaminobenzidine solution, followed by counterstaining with hematoxylin. Images were acquired and processed by a computer equipped with a Nikon DXM1200F ACT-1 digital camera mounted on an Olympus BH-2 microscope.

Statistical analysis. Statistical analysis for cell death assays and tumor growth in the lungs was determined using two-sample, two-tailed Student's t tests, with P < 0.05 considered statistically significant. Statistical analyses of differences in tumor growth size for all in vivo subcutaneous experiments were done using Wilcoxon rank sum tests at those time points for which complete or nearly complete data were present; other, later time points were excluded due to potential biases. For in vivo tumor growth experiments, because many time points were being evaluated within each experiment, in order to take the multiple comparisons into consideration, only P < 0.01 was considered statistically significant, whereas values at 0.01 < P < 0.05 would be considered trends. Overall survival was assessed in immunocompetent mice by a Kaplan-Meier plot, and statistical analysis was done using a two-tailed log-rank test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Development and characterization of CMS4-shRNA-IRF-8 cells. To ascertain the functional role of IRF-8 in solid tumor cell growth, survival, or response to death-inducing stimuli, IRF-8 expression was silenced in an IRF-8–expressing tumor cell line (i.e., CMS4 sarcoma) via RNA interference. Tumor cells were stably transfected with plasmids containing a nontargeting control (shRNA-Control) or one of two different shRNA constructs targeting IRF-8 (shRNA-IRF8-1 and shRNA-IRF8-2). The stability of shRNA expression was analyzed and verified by GFP expression (Fig. 1A ). Untransfected and transfected cells were cultured in the absence or presence of IFN-{gamma}, which is a principal stimulus for IRF-8 induction (14). RT-PCR analysis of tumor cells revealed that shRNA-IRF8-1 and shRNA-IRF8-2 cells had strongly reduced IFN-{gamma}–inducible IRF-8 levels compared with both untransfected and shRNA-Control cells (Fig. 1B). RT-PCR analysis also revealed relatively weak expression of basal IRF-8 transcripts, which was undetectable in shRNA-IRF8-2 cells. Given that IFN-{gamma} up-regulates the expression of various IRF family members, including IRF-1 (14), we evaluated both control and IRF-8–deficient tumor cell populations for potential changes in IRF-1 mRNA levels. RT-PCR analysis revealed that all groups of tumor cells expressed constitutive levels of IRF-1 mRNA that further increased similarly after IFN-{gamma} treatment (Fig. 1B). Overall, IRF-1 expression remained intact and was unaffected by the loss of IRF-8 in the IRF-8–deficient tumor cells. Similarly, the expression of an unrelated gene, caspase-1, was unaltered in all tumor cell populations, which further supported the specificity of these shRNA-IRF8 constructs to target IRF-8 (Fig. 1B).


Figure 1
View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. Generation and characterization of CMS4-shRNA-IRF8 cells. CMS4 cells were stably transfected with GFP-expressing shRNA plasmid constructs using LipofectAMINE 2000 and selection in zeocin. shRNA-Control refers to CMS4 cells expressing a nontargeting control sequence; shRNA-IRF8-1 and shRNA-IRF8-2 refer to two independently produced CMS4 transfectants expressing distinct shRNA-IRF8 sequences. A, GFP expression as determined by flow cytometry. Untransfected CMS4 cells (gray-shaded area). B, RT-PCR analysis of the indicated transcripts. Untransfected or transfected CMS4 cells were incubated for 48 h either in the absence (media alone) or presence of rmIFN-{gamma} (200 units/mL) prior to RNA isolation. C, surface MHC class I expression on untreated and IFN-{gamma}–treated CMS4 transfectants. Staining with isotype control antibodies (shaded areas). D, surface Fas expression on untreated and IFN-{gamma}–treated cells. All results are representative of a minimum of three independent experiments.

 
Surface expression of MHC class I H-2d antigens on tumor cells was examined following culture in the absence or presence of IFN-{gamma} (Fig. 1C). We found that reduction of IRF-8 expression did not alter the surface levels of the three major H-2d MHC class I antigens examined (Fig. 1C). Comparable levels of IFN-{gamma}–induced expression of the three class I antigens was observed on both control and IRF-8–deficient tumor cells (Fig. 1C). Moreover, constitutive and IFN-{gamma}–inducible Fas surface expression was slightly, but not substantially, reduced on shRNA-IRF8-2 cells as compared with control cells (Fig. 1D). Both control and IRF-8–deficient tumor cells were responsive to Fas up-regulation after IFN-{gamma} treatment. Taken collectively, these observations show that the loss of IRF-8 expression via RNA silencing did not globally impair the expression of other genes or gene products, such as MHC, Fas, or caspase-1.

IRF-8 deficiency does not alter tumor cell proliferation in vitro. In order to determine whether IRF-8 deficiency alters the proliferation of these tumor cells in vitro, cells were cultured for 24 h in the absence or presence of IFN-{gamma} (Fig. 2A ). There was no significant alteration of cell proliferation, as measured by [3H]thymidine incorporation, of shRNA-IRF8 cells either in the absence or presence of IFN-{gamma}. Similar results were observed after culture for 72 h (data not shown). In addition, cell proliferation was analyzed by longer-term colony formation assays. We compared shRNA-IRF8-2 cells to the vector control and observed no significant difference (P = 0.053) in the number of colonies formed between these two cell populations (262 ± 9 versus 205 ± 8, respectively). These results indicate that IRF-8 does not function to significantly or profoundly influence the proliferation of CMS4 tumor cells in vitro.


Figure 2
View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. IRF-8 deficiency does not affect tumor cell proliferation, but does enhance resistance to Fas- and irradiation-induced death in vitro. A, untransfected and transfected CMS4 cells were cultured at varying cells densities for 24 h in the absence (left) or presence (right) of rmIFN-{gamma} (200 units/mL). [3H]Thymidine was added in the final 18 h of incubation. B, Fas-mediated apoptosis of CMS4 transfectants. Left, tumor cells were incubated for 24 h in the presence of rmIFN-{gamma} (200 units/mL), followed by a subsequent 24-h culture with sFasL (100 ng/mL). Cell death was quantified by flow cytometric analysis of PI-stained cells using the formula in Materials and Methods (columns, means of three independent experiments; bars, SE). Right, irradiation-induced cell death. Tumor cells were exposed to increasing doses of radiation, cultured for 48 h and cell death was analyzed as for Fas-induced death (points, means of three independent experiments; bars, SE). Asterisks, P values for shRNA-Control versus shRNA-IRF8-1 or shRNA-IRF8-2 at 100 (*), 150 (**), or 200 (***) Gy. *, shRNA-IRF8-1 (P = 0.01) and shRNA-IRF8-2 (P = 0.002); **, shRNA-IRF8-1 (P = 0.02) and shRNA-IRF8-2 (P = 0.004); ***, shRNA-IRF8-1 (P = 0.02) and shRNA-IRF8-2 (P = 0.05). C, shRNA-Control and shRNA-IRF8-2 tumor cells were left untreated (left) or irradiated at 120 Gy (right), cultured for 48 h, and then analyzed for active caspase-3 by flow cytometry. Marginal levels of active caspase-3 were detectable at 24 h (data not shown).

 
IRF-8 plays a role in Fas- and irradiation-induced tumor cell death. We recently showed a direct correlation between Fas sensitivity and IRF-8 expression in a human colon carcinoma cell line model (19). Therefore, in order to determine a mechanistic link between IRF-8 expression and apoptotic sensitivity using this approach, control and IRF-8–deficient CMS4 tumor cells were evaluated for sensitivity to both extrinsic (Fas) and intrinsic (irradiation) forms of apoptotic induction. Tumor cells were cultured in the presence of IFN-{gamma} for 24 h to sensitize them to Fas-mediated apoptosis as previously described (19), followed by another 24 h of culture with recombinant sFasL to induce cell death. The percentage of Fas-induced cell death was significantly reduced in both shRNA-IRF8-1 (P < 0.0005) and shRNA-IRF8-2 (P < 0.05) transfectants compared with the controls (Fig. 2B).

Next, we tested whether differential expression of IRF-8 affected tumor cell response to irradiation-induced cell death (Fig. 2B). Interestingly, both shRNA-IRF8-1 and shRNA-IRF8-2 cells were significantly less sensitive to irradiation-induced cell death at lethal doses of irradiation (100, 150, and 200 Gy) compared with control cells. We also evaluated caspase-3 activation following irradiation (23, 24), and whether both control and IRF-8–deficient tumor cells were differentially responsive. In these experiments, we compared the control to one of the IRF-8–deficient tumor cell populations (IRF8-2) at 120 Gy (Fig. 2C), a dose range found to significantly distinguish the two groups of cells for radiosensitivity (Fig. 2B). We showed that the IRF-8–deficient tumor cells were markedly less sensitive to irradiation-induced caspase-3 activation as compared with the control population. In contrast, caspase-3 activation was not detectable in untreated tumor cells. Similar patterns were observed using Annexin V staining (data not shown). Overall, these results indicate that IRF-8 is an important molecular determinant for both Fas and irradiation-induced tumor cell death.

IRF-8 deficiency enhances tumor growth in immunocompetent mice. Next, we examined the effect of IRF-8 deficiency on malignant behavior in vivo. The discovery that IRF-8 deficiency in null mice contributes to CML development (17) and our observation that IRF-8 deficiency renders CMS4 cells more resistant to apoptosis (Fig. 2) suggested that IRF-8 may affect their intrinsic tumorigenicity. Because shRNA-IRF8-1 and shRNA-IRF8-2 cells were similar in the various in vitro parameters examined, we selected one cell line, shRNA-IRF8-2, for use in all subsequent in vivo experiments. Tumor cells were injected s.c. into normal BALB/c mice and growth was measured over time. In the shRNA-Control group, progressive tumor growth was observed in 14 of 20 mice. Three mice did not form tumors, whereas another three mice rejected their tumors soon after implantation, indicating some level of immunogenicity and the presence of a host-tumor immunosurveillance response (Fig. 3A ). All animals in the shRNA-IRF8-2 group (n = 20) developed progressive tumor growth (Fig. 3A). Moreover, the growth of shRNA-IRF8-2 cells was significantly greater (P < 0.01, at all time points examined) as compared with that of control tumor cells (Fig. 3D). The horizontal dashed line in the graphs provides another perspective to illustrate the differences in tumor incidence and size between the two groups of tumor-bearing mice. For example, on day 20 postimplantation, the number of mice with tumor volumes ≥0.5 cm3 was 6 of 20 for the control cells and 17 of 20 for the IRF-8–deficient cells. Overall, such differences in tumor growth unlikely reflected changes in transfection stability because tumor explants of mice bearing either control or shRNA-IRF8-2 cells retained GFP expression ex vivo (data not shown).


Figure 3
View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. IRF-8 deficiency enhances tumor growth in immunocompetent mice. A, BALB/c mice were injected s.c. with 5 x 105 shRNA-Control or shRNA-IRF8-2 cells and tumor growth was measured. Solid lines, tumor growth for an individual mouse (n = 20/group). Mice were euthanized when tumor volume approached the ethical limit of 2 cm3 or for other ethical considerations, and the experiment was terminated on day 35 postimplantation. Data are pooled from two independent experiments. Horizontal dashed line, an arbitrary point of reference for assessing the number of mice with tumors (≥0.5 cm3) at any given time point. B, tumor growth in the lungs of BALB/c mice. Mice were injected i.v. with 2.5 x 105 cells and 3 wk postinjection, mice were euthanized and the resected lungs were stained. Photographs were taken of whole lungs of 10 mice/group. C, enumeration of lung tumor nodules, including those of mice in B. Points, total lung nodules for an individual mouse (n = 19 for shRNA-Control and n = 20 for shRNA-IRF8-2). Horizontal bar, the mean of the data points/group. P < 0.0003 for the number of tumor nodules between the two groups of tumor-bearing mice. D, overall survival of mice in A (left) and summary of the statistical analyses of all s.c. tumor growth experiments in A and Figs. 4 and 5 (right). For each of the different experiments, and at each time point which contained complete or nearly complete data, shRNA-Control and shRNA-IRF8-2 tumor cells were compared using the Wilcoxon rank-sum test. Points, P values for an individual day when measurements were recorded and adequate data were present. Because of multiple comparisons, only time points with P < 0.01 would indicate significant differences (dashed line). For the BALB/c nude experiment, the four significant P values (P < 0.01) were obtained on days 7, 13, 15, and 17; for the IFN-{gamma} KO experiment, the one significant P value was obtained on day 18; for the gld experiment, the two significant P values were observed at days 17 and 19.

 

Figure 4
View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. Host-derived IFN-{gamma} and FasL control growth of CMS4 cells via an IRF-8–dependent mechanism. The contribution of host-derived IFN-{gamma} or FasL in regulating the growth of CMS4 transfectants was analyzed using IFN-{gamma} KO or gld mice. A, subcutaneous tumor growth of shRNA-Control and shRNA-IRF8-2 cells (5 x 105 cells) was measured in syngeneic IFN-{gamma} KO mice, as in Fig. 3A. Solid lines, tumor growth for an individual mouse (n = 18 for shRNA-Control and n = 17 for shRNA-IRF8-2). Data are pooled from two independent experiments. B, subcutaneous tumor growth of shRNA-Control cells (n = 9) and shRNA-IRF8-2 cells (n = 10; 5 x 105 cells/mouse) in gld mice, as in A. Data are pooled from two independent experiments. Horizontal dashed lines, see Fig. 3A.

 

Figure 5
View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. Innate immunity controls CMS4 tumor growth via an IRF-8–dependent mechanism. The contribution of the host immune response in regulating the growth of CMS4 transfectants was analyzed using immunodeficient mouse strains. A, subcutaneous tumor growth of shRNA-Control and shRNA-IRF8-2 cells (5 x 105 cells) in BALB/c nude mice as described in Fig. 3A. Solid lines, tumor growth for an individual mouse (n = 5 for shRNA-Control and n = 10 for shRNA-IRF8-2). B, subcutaneous tumor growth of shRNA-Control and shRNA-IRF8-2 cells (5 x 105 cells) in bg-nu-XID mice (n = 10/group), as in A. Horizontal dashed lines, see Fig. 3A. C, effect of NK depletion in vivo on tumor growth. Subcutaneous tumor growth of shRNA-Control and shRNA-IRF8-2 cells (5 x 105 cells) in athymic nude mice as described in A in the absence (saline-treated) or presence of anti–asialo-GM1 antibodies. Solid or dotted lines, tumor growth for an individual mouse (n = 5 for saline- and antibody-treated mice).

 
Differences in tumorigenic behavior between these two groups of tumor-bearing mice were also assessed by overall survival (Fig. 3D). None of the mice in either group became moribund or died of natural causes while under observation for up to 35 days. The median time to euthanasia as a result of developing excessive tumor volume (as required per Animal Care and Use Committee guidelines) was 27 days for the mice bearing shRNA-IRF-8 cells and was not observed in mice receiving the shRNA-Control cells. However, by day 35, there was a 59% probability that the control group required euthanasia due to excessive tumor volume. The difference in overall survival between both groups of tumor-bearing mice was significant (P = 0.0004). Lastly, we analyzed the ability of shRNA-Control and shRNA-IRF8-2 cells to form experimental lung metastases in normal BALB/c mice after i.v. injection (Fig. 3B and C). Control transfected cells grew few nodules in the lungs as has been previously described for CMS4 cells (8, 9). Interestingly, IRF-8–deficient cells grew substantially and significantly more tumor nodules in the lungs as compared with control cells (Fig. 3B and C). These results indicate that IRF-8 deficiency enhances both subcutaneous tumor growth and the formation of experimental lung metastases in immunocompetent mice.

IFN-{gamma} and FasL control growth of tumor cells via an IRF-8–dependent mechanism in vivo. To determine whether the differences in tumor incidence and size between these two groups of tumor-bearing mice (Fig. 3A) were due to intrinsic or extrinsic (host-dependent) factors, these subcutaneous in vivo experiments were repeated in various immunodeficient mouse strains. The prediction was that if the differences in tumor size reflected differences in the susceptibility of tumor cells to IRF-8–dependent innate or adaptive immune responses, then the elimination of a particular effector mechanism should enable both groups of tumor cells to grow to comparable sizes over time.

We first examined the role of host-derived IFN-{gamma} and FasL using IFN-{gamma} KO mice and FasL-deficient (gld) mice, which was based on our observations that IFN-{gamma} was important for the up-regulation of IRF-8 (Fig. 1B) and that IFN-{gamma}–induced IRF-8 up-regulation sensitized control tumor populations to Fas-mediated apoptosis (Fig. 2B). Conversely, in IRF-8–deficient tumor cells (e.g., shRNA-IRF8-2), the loss of IRF-8 was causally linked to a reduction in Fas sensitivity (Fig. 2B). Consistent with this notion, in IFN-{gamma} KO mice (Fig. 4A ), tumor growth was not significantly different between IRF-8–deficient and control cells at five of six time points measured (Fig. 3D). Similarly, there were no significant differences in tumor growth between the two cell lines at five of seven time points in gld mice (Figs. 3D and 4B). Thus, using IFN-{gamma}–deficient and FasL-deficient mice, these data support the hypothesis that endogenous (host-derived) IFN-{gamma} produced during the process of tumor growth modulates IRF-8 expression, which, in turn, sensitizes these tumor cells to a FasL-dependent immune response.

Growth of CMS4 cells is regulated by innate immunity in an IRF-8–dependent manner. The results in FasL-deficient mice, as well as in the in vitro proliferation assays (Fig. 2A), supported the contention that IRF-8 expression likely affected tumor growth in vivo (Fig. 3) in response to extrinsic mechanisms of immunosurveillance rather than to intrinsic factors that potentially affected cell autonomous behavior. To further evaluate this notion, we did these in vivo experiments in BALB/c nude or bg-nu-XID triple-deficient mice, which are deficient in functional T and functional T, B, and NK cells (25–28), respectively. Thus, as with the experiments in IFN-{gamma}– and FasL–deficient mice, we hypothesized that in the absence of a relevant host defense mechanism, the growth differences between IRF-8–expressing and IRF-8–deficient tumor populations would no longer be significant.

Interestingly, at the majority of time points measured (Fig. 3D), the shRNA-IRF8-2 cells (Fig. 5A ) still maintained a significant growth advantage over shRNA-Control cells in BALB/c nude mice. Similar patterns were observed in the athymic nude mouse strain (Fig. 5C). However, when tumor cells were injected into bg-nu-XID mice, both shRNA-Control and shRNA-IRF8-2 (Fig. 5B) cells grew similarly, with no significant differences in the growth of the two cell lines noted at any of the six time points measured (Fig. 3D). The bg-nu-XID mice have a similar immunologic defect as the SCID/beige mouse and are commonly used for studies of innate or NK-mediated immunity (25–28). These results indicate that an innate immune response, acting in a tumor cell–associated IRF-8–dependent manner, plays an important role in controlling the growth of these tumor cells in vivo.

Therefore, to further evaluate the functional role of NK cells in controlling the growth of IRF-8–expressing tumor cells, we conducted NK depletion experiments using anti–asialo-GM1 antibodies (21, 22) in athymic nude mice (Fig. 5C) in which a significant difference in tumor growth between both control and shRNA-IRF8-2 populations was shown. Furthermore, the use of the nude mouse for these studies allowed us to analyze the contribution of NK cells without the potential complexity of interactions with elements of the adaptive immune system. Interestingly, our data revealed that despite NK depletion using this approach, we observed no significant increase in the growth of the control tumor cells compared with untreated mice (Fig. 5C). Furthermore, the differences in growth between control tumor cells in the antibody-treated mice as compared with shRNA-IRF8-2 cells (in either untreated or antibody-treated mice) were still maintained at all time points measured (Fig. 5C). Similar results were observed in a second independent experiment using a slightly modified schedule of antibody administration, whereby anti–asialo-GM1 was given prior to tumor implantation (data not shown).

Taken together with the bg-nu-XID mice experiments, these results support a role for an NK-independent innate immune response. To evaluate this notion further, we conducted an immunohistochemical analysis of tumor explants from athymic nude mice bearing either control or IRF-8–deficient tumor cells for infiltration of two other major innate immune cell types, macrophages and neutrophils, as assessed by F4/80 and myeloperoxidase staining, respectively (Fig. 6 ). Our findings revealed substantial infiltration of macrophages in both groups of tumor-bearing mice. Isotype control staining for F4/80 was negative. In contrast to the intense staining for macrophages, we observed only a marginal infiltration of neutrophils, as well as a rare or occasional B cell or T cell, the latter of which is consistent with the immune defect in nude mice. Collectively, these data indicate a potentially important tumor immunosurveillance role for macrophages in controlling the growth of CMS4 cells in vivo and their ability to do so requires the presence of functional endogenous IRF-8 within the tumor cell.


Figure 6
View larger version (81K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 6. Immunohistochemical analysis of tumor explants for infiltrating leukocytes. Paraffin-embedded tumor tissue sections were prepared from athymic nude mice 13 d postimplantation of either the shRNA-Control or shRNA-IRF8-2 cells for H&E or immunohistochemistry for the indicated immune cell type. Normal rat IgG2a was used as the isotype control for F4/80. The average tumor volume of the control and IRF-8–deficient CMS4 cells (five mice per group) was 0.7 ± 0.1 and 1.5 ± 0.3 cm3, respectively. Photomicrographs are representative of five separate mice per group (magnification, x400).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Previously, we identified the expression of IRF-8 in solid tumor models, which directly correlated with Fas-mediated apoptosis, and was inversely related to a malignant phenotype (19). To further explore the role of IRF-8 in solid tumors, we silenced IRF-8 expression via RNA interference in a Fas- and IRF-8–expressing mouse tumor model, termed CMS4. Using this tumor model, our studies revealed that IRF-8 expression in neoplastic cells was integral for (a) Fas (extrinsic)-, as well as irradiation (intrinsic)-induced apoptosis; (b) inhibiting tumorigenic behavior in immunocompetent hosts; and (c) effective host immunosurveillance involving at least three key elements, innate effector cells (e.g., macrophages), IFN-{gamma} production, and FasL expression. Thus, we showed for the first time that IRF-8 expression in solid neoplastic cells is important for host antitumor activity during immunosurveillance and response to cytotoxic or apoptotic stimuli. Therefore, the loss or down-regulation of IRF-8 expression in neoplastic cells may represent a previously unrecognized tumor escape mechanism that facilitates tumor progression.

The IFN-{gamma} pathway plays an important role in host-tumor immunosurveillance (29, 30) and proinflammatory antitumor responses, in part, by sensitizing tumor cells to apoptosis (11, 19). IFN-{gamma} has also been shown to activate the transcription of IRF-8 in both immune cells (14, 31, 32) and tumor cells (19). We showed that stable transfection of tumor cells with shRNA constructs targeting IRF-8 specifically reduced IFN-{gamma}–inducible IRF-8 levels. IRF-8 has been shown to bind to the MHC class I promoter (31) and, in some cases, suppress the expression of class I genes (33). In our experiments, however, we did not observe any obvious reduction in cell surface class I levels in these IRF-8–deficient tumor cells, which may be due in part to cell type–specific interactions that require further study. We also analyzed the expression of IRF-1, caspase-1, and Fas to assess potential off-target effects of this molecular approach, and in all instances, observed no significant or profound adverse effects on the de novo or IFN-{gamma}–inducible expression levels of these molecules. However, we found that IRF-8 expression is involved in the regulation of apoptosis in these solid tumor cells, which is consistent with other studies on hematopoietic cells (18, 34–36). We observed that IRF-8–deficient CMS4 cells were significantly more resistant to both Fas-mediated and irradiation-induced cell death, indicating that IRF-8 mediates tumor suppressor–like activity.

The role of IRF-8 as a tumor suppressor component in solid tumor models is also supported by our earlier studies (19, 37), which revealed that ectopic expression of IRF-8 in human colon carcinoma cells promotes Fas-mediated apoptosis of IFN-{gamma}–sensitized cells. Ectopic expression of IRF-8 has also been shown to promote IFN-{gamma}–mediated apoptosis in a transgenic murine ocular model of epithelial carcinoma (38). However, the precise molecular mechanism(s) by which IRF-8 promotes Fas- or irradiation-induced cell death in solid tumor models requires further investigation. IRF-8 could be involved as a downstream determinant that interfaces with elements of the Fas pathway to modulate the expression of proapoptotic signaling components, such as caspases (18). This may be analogous to the role of IRF-4, a lymphoid-restricted IRF family member, in regulating caspase-8 activation in lymphoid models (39). Also, in myeloid cells, IRF-8 has been shown to down-regulate the expression of the antiapoptotic genes, Bcl-2 (34) and Bcl-XL (18), which may help explain, in part, the decreased sensitivity of IRF-8–deficient tumors to lethal doses of ionizing radiation. Nonetheless, the modes of action of IRF-8 in both extrinsic and intrinsic death pathways are likely complex and warrant further investigation.

Because IRF-8 deficiency in CMS4 cells altered their apoptotic phenotype, we hypothesized that IRF-8 deficiency might also affect their malignant behavior. Indeed, we observed that IRF-8 deficiency significantly enhanced the ability of CMS4 cells to grow subcutaneously, as well as to form experimental lung metastases. The observations that IRF-8 deficiency did not alter tumor cell proliferation in vitro, but seemed to do so in vivo in immunocompetent mice suggested that IRF-8 more likely affected tumor cell response to cytotoxic mechanisms of host immunosurveillance. A number of studies have characterized important roles for elements of both innate and adaptive immunity during tumor immunosurveillance (29, 30, 40–43). For example, experiments using IFN-{gamma}–deficient or IFN-{gamma} receptor–deficient mice have revealed that IFN-{gamma} produced by T cells, NK cells, or both populations are necessary to protect the host during tumor immunosurveillance (42, 43). We postulated that activation of IRF-8 by endogenously produced IFN-{gamma} might be a key component in regulating the growth of at least some tumors in vivo by enhancing host antitumor activity. Therefore, to analyze the importance of host-derived IFN-{gamma} in our tumor studies, we employed IFN-{gamma}–null mice. Interestingly, we found that tumor growth was not significantly different at the majority of time points analyzed between IRF-8–deficient and control tumor cells in IFN-{gamma}–null mice, showing that IFN-{gamma} plays an important role in determining the growth of CMS4 cells in vivo. Moreover, these observations are consistent with the important role of IFN-{gamma} for the regulation of IRF-8 expression, as shown here, and originally elsewhere (14, 31). Next, based on our studies which revealed that IRF-8 deficiency reduced the sensitivity of CMS4 tumor cells to Fas-mediated apoptosis in vitro, we analyzed the role of the Fas pathway in vivo using FasL-deficient gld mice. Furthermore, the importance of this death receptor pathway has been shown in various models of tumor destruction or rejection mediated by innate (e.g., NK cells, macrophages) or adaptive (e.g., CTL) immune cells (20, 44–47). We found that the growth of IRF-8–deficient CMS4 cells was similar to that of their control counterparts at the majority of time points analyzed. These findings support an important role for host-derived FasL in controlling the growth of CMS4 cells in vivo, which implicates an extrinsic mechanism of immunosurveillance that affects tumor growth.

To gain further insight into that mechanism, we evaluated tumor growth in mice with genetic deficiencies in adaptive and/or innate immune cells. In nude mice, the growth of IRF-8–deficient tumor cells was significantly greater than their control counterparts at the majority of time points assessed. Because these studies were undertaken in nonimmunized animals, it was not entirely unexpected that adaptive T cell immunity would play a less dominant antitumor role during host immunosurveillance. Adaptive immunity would likely play a more dominant role under conditions of prior host immunization, and requires further study. Interestingly, we found that IRF-8–deficient tumor cells in bg-nu-XID mice no longer maintained a significant growth advantage over controls at all time points measured. These findings supported an important role for an innate immune response against CMS4 tumor growth via an IRF-8–dependent mechanism. Furthermore, the observation that both control and IRF-8–deficient tumor cells grew similarly in bg-nu-XID mice indicated that the differences in tumor growth seen between these two cell populations in immunocompetent mice were not due to differences in their proliferation in vivo.

Because mice with the beige mutation have been used for studies of NK cell biology (25–28), we further investigated the role of NK cells by antibody depletion in the nude mouse setting. Surprisingly, NK depletion in vivo failed to show a relevant role for NK cells because the control tumor population did not grow more aggressively. Immunohistochemical analysis of resected tumor tissues of the untreated control groups revealed extensive infiltration of macrophages. Thus, although these observations implicate macrophages as a potentially important effector cell, further studies are warranted to characterize in detail the precise role that they play, either alone or in combination with other elements of the immune system. Moreover, because the bg-nu-XID mouse possesses several immunologic defects, it is conceivable that important functions of macrophages may become compromised or impaired during tumor immunosurveillance, which also requires further elucidation. The observation that high levels of macrophages were found in mice bearing either the control or IRF-8–deficient tumor cells suggested that IRF-8 status in the tumor did not alter macrophage migration, but perhaps the functional outcome of the macrophage-tumor interaction. Furthermore, it remains to be fully understood whether differential expression of IRF-8 in the tumor cell population might influence the polarization or subtypes of infiltrating macrophages, which, in turn, could affect the efficacy of the host antitumor response.

In summary, our studies reveal that IRF-8 plays an important tumor suppressor role in the control of CMS4 tumor growth in vivo. Our findings are consistent with the paradigm that IFN-{gamma} is required to up-regulate intrinsic IRF-8 expression in tumor cells, which then sensitizes them to an innate response during host immunosurveillance. Tumor-associated IRF-8 expression, therefore, is a necessary molecular determinant for the ability of innate immune cells to more effectively destroy CMS4 tumor cells via an IFN-{gamma} and FasL-dependent mechanism. Conversely, the loss of IRF-8 expression would render cells unresponsive to IFN-{gamma}–mediated signals, thus protecting the cells from apoptosis, and resulting in the outgrowth of immunoresistant TEV. Therefore, differential expression of IRF-8 in solid malignancies might be a marker of tumor progression, and restoration of IRF-8 expression in tumor cells might be a novel therapeutic strategy to promote or improve therapeutic efficacy.


   Acknowledgments
 
Grant support: Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Julia Reid for technical assistance and Dr. Diana Haines of the Pathology/Histotechnology Laboratory (Laboratory Animal Sciences Program, NCI/SAIC) for assistance with the immunohistochemistry analysis.

Received 4/ 3/07. Revised 7/16/07. Accepted 8/23/07.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000;100:57–70.[CrossRef][Medline]
  2. Keane MM, Ettenberg SA, Lowrey GA, Russell EK, Lipkowitz S. Fas expression and function in normal and malignant breast cell lines. Cancer Res 1996;56:4791–8.[Abstract/Free Full Text]
  3. Krammer PH, Galle PR, Moller P, Debatin KM. CD95(APO-1/Fas)-mediated apoptosis in normal and malignant liver, colon, and hematopoietic cells. Adv Cancer Res 1998;75:251–73.[Medline]
  4. Owen-Schaub L, Chan H, Cusack JC, Roth J, Hill LL. Fas and Fas ligand interactions in malignant disease. Int J Oncol 2000;17:5–12.[Medline]
  5. Yamana K, Bilim V, Hara N, et al. Prognostic impact of FAS/CD95/APO-1 in urothelial cancers: decreased expression of Fas is associated with disease progression. Br J Cancer 2005;93:544–51.[CrossRef][Medline]
  6. Zhang Z, Wang LE, Sturgis EM, et al. Polymorphisms of FAS and FAS ligand genes involved in the death pathway and risk and progression of squamous cell carcinoma of the head and neck. Clin Cancer Res 2006;12:5596–602.[Abstract/Free Full Text]
  7. Chakraborty M, Abrams SI, Camphausen K, et al. Irradiation of tumor cells up-regulates Fas and enhances CTL lytic activity and CTL adoptive immunotherapy. J Immunol 2003;170:6338–47.[Abstract/Free Full Text]
  8. Liu K, Abrams SI. Alterations in Fas expression are characteristic of, but not solely responsible for, enhanced metastatic competence. J Immunol 2003;170:5973–80.[Abstract/Free Full Text]
  9. Liu K, Caldwell SA, Abrams SI. Cooperative disengagement of Fas and intercellular adhesion molecule-1 function in neoplastic cells confers enhanced colonization efficiency. Cancer Res 2005;65:1045–54.[Abstract/Free Full Text]
  10. Lee JK, Sayers TJ, Brooks AD, et al. IFN-{gamma}-dependent delay of in vivo tumor progression by Fas overexpression on murine renal cancer cells. J Immunol 2000;164:231–9.[Abstract/Free Full Text]
  11. Siegmund D, Wicovsky A, Schmitz I, et al. Death receptor-induced signaling pathways are differentially regulated by {gamma} interferon upstream of caspase 8 processing. Mol Cell Biol 2005;25:6363–79.[Abstract/Free Full Text]
  12. Wigginton JM, Gruys E, Geiselhart L, et al. IFN-{gamma} and Fas/FasL are required for the antitumor and antiangiogenic effects of IL-12/pulse IL-2 therapy. J Clin Invest 2001;108:51–62.[CrossRef][Medline]
  13. Liu K, Caldwell SA, Greeneltch KM, Yang D, Abrams SI. CTL adoptive immunotherapy concurrently mediates tumor regression and tumor escape. J Immunol 2006;176:3374–82.[Abstract/Free Full Text]
  14. Nguyen H, Hiscott J, Pitha PM. The growing family of interferon regulatory factors. Cytokine Growth Factor Rev 1997;8:293–312.[CrossRef][Medline]
  15. Tamura T, Ozato K. ICSBP/IRF-8: its regulatory roles in the development of myeloid cells. J Interferon Cytokine Res 2002;22:145–52.[CrossRef][Medline]
  16. Tamura T, Nagamura-Inoue T, Shmeltzer Z, Kuwata T, Ozato K. ICSBP directs bipotential myeloid progenitor cells to differentiate into mature macrophages. Immunity 2000;13:155–65.[CrossRef][Medline]
  17. Holtschke T, Lohler J, Kanno Y, et al. Immunodeficiency and chronic myelogenous leukemia-like syndrome in mice with a targeted mutation of the ICSBP gene. Cell 1996;87:307–17.[CrossRef][Medline]
  18. Gabriele L, Phung J, Fukumoto J, et al. Regulation of apoptosis in myeloid cells by interferon consensus sequence-binding protein. J Exp Med 1999;190:411–21.[Abstract/Free Full Text]
  19. Liu K, Abrams SI. Coordinate regulation of IFN consensus sequence-binding protein and caspase-1 in the sensitization of human colon carcinoma cells to Fas-mediated apoptosis by IFN-{gamma}. J Immunol 2003;170:6329–37.[Abstract/Free Full Text]
  20. Caldwell SA, Ryan MH, McDuffie E, Abrams SI. The Fas/Fas ligand pathway is important for optimal tumor regression in a mouse model of CTL adoptive immunotherapy of experimental CMS4 lung metastases. J Immunol 2003;171:2402–12.[Abstract/Free Full Text]
  21. Smyth MJ, Thia KY, Cretney E, et al. Perforin is a major contributor to NK cell control of tumor metastasis. J Immunol 1999;162:6658–62.[Abstract/Free Full Text]
  22. Smyth MJ, Crowe NY, Godfrey DI. NK cells and NKT cells collaborate in host protection from methylcholanthrene-induced fibrosarcoma. Int Immunol 2001;13:459–63.[Abstract/Free Full Text]
  23. Giagkousiklidis S, Vogler M, Westhoff MA, et al. Sensitization for {gamma}-irradiation-induced apoptosis by second mitochondria-derived activator of caspase. Cancer Res 2005;65:10502–13.[Abstract/Free Full Text]
  24. Krueger SA, Joiner MC, Weinfeld M, Piasentin E, Marples B. Role of apoptosis in low-dose hyper-radiosensitivity. Radiat Res 2007;167:260–7.[CrossRef][Medline]
  25. Maecker HL, Yun Z, Maecker HT, Giaccia AJ. Epigenetic changes in tumor Fas levels determine immune escape and response to therapy. Cancer Cell 2002;2:139–48.[CrossRef][Medline]
  26. Tseng JC, Levin B, Hirano T, et al. In vivo antitumor activity of Sindbis viral vectors. J Natl Cancer Inst 2002;94:1790–802.[Abstract/Free Full Text]
  27. McMillan TJ, Rao J, Everett CA, Hart IR. Interferon-induced alterations in metastatic capacity, class-1 antigen expression and natural killer cell sensitivity of melanoma cells. Int J Cancer 1987;40:659–63.[CrossRef][Medline]
  28. Roder JC. The beige mutation in the mouse. I. A stem cell predetermined impairment in natural killer cell function. J Immunol 1979;123:2168–73.[Abstract/Free Full Text]
  29. Smyth MJ, Swann J, Hayakawa Y. Innate tumor immune surveillance. Adv Exp Med Biol 2007;590:103–11.[Medline]
  30. Dunn GP, Koebel CM, Schreiber RD. Interferons, immunity and cancer immunoediting. Nat Rev Immunol 2006;6:836–48.[CrossRef][Medline]
  31. Driggers PH, Ennist DL, Gleason SL, et al. An interferon {gamma}-regulated protein that binds the interferon-inducible enhancer element of major histocompatibility complex class I genes. Proc Natl Acad Sci U S A 1990;87:3743–7.[Abstract/Free Full Text]
  32. Weisz A, Marx P, Sharf R, et al. Human interferon consensus sequence binding protein is a negative regulator of enhancer elements common to interferon-inducible genes. J Biol Chem 1992;267:25589–96.[Abstract/Free Full Text]
  33. Nelson N, Marks MS, Driggers PH, Ozato K. Interferon consensus sequence-binding protein, a member of the interferon regulatory factor family, suppresses interferon-induced gene transcription. Mol Cell Biol 1993;13:588–99.[Abstract/Free Full Text]
  34. Burchert A, Cai D, Hofbauer LC, et al. Interferon consensus sequence binding protein (ICSBP; IRF-8) antagonizes BCR/ABL and down-regulates bcl-2. Blood 2004;103:3480–9.[Abstract/Free Full Text]
  35. Hao SX, Ren R. Expression of interferon consensus sequence binding protein (ICSBP) is downregulated in Bcr-Abl-induced murine chronic myelogenous leukemia-like disease, and forced coexpression of ICSBP inhibits Bcr-Abl-induced myeloproliferative disorder. Mol Cell Biol 2000;20:1149–61.[Abstract/Free Full Text]
  36. Turcotte K, Gauthier S, Tuite A, et al. A mutation in the Icsbp1 gene causes susceptibility to infection and a chronic myeloid leukemia-like syndrome in BXH-2 mice. J Exp Med 2005;201:881–90.[Abstract/Free Full Text]
  37. Yang D, Thangaraju M, Greeneltch K, et al. Repression of IFN regulatory factor 8 by DNA methylation is a molecular determinant of apoptotic resistance and metastatic phenotype in metastatic tumor cells. Cancer Res 2007;67:3301–9.[Abstract/Free Full Text]
  38. Egwuagu CE, Li W, Yu CR, et al. Interferon-{gamma} induces regression of epithelial cell carcinoma: critical roles of IRF-1 and ICSBP transcription factors. Oncogene 2006;25:3670–9.[CrossRef][Medline]
  39. Fanzo JC, Hu CM, Jang SY, Pernis AB. Regulation of lymphocyte apoptosis by interferon regulatory factor 4 (IRF-4). J Exp Med 2003;197:303–14.[Abstract/Free Full Text]
  40. Sinha P, Clements VK, Miller S, Ostrand-Rosenberg S. Tumor immunity: a balancing act between T cell activation, macrophage activation and tumor-induced immune suppression. Cancer Immunol Immunother 2005;54:1137–42.[CrossRef][Medline]
  41. Lum HD, Buhtoiarov IN, Schmidt BE, et al. In vivo CD40 ligation can induce T-cell-independent antitumor effects that involve macrophages. J Leukoc Biol 2006;79:1181–92.[Abstract/Free Full Text]
  42. Kaplan DH, Shankaran V, Dighe AS, et al. Demonstration of an interferon {gamma}-dependent tumor surveillance system in immunocompetent mice. Proc Natl Acad Sci U S A 1998;95:7556–61.[Abstract/Free Full Text]
  43. Shankaran V, Ikeda H, Bruce AT, et al. IFN{gamma} and lymphocytes prevent primary tumour development and shape tumour immunogenicity. Nature 2001;410:1107–11.[CrossRef][Medline]
  44. Montel AH, Bochan MR, Hobbs JA, Lynch DH, Brahmi Z. Fas involvement in cytotoxicity mediated by human NK cells. Cell Immunol 1995;166:236–46.[CrossRef][Medline]
  45. Seki N, Brooks AD, Carter CR, et al. Tumor-specific CTL kill murine renal cancer cells using both perforin and Fas ligand-mediated lysis in vitro, but cause tumor regression in vivo in the absence of perforin. J Immunol 2002;168:3484–92.[Abstract/Free Full Text]
  46. Cappello P, Novelli F, Forni G, Giovarelli M. Death receptor ligands in tumors. J Immunother 2002;25:1–15.[Medline]
  47. Chauhan P, Sodhi A, Tarang S. Cisplatin-treated murine peritoneal macrophages induce apoptosis in L929 cells: role of Fas-Fas ligand and tumor necrosis factor-tumor necrosis factor receptor 1. Anticancer Drugs 2007;18:187–96.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
I. N. Buhtoiarov, A. L. Rakhmilevich, L. L. Lanier, E. A. Ranheim, and P. M. Sondel
Naive Mouse Macrophages Become Activated following Recognition of L5178Y Lymphoma Cells via Concurrent Ligation of CD40, NKG2D, and CD18 Molecules
J. Immunol., February 15, 2009; 182(4): 1940 - 1953.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
D. Yang, S. Wang, C. Brooks, Z. Dong, P. V. Schoenlein, V. Kumar, X. Ouyang, H. Xiong, G. Lahat, A. Hayes-Jordan, et al.
IFN Regulatory Factor 8 Sensitizes Soft Tissue Sarcoma Cells to Death Receptor-Initiated Apoptosis via Repression of FLICE-like Protein Expression
Cancer Res., February 1, 2009; 69(3): 1080 - 1088.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
J. M. McGough, D. Yang, S. Huang, D. Georgi, S. M. Hewitt, C. Rocken, M. Tanzer, M. P.A. Ebert, and K. Liu
DNA Methylation Represses IFN-{gamma}-Induced and Signal Transducer and Activator of Transcription 1-Mediated IFN Regulatory Factor 8 Activation in Colon Carcinoma Cells
Mol. Cancer Res., December 1, 2008; 6(12): 1841 - 1851.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Greeneltch, K. M.
Right arrow Articles by Abrams, S. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Greeneltch, K. M.
Right arrow Articles by Abrams, S. I.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online