Cancer Research Cancer Epigenetics  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 67, 10753, November 15, 2007. doi: 10.1158/0008-5472.CAN-07-0329
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Byun, H.-M.
Right arrow Articles by Yang, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Byun, H.-M.
Right arrow Articles by Yang, A. S.

Molecular Biology, Pathobiology, and Genetics

Examination of IGF2 and H19 Loss of Imprinting in Bladder Cancer

Hyang-Min Byun1, Hui-Lee Wong3, Elliott Aaron Birnstein1, Erika M. Wolff2, Gangning Liang2 and Allen S. Yang1

1 Division of Hematology and 2 Department of Biochemistry, University of Southern California/Norris Comprehensive Cancer Center, Los Angeles, California; and 3 Viral Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Department of Health and Human Services, Bethesda, Maryland

Requests for reprints: Allen S. Yang, USC/Norris Cancer Center, 1441 Eastlake Ave., Room 6428, University of Southern California, CA 90033. Phone: 323-865-0712; E-mail: allenyan{at}usc.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Loss of imprinting (LOI) is a common epigenetic event in cancer and may serve as an early biomarker in some cancers. To obtain a better understanding of LOI, we studied 41 bladder tumors and their adjacent normal bladder mucosa. We found 2/9 (22.2%) cases that displayed LOI of IGF2 and 2/16 (12.5%) that had LOI of H19, as determined by the evaluation of mRNA for biallelic expression. In addition, we examined allele-specific methylation of the differentially methylated regions (DMR) of IGF2 and H19 using a new allele-specific pyrosequencing assay. We found that DNA methylation changes were a common finding (21/30, 70%) in the DMR regions, but could not clearly link DNA methylation changes with LOI as measured by biallelic expression. LOI and allele-specific DNA methylation changes are present in bladder cancer; however, a better understanding of the biology of LOI and its relationship to DNA methylation changes is needed before its use as an epigenetic biomarker. [Cancer Res 2007;67(22):10753–8]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Genomic imprinting is a mechanism by which there is preferential expression of a gene based on the parental origin of the allele. Two well-studied reciprocally imprinted genes, IGF2 and H19, are located on human chromosome 11p15.5 (1). IGF2 encodes the insulin-like growth factor II (IGF-II), whereas the H19 transcript apparently does not encode any protein; however, expression of H19 is associated with silencing of IGF2 (2). IGF2 is exclusively expressed from the paternal allele, whereas H19 is only expressed from the maternal allele. The transcription of the IGF2 gene is regulated by a differentially methylated region (DMR) upstream of the H19 promoter and by an H19 downstream enhancer (36). The H19 DMR contains binding sites for CTCF, a chromatin insulator that binds to the unmethylated DMR on the maternal allele, preventing IGF2 transcription and enabling H19 expression. On the paternal allele, methylation of the DMR prevents CTCF binding, leading to IGF2 expression and H19 silencing (5, 6). This is commonly referred to as the enhancer competition model (7).

Biallelic expression of IGF2 has been reported in a number of cancer types and is commonly referred to as loss of imprinting (LOI; ref. 7). Methylation changes of the DMR have been associated with LOI. The aberrant methylation at this site correlates with LOI in Wilms' tumors (8), bladder cancer (9), and colon cancer (7, 10), as well as chronic myelogenous leukemia (11). Cui et al. (8) reported that hypermethylation of the normally unmethylated allele was found in Wilms' tumors with IGF2 LOI, whereas hypomethylation of the normally methylated allele was found in bladder cancers with H19 LOI (9). Takai et al. showed that only the sixth CTCF-binding site showed allele-specific methylation, and the sixth CTCF-binding site acts as a key regulatory domain for switching of H19/IGF2 expression (9). The mechanisms responsible for retention of imprinting (ROI) and LOI are still unresolved.

Several studies have reported DNA methylation changes in bladder cancer (12). The p16 and p14 genes have been described to be aberrantly hypermethylated in bladder cancer, and this methylation has been associated with worse prognosis (13). DNA methylation changes have also been reported in the IGF2 and H19 locus (10), but these have not been studied along with imprinting or LOI status. LOI may be a common event in bladder cancer, as Hochberg A reported 50% of bladder cancer samples had LOI in both IGF2 and H19 gene (14).

To obtain a better understanding of the relationship of DNA methylation and imprinting, we have developed an allele-specific pyrosequencing assay that can quantitate DNA methylation of an individual allele (15). We studied 41 matched sets of bladder tumors along with adjacent normal bladder mucosa. We determined the frequency of LOI as measured by biallelic expression of IGF2 and H19 and tried to correlate these results to allele-specific DNA methylation changes of the DMR.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials. Matched sets of normal bladder mucosa and bladder tumor samples were obtained from 41 patients. The patients' age varied from 40 to 81 years old, with a mean age of 64 (Table 1 ). Tissue was immediately frozen after cystectomy and snap frozen in liquid nitrogen and stored at –80°C. Institutional guidelines were followed, and tissue was obtained through the Norris Cancer Center Pathology Core. This study was approved by the University of Southern California Institutional Review Board.


View this table:
[in this window]
[in a new window]

 
Table 1. Patients' characteristics and four required SNP sites

 
Nucleic acid isolation and bisulfite treatment. Genomic DNA was isolated by standard proteinase K digestion and phenol-chloroform extraction (16). Total RNA was collected and extracted from cultured cells with the RNeasy Protect minikit (Qiagen) according to the manufacturer's recommended protocol. Bisulfite modification of genomic DNA has been described previously (17).

Genotyping of IGF2 and H19 and loss of heterozygosity of chromosome 11. Many of our assays depend on a single nucleotide polymorphism (SNP). Therefore, to genotype our samples, we used an ApaI polymorphism for IGF2 and a RsaI polymorphism for H19 as described previously (18, 19). Primer sequence for genotyping for allelic specific expression: IGF2-Apa-F: CTTGGACTTTTGAGTCAAATTGG; IGF2-Apa-R: GGTCGTGCCAATTACATTTCA; H19-Rsa-F: TACAACCACTGCACTACCTG; H19-Rsa-R: TGGAATGCTTGAAGGCTGCT. For our allele-specific methylation assay, we analyzed a SNP (dbSNP ID: rs3741204) that was genotyped using PCR followed by HpaII digestion within IGF2 DMR region. To determine the SNP for the H19 DMR region (dbSNP ID: rs2071094) we used pyrosequencing (see Fig. 1 ). Primer sequences for genotyping of DMR regions were as follows: IGF2-DMR-F: GTGAAAAGTTTCCTCCCGTTGC; IGF2-DMR-R: TGTCCAATTTCTTGCTGGTG; H19-DMR-F: GGTCTCACCGCCTGGATG; H19-DMR-R: GACCCGGGACGTTTCCAC.


Figure 1
View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Schematic representation of the IGF2 and H19 gene locus. A, specific primer P1, P2, P3, and P4 for multiplex PCR for promoter usage were marked. Allele expression was identified using an ApaI polymorphism in exon 9 of IGF2 gene. For the methylation status of the DMR region of IGF2, we used rs3741204 polymorphism. B, allele expression was identified using an RsaI polymorphism in exon 5 of H19 gene. For the methylation status of the sixth CTCF region of H19, we used rs2071094 polymorphism.

 
Chromosome 11 deletion is a common finding in bladder cancer, and to identify chromosomal deletions of the 11p15 region of chromosome 11, we assayed for loss of heterozygosity (LOH). We did PCR with genomic DNA of bladder tumor and adjacent normal bladder. The PCR product was then ApaI digested for IGF2 or RsaI digested for H19 as described above to identify samples that were heterozygous for the SNP. For samples that were heterozygous for the SNP within IGF2 or H19, we could determine loss of chromosome 11 by looking for LOH of the SNP in tumor samples when compared with their matched normal samples. LOH in the tumor sample reflects loss of a chromosome 11 allele.

Analysis of allelic expression of IGF2 and H19. To assess allele-specific expression, we did reverse transcription-PCR (RT-PCR) and restriction digestion by ApaI for IGF2 (20) and RsaI for H19 (18) as previously described. Total RNA was treated with DNase I (Qiagen) before the reverse transcription reaction (New England Biolabs) to avoid genomic DNA contamination. The absence of genomic DNA in DNase I–treated RNA was confirmed by an identical RT-PCR reaction that lacked the reverse transcriptase (RT) control. Primer sequences for allelic specific expression were as follows: IGF2-LOI-Apa-F: CTTGGACTTTGAGTCAAATTGG; IGF2-LOI-Apa-R: GGGTCGTGCCAATTACATTTC; H19-LOI-Rsa-F: TACAACCACTGCACTACCTG; and H19-LOI-Rsa-R: TGGAATGCTTGAAGGCTGCT. Amplifications were done in a PTC-100 (MJ Research). PCR products were digested by ApaI and RsaI (New England Biolabs) and electrophoresed on a 2% agarose gel.

Methylation status analysis of IGF2 and H19 DMR region by pyrosequencing. PCR product of each gene was used for the individual sequencing reaction. The biotinylated PCR product (40 µL) was purified by using streptavidin-Sepharose beads (Amersham Biosciences). Purification with streptavidin-Sepharose HP beads and codenaturation of the biotinylated PCR products and the sequencing primer (15 pmol per reaction) were conducted following the PSQ 96 sample preparation guide using the pyrosequencing vacuum prep tool (Biotage AB). The single-strand PCR product acted as a template in a pyrosequencing reaction, and all the reactions were designed as recommended by the manufacturer's instruction (Biotage AB). After completion of primer annealing, sequencing was done on a PSQ 96HS system with the Pyrogold reagent kit according to the manufacturer's instructions. Raw data were analyzed with the allele quantitation algorithm with the provided software. Percent methylation was calculated for the H19 CTCF region (sixth CpG site) and IGF2 DMR (first CpG site adjacent to the rs3741204 SNP). The average percentage methylation between the parental alleles and between the normal and tumor groups were compared with the paired t test and {chi}2 test, respectively. Primer sequence for pyrosequencing of DMR region were IGF2-PQ-DMR-F: TATTTTTAGAGATAAATAGGAGA; IGF2-PQ-DMR-R: TATCCAATTTCT TACTAATAATC; IGF2-A allele-sequencing primer: GGAGATTTTGTAGAGGAG TYA; IGF2-G allele-sequencing primer: GGAGATTTTGTAGAGGAGTYG; H19-PQ-DMR-F: GTTTTTATGAGTGTTTTATTTTTAGATC; H19-PQ-DMR-R: CACATAAATATTTCTAAAAACTTCTCC; H19-G allele-sequencing primer: GAATTTTAGTTG; and H19-T allele-sequencing primer: GAATTTTAGTTT.

Multiplex PCR assay for IGF2 promoter usage. To assay for IGF2 promoter usage, cDNA samples were amplified in a multiplex PCR reaction with four promoter-specific 5' primers and a common 3' primer (see Fig. 1). PCR sequences for promoter assay were IGF2-64067-F: GTCCTGAGGTGAGCTGCTGTGGC; IGF2-57451-F: ACCGGGCATTGCCCCCAGTCTCC; IGF2-54755-F: CGTCGCACATTCGGCCCCCGCGACT; IGF2-53624-F: TCCTCCTCCTCCTGCCCCAGCG; and IGF2-51846-R: CAGCAATGCAGCACGAGGCGAAGGC. The promoter-specific primers were designed to have a similar Tm, so that they have similar amplification kinetics by combination with the 3'-common primer as previously described (21). Products have been shown to reflect the relative abundance of the promoter-specific derived transcripts (22).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Allele-specific expression and LOI in bladder cancer. Imprinting of IGF2 and H19 has previously been shown through analysis of allele-specific expression. We were interested in comparing allele-specific expression to allele-specific methylation of the IGF2 and H19 genes. Assays for both allele-specific expression and methylation depend on SNP to distinguish the two alleles. We therefore genotyped our 41 patient samples for the four required SNPs for our assays (Tables 1 and 2 ). A schematic of the IGF2 and H19 genes is shown in Fig. 1. The methylation assay polymorphisms were in the IGF2 DMR (rs3741204) and H19 DMR (rs2071094) in 5'-untranscribed region of the genes. The allele-specific expression assays used SNPs in exon 9 of IGF2 (ApaI) and exon 5 of H19 (RsaI). IGF2 and H19 are imprinted genes that are discordantly monoallelic expressed from the paternal and maternal alleles, respectively. Unfortunately, for many samples, we did not have RNA that could be used to generate cDNA for our expression assay (N/D in Table 2). For IGF2, 7/7 (100%) normal bladder tissues showed monoallelic expression, and 7/9 (77.8%) matched bladder tumors showed monoallelic expression. LOI as shown by biallelic expression of IGF2 was found in 2/9 (22.2%) bladder cancers. For one sample, examination of the genomic DNA showed the normal tissue to be heterozygous, and the matched tumor tissue had lost heterozygosity consistent with a chromosomal deletion in this locus.


View this table:
[in this window]
[in a new window]

 
Table 2. Frequency of heterozygosity for the expression assays of IGF2 and H19

 
H19 12/13 (92.3%) samples showed monoallelic expression in the normal, and 14/16 (70%) bladder tumors showed ROI. We found 2/16 (12.5%) tumor samples that showed LOI that is a much lower frequency than previously reported. Interestingly, we found one tumor sample that seemed to show a monoallelic expression for one allele in the normal, but expressed only the other allele in the tumor. The monoallelic switch in expression was explained by the examination of the genomic DNA that showed LOH in the tumor sample consistent with a chromosomal deletion for the expressed allele (Table 2). Loss of chromosome 11 is a common event in bladder cancer, and this may complicate LOI analysis by allelic expression studies. Finally, we found one sample that had LOI in the normal (1/13) but not the matched tumor, showing that LOI may occur in normal tissue independent of cancer.

LOI of IGF2 is not due to a promoter switch in bladder cancer. IGF2 can be transcribed from four distinct promoters, P1 to P4 (23), of which P3 and P4 are predominant in most tissues (24). P2 to P4 is contained in a CpG island, and transcription from these promoters is subject to parental imprinting (25, 26). P1, however, is normally biallelically expressed (21) and seems to be regulated differently than P2 to P4 in that it escapes imprinting in several adult tissues (27). Therefore, we examined whether biallelic expression of IGF2 could be attributable to the use of the P1 promoter in bladder cancer. Loss of IGF2 imprinting could then result from promoter switching if transcription from the imprinted promoters P2 to P4 declines and transcription from the non-imprinted promoter P1 increases. To examine this possibility, we used a multiplex promoter-specific RT-PCR assay. MCF-7, a breast cancer cell line, has previously been reported to use all four promoters in the expression of IGF2 and served as a positive control for our assay (Fig. 2 ). In all the bladder tumors examined, IGF2 transcripts were predominantly from P3 and P4 promoters (Fig. 2). Thus, biallelic expression of IGF2 was not due to a change in promoter usage.


Figure 2
View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. IGF2 promoter usage assay in bladder cancer. Multiplex PCR was used on cDNA from bladder cancers to determine which of the four promoters (P1–P4) do IGF2 transcripts arise.

 
Allele-specific methylation of the IGF2 DMR and H19 CTCF region. Previous reports have shown that allele-specific DNA methylation of the IGF2 DMR and the H19 CTCF region inversely correlated with allelic expression. We therefore used a novel pyrosequencing assay to assess allele-specific DNA methylation. Our assay uses bisulfite pyrosequencing directed toward a heterozygous SNP to distinguish the two alleles. As expected, we always found one allele to be much more methylated than the other, consistent with the region being a DMR (Figs. 3 and 4 ; IGF2 normal bladder, P = 0.001; IGF2 bladder tumor, P = 0.00004; H19 normal bladder, P < 0.000001; and H19 bladder tumor, P = 0.0002). In the case of H19, the percentage of methylation was significantly decreased from normal bladder to bladder tumor (82.4% to 58.3%; P = 0.02) in the methylated allele. However, the methylation of the unmethylated allele slightly changed (1.6% to 3.6%; see Fig. 3).


Figure 3
View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. H19 allele-specific methylation in normal bladder and bladder cancer. Allele-specific pyrosequencing was used to quantitatively measure the DNA methylation of the H19 DMR. Hatch mark, mean. ROI, samples that show ROI; LOI, samples that show LOI by a RNA expression–based assay.

 

Figure 4
View larger version (10K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. IGF2 allele-specific methylation in normal bladder and bladder cancer. Allele-specific pyrosequencing was used to quantitatively measure the DNA methylation of the IGF2 DMR. Hatch mark, mean. LOI, samples that show LOI by a RNA expression–based assay.

 
In addition, we found four joint H19 heterozygous cases in the CTCF region that matched our H19 exon 5 heterozygous to examine whether a DNA methylation change played a role in biallelic expression. The significant decreased methylation level of methylated allele (88.6% to 46.4%) of this CTCF region occurred with biallelic expression of H19 in one bladder tumor case, but methylation level also decreased, showing monoallelic expression of H19 in three other bladder tumor cases.

Takai et al. reported that the methylation status of the sixth CTCF-binding site of H19 controlled the IGF2 and H19 expression. In this experiment, three samples contained the correct combination of polymorphism in the exon 5 of IGF2 and that CTCF region of H19. Unfortunately, all three samples have ROI, and none of these samples showed biallelic expression of IGF2. With our data, we suggested that the methylation status in the DMR region of IGF2 was a more affective factor for biallelic expression of IGF2. In addition to this, as shown in Fig. 4, the methylation status of IGF2 was variable and unstable compared to the H19 methylation status. The H19 methylation pattern of unmethylated allele and methylated allele was more consistent in normal bladder.

In the case of IGF2, we examined 17 heterozygous patients for the IGF2 DMR. In normal bladder tissue, the methylated allele showed a mean methylation of 70.5% and 29.6% for the unmethylated allele. In contrast to normal bladder tissue, the percent of DNA methylation in bladder tumors was 54.5% in methylated allele and 18.8% in the unmethylated allele (Fig. 4). There was one sample that was heterozygous for both our allelic expression assay and our allele-specific DNA methylation assay, and it was found that the unmethylated allele was unchanged. The methylated allele, however, decreased the DNA methylation of the DMR from 70.4% to 54.5% in the tumor. A total of 12 patients showed a greater decrease in methylation of the IGF2 DMR, but no RNA was available to perform the RT-PCR assay to evaluate expression. In the same manner, the considerable decreased methylation level of the methylated allele (86.0% to 37.2%) of the IGF2 DMR region occurred with biallelic expression of IGF2 in the bladder tumor. There was no change of the methylation level of the unmethylated allele (0%).

These data suggest a relationship between LOI and the altered methylation profile of IGF2 and H19 in bladder tumors; that is, the loss of methylation of the methylated allele shows LOI in IGF2 and H19. For H19, several more tumor samples were heterozygous for the H19 locus and were analyzed by allele-specific pyrosequencing. Five samples were heterozygous for both the methylation and expression assays (Fig. 4). Of these, one showed biallelic expression that could be measured and showed allele-specific DNA methylation changes. However, the other three loci studied also showed significant allele-specific DNA methylation changes but maintained monoallelic expression of H19 consistent with ROI. Therefore, predicted biallelic expression (LOI) was independent of allele-specific DNA methylation changes.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In our study DNA methylation of the IGF2 and H19 DMR could not be correlated with biallelic expression of either IGF2 or H19. We clearly found biallelic expression of both IGF2 and H19, which has been previously reported (8). In addition, we clearly found DNA methylation changes in both the IGF2 and H19 DMR; however, we were unable to link between the two. It should be noted that our sample size is small, and the number of samples that are jointly heterozygous for both our DNA methylation and RNA expression assays is limited. Interestingly, we found that the expression assay can be complicated by chromosome 11 deletions (LOH) that are a common event in bladder cancer and can lead to the incorrect assessment of LOI (28). In addition, we observed biallelic expression of H19 gene in normal bladder tissue; however, the matched tumor did not show biallelic expression. In this patient, DNA methylation level of the DMR in the H19 gene was slightly higher in the bladder tumor compared with normal bladder tissue. This result may show that during bladder carcinogenesis, the aberrant DNA methylation in the DMR of the H19 gene preceded the biallelic expression of the H19 gene. Increased expression of H19 is a marker of early recurrence in human bladder cancer (14). It is possible that this increased expression is due to the expression of the methylated paternal H19 allele that is usually not expressed, and aberrant allele-specific methylation or LOI may be involved in this increased aberrant expression of H19 and IGF2.

LOI occurs in approximately one third of human colon cancers, and LOI is a potential marker of colorectal cancer risk (29, 30). Interestingly, colon LOI was also present in normal colonic mucosa from patients with colon cancer. These changes were common even in individuals without cancer, occurring in ~10% of all normal colon samples (29). Furthermore, LOI was also found in the peripheral blood of individuals with colon cancer (29) and poses the possibility that LOI can be used as a possible screening tool for cancer risk. We have also found that a patient with bladder cancer had biallelic expression of the IGF2 gene (LOI) in their normal bladder mucosa. However, this patient's bladder cancer had ROI and monoallelic expressed IGF2. Furthermore, we and others found that DNA methylation changes do occur in the IGF2 and H19 locus, but we could not correlate them with LOI (31). Thus, additional studies of LOI are needed before it can be employed as a useful tool in screening for cancer.

In colorectal cancer, biallelic expression of the IGF2 gene was associated with a gain of DNA methylation in the unmethylated allele of H19 (32). However, LOI in colorectal cancer has also been associated with a loss of DNA methylation in the methylated allele of IGF2 (7). In bladder cancer, H19 methylation was shown to be decreased in the DMR (9). Our results show that loss of DNA methylation in the methylated allele of H19 and IGF2 can be found in tumors with LOI, but these DNA methylation changes can occur in the absence of LOI. We found that all cases of biallelic expression of H19 or IGF2 were associated with a decrease in DNA methylation of the methylated allele. However, we also found cases in which there were changes in DNA methylation of the DMR that were not associated with biallelic expression. We hypothesize that aberrant DNA methylation of the methylated allele is an early event in LOI and precedes biallelic expression of the imprinted gene in bladder cancer. Again, our data suggest that aberrant DNA methylation changes in the DMR region are necessary, but not sufficient for LOI.


    Acknowledgments
 
Grant support: Wright Foundation and STOP Cancer. A.S. Yang is the recipient of an American Society of Clinical Oncology–Association of Subspecialty Professors Career Development Award in Geriatric Oncology. This work was also supported by grant NIH PPG CA 86871-01A2 (to G. Liang).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 1/26/07. Revised 7/30/07. Accepted 9/24/07.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Zemel S, Bartolomei MS, Tilghman SM. Physical linkage of two mammalian imprinted genes, H19 and insulin-like growth factor 2. Nat Genet 1992;2:61–5.[CrossRef][Medline]
  2. Ferguson-Smith AC. Genetic imprinting: silencing elements have their say. Curr Biol 2000;10:R872–5.[CrossRef][Medline]
  3. Leighton PA, Saam JR, Ingram RS, Stewart CL, Tilghman SM. An enhancer deletion affects both H19 and Igf2 expression. Genes Dev 1995;9:2079–89.[Abstract/Free Full Text]
  4. Frevel MA, Hornberg JJ, Reeve AE. A potential imprint control element: identification of a conserved 42 bp sequence upstream of H19. Trends Genet 1999;15:216–8.[CrossRef][Medline]
  5. Bell AC, Felsenfeld G. Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature 2000;405:482–5.[CrossRef][Medline]
  6. Hark AT, Schoenherr CJ, Katz DJ, Ingram RS, Levorse JM, Tilghman SM. CTCF mediates methylation-sensitive enhancer-blocking activity at the H19/Igf2 locus. Nature 2000;405:486–9.[CrossRef][Medline]
  7. Cui H, Onyango P, Brandenburg S, Wu Y, Hsieh CL, Feinberg AP. Loss of imprinting in colorectal cancer linked to hypomethylation of H19 and IGF2. Cancer Res 2002;62:6442–6.[Abstract/Free Full Text]
  8. Cui H, Niemitz EL, Ravenel JD, et al. Loss of imprinting of insulin-like growth factor-II in Wilms' tumor commonly involves altered methylation but not mutations of CTCF or its binding site. Cancer Res 2001;61:4947–50.[Abstract/Free Full Text]
  9. Takai D, Gonzales FA, Tsai YC, Thayer MJ, Jones PA. Large scale mapping of methylcytosines in CTCF-binding sites in the human H19 promoter and aberrant hypomethylation in human bladder cancer. Hum Mol Genet 2001;10:2619–26.[Abstract/Free Full Text]
  10. Nakagawa H, Nuovo GJ, Zervos EE, et al. Age-related hypermethylation of the 5' region of MLH1 in normal colonic mucosa is associated with microsatellite-unstable colorectal cancer development. Cancer Res 2001;61:6991–5.[Abstract/Free Full Text]
  11. Randhawa GS, Cui H, Barletta JA, et al. Loss of imprinting in disease progression in chronic myelogenous leukemia. Blood 1998;91:3144–7.[Abstract/Free Full Text]
  12. Hoque MO, Begum S, Topaloglu O, et al. Quantitation of promoter methylation of multiple genes in urine DNA and bladder cancer detection. J Natl Cancer Inst 2006;98:996–1004.[Abstract/Free Full Text]
  13. Dominguez G, Silva J, Garcia JM, et al. Prevalence of aberrant methylation of p14ARF over p16INK4a in some human primary tumors. Mutat Res 2003;530:9–17.[Medline]
  14. Elkin M, Shevelev A, Schulze E, et al. The expression of the imprinted H19 and IGF-2 genes in human bladder carcinoma. FEBS Lett 1995;374:57–61.[CrossRef][Medline]
  15. Wong HL, Byun HM, Kwan JM, et al. Rapid and quantitative method of allele-specific DNA methylation analysis. Biotechniques 2006;41:734–9.[Medline]
  16. Wolff RK, Frazer KA, Jackler RK, Lanser MJ, Pitts LH, Cox DR. Analysis of chromosome 22 deletions in neurofibromatosis type 2–related tumors. Am J Hum Genet 1992;51:478–85.[Medline]
  17. Clark SJ, Harrison J, Paul CL, Frommer M. High sensitivity mapping of methylated cytosines. Nucleic Acids Res 1994;22:2990–7.[Abstract/Free Full Text]
  18. Tadokoro K, Fujii H, Inoue T, Yamada M. Polymerase chain reaction (PCR) for detection of ApaI polymorphism at the insulin like growth factor II gene (IGF2). Nucleic Acids Res 1991;19:6967.[Free Full Text]
  19. Redeker E, Van Moorsel CJ, Feinberg A, Mannens M. TaqI and RsaI polymorphisms in the H19 gene (D11S813E). Hum Mol Genet 1993;2:823.[Free Full Text]
  20. Zhang Y, Tycko B. Monoallelic expression of the human H19 gene. Nat Genet 1992;1:40–4.[CrossRef][Medline]
  21. Vu TH, Hoffman A. Alterations in the promoter-specific imprinting of the insulin-like growth factor-II gene in Wilms' tumor. J Biol Chem 1996;271:9014–23.[Abstract/Free Full Text]
  22. Wang WH, Duan JX, Vu TH, Hoffman AR. Increased expression of the insulin-like growth factor-II gene in Wilms' tumor is not dependent on loss of genomic imprinting or loss of heterozygosity. J Biol Chem 1996;271:27863–70.[Abstract/Free Full Text]
  23. Sussenbach JS, Rodenburg RJ, Scheper W, Holthuizen P. Transcriptional and post-transcriptional regulation of the human IGF-II gene expression. Adv Exp Med Biol 1993;343:63–71.[Medline]
  24. van Dijk MA, van Schaik FM, Bootsma HJ, Holthuizen P, Sussenbach JS. Initial characterization of the four promoters of the human insulin-like growth factor II gene. Mol Cell Endocrinol 1991;81:81–94.[CrossRef][Medline]
  25. Giannoukakis N, Deal C, Paquette J, Goodyer CG, Polychronakos C. Parental genomic imprinting of the human IGF2 gene. Nat Genet 1993;4:98–101.[CrossRef][Medline]
  26. Ohlsson R, Nystrom A, Pfeifer-Ohlsson S, et al. IGF2 is parentally imprinted during human embryogenesis and in the Beckwith-Wiedemann syndrome. Nat Genet 1993;4:94–7.[CrossRef][Medline]
  27. Vu TH, Hoffman AR. Promoter-specific imprinting of the human insulin-like growth factor-II gene. Nature 1994;371:714–7.[CrossRef][Medline]
  28. Shipman R, Schraml P, Colombi M, Raefle G, Ludwig CU. Loss of heterozygosity on chromosome 11p13 in primary bladder carcinoma. Hum Genet 1993;91:455–8.[Medline]
  29. Cui H, Horon IL, Ohlsson R, Hamilton SR, Feinberg AP. Loss of imprinting in normal tissue of colorectal cancer patients with microsatellite instability. Nat Med 1998;4:1276–80.[CrossRef][Medline]
  30. Cui H, Cruz-Correa M, Giardiello FM, et al. Loss of IGF2 imprinting: a potential marker of colorectal cancer risk. Science 2003;299:1753–5.[Abstract/Free Full Text]
  31. Murphy SK, Huang Z, Wen Y, et al. Frequent IGF2/H19 domain epigenetic alterations and elevated IGF2 expression in epithelial ovarian cancer. Mol Cancer Res 2006;4:283–92.[Abstract/Free Full Text]
  32. Nakagawa H, Chadwick RB, Peltomaki P, Plass C, Nakamura Y, de La Chapelle A. Loss of imprinting of the insulin-like growth factor II gene occurs by biallelic methylation in a core region of H19-associated CTCF-binding sites in colorectal cancer. Proc Natl Acad Sci U S A 2001;98:591–6.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
E. M. Gallagher, D. M. O'Shea, P. Fitzpatrick, M. Harrison, B. Gilmartin, J. A. Watson, T. Clarke, M. O. Leonard, A. McGoldrick, M. Meehan, et al.
Recurrence of Urothelial Carcinoma of the Bladder: A Role for Insulin-Like Growth Factor-II Loss of Imprinting and Cytoplasmic E-Cadherin Immunolocalization
Clin. Cancer Res., November 1, 2008; 14(21): 6829 - 6838.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
Y. Ito, T. Koessler, A. E.K. Ibrahim, S. Rai, S. L. Vowler, S. Abu-Amero, A.-L. Silva, A.-T. Maia, J. E. Huddleston, S. Uribe-Lewis, et al.
Somatically acquired hypomethylation of IGF2 in breast and colorectal cancer
Hum. Mol. Genet., September 1, 2008; 17(17): 2633 - 2643.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. X. Fu, J. R. Dobosy, J. A. Desotelle, N. Almassi, J. A. Ewald, R. Srinivasan, M. Berres, J. Svaren, R. Weindruch, and D. F. Jarrard
Aging and Cancer-Related Loss of Insulin-like Growth Factor 2 Imprinting in the Mouse and Human Prostate
Cancer Res., August 15, 2008; 68(16): 6797 - 6802.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. M. Wolff, G. Liang, C. C. Cortez, Y. C. Tsai, J. E. Castelao, V. K. Cortessis, D. D. Tsao-Wei, S. Groshen, and P. A. Jones
RUNX3 Methylation Reveals that Bladder Tumors Are Older in Patients with a History of Smoking
Cancer Res., August 1, 2008; 68(15): 6208 - 6214.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Byun, H.-M.
Right arrow Articles by Yang, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Byun, H.-M.
Right arrow Articles by Yang, A. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online