Cancer Research AACR Membership  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 67, 10774, November 15, 2007. doi: 10.1158/0008-5472.CAN-07-1475
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trent, S.
Right arrow Articles by Schmidt, E. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trent, S.
Right arrow Articles by Schmidt, E. V.

Molecular Biology, Pathobiology, and Genetics

Heat Shock Protein B8, a Cyclin-Dependent Kinase–Independent Cyclin D1 Target Gene, Contributes to Its Effects on Radiation Sensitivity

Sally Trent1,2, Chuanwei Yang2, Cuiqi Li2, Mary Lynch2 and Emmett V. Schmidt2,3

1 Oxford Cancer Centre, Department of Radiotherapy, Churchill Hospital, Oxford, United Kingdom and 2 Cancer Research Center and 3 The Pediatric Service, Massachusetts General Hospital, Boston, Massachusetts

Requests for reprints: Emmett V. Schmidt, Massachusetts General Hospital Cancer Research Center, Massachusetts General Hospital Cancer Center-Harvard University, 55 Fruit Street, GRJ 904, Boston, MA 02114. Phone: 617-726-5707; Fax: 617-726-5637; E-mail: schmidt{at}helix.mgh.harvard.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Overexpression of cyclin D1 is associated with many cancers, and its overexpression is especially associated with a poor prognosis in breast cancer. Paradoxically, cyclin D1 is known to enhance radiation sensitivity, a finding that has not yet been therapeutically exploited. Proposed cyclin D1 functions that could be involved in this effect include cyclin-dependent kinase (CDK)–dependent phosphorylation of retinoblastoma gene product (pRb), titration of p21/p27 complexes, and less well-characterized effects on gene expression. In this report, we sought to clarify the functions of cyclin D1 that might contribute to enhanced radiation sensitivity. Breast cancer cells stably overexpressing a cyclin D1 mutant (KE) that cannot interact with its CDK partners to phosphorylate pRb were as radiation sensitive as those expressing wild-type D1. Although cyclin D1 has been proposed to affect radiation sensitivity through interactions with p21, a cyclin D1 mutant defective for p21 interactions also increased radiation sensitivity. Cyclin D1 overexpression is generally confined to hormone receptor–positive breast cancers, wherein standard therapies include both radiation and hormonal therapies. Among several proposed CDK-independent cyclin D1 targets, we have identified heat shock protein B8 (HSPB8) as a target particularly associated with cyclin D1 and ER-positive tumors. We therefore evaluated its potential contribution to radiation sensitivity. Overexpression of HSPB8 markedly increased radiation sensitivity, and HSPB8 small interfering RNA blocked cyclin D1's enhancement of radiation sensitivity. Taken together, our results show that some of cyclin D1's effects on radiation sensitivity are CDK and p21 independent and identify HSPB8 as a candidate CDK-independent cyclin D1 target that can mediate its effects. [Cancer Res 2007;67(22):10774–81]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abnormal expression of cyclin D1 caused by amplification of its genomic locus on chromosome 11q13 plays a prominent role in the pathogenesis of a variety of cancers (1, 2). Initial studies of cyclin D1's role in cell division control showed interactions with cyclin-dependent kinases (Cdk) 4 and 6 that control phosphorylation of the retinoblastoma gene product (pRb). Although this phosphorylation event is a key determinant of passage through the G1-S phase of the cell cycle, cancers that overexpress cyclin D1 do not necessarily exhibit increased CDK activity (3). Moreover, overexpression of cyclin D1 is not itself sufficient to accelerate total cell proliferation (4). Cyclin D1 also functions by titrating the p21/p27 family of Cdk inhibitors (5) and/or by interactions with a variety of transcriptional activators (6). These alternative functions, especially its effects on gene expression patterns, are increasingly recognized as key contributors to cyclin D1's oncogenic functions (7).

Cyclin D1 is especially important in breast cancer, wherein its overexpression is highly correlated with estrogen receptor–positive tumors. Genomic analysis shows a clear contribution of amplified 11q13 sequences, which include the cyclin D1 locus, to poor clinical outcomes (8, 9). Cyclin D1 is likely a central contributor to 11q13 effects because high–cyclin D1 levels consistently correlate with a bad prognosis (1013). Additionally, cyclin D1 expression distinguishes malignant breast carcinoma from benign and premalignant lesions (14). Importantly, cyclin D1 levels did not correlate with cell proliferation markers in these tumors but, instead, correlate with tumor invasiveness.

Given cyclin D1's contributions to poor clinical outcomes, therapeutic strategies to attack its functions are needed. Built-in G1 cyclin redundancy and lack of specificity of candidate drugs have together limited development of CDK inhibitors as cancer therapeutics (15, 16). In contrast, cyclin D1 overexpression enhances sensitivity to ionizing radiation in vitro, although this interaction has received scant attention in clinical strategies to treat tumors overexpressing cyclin D1 (17). Clinically, low levels of cyclin D1 have indeed been shown to correlate with radiation treatment failures (18, 19). This effect has been attributed to cyclin D1's release of p21CIP1 from interactions with Cdk4 after cyclin D1 binding, leading to consequent inhibition of Cdk2 (17, 20). Alternatively, cyclin D1 overexpression has also been reported to sensitize breast cells to ionizing radiation by increasing death receptor 5 (DR5) mRNA levels. The increased DR5 levels were reported to sensitize cells to the combination of radiation and the tumor necrosis factor–related apoptosis–inducing ligand (Apo-2L; ref. 21).

Although it was initially assumed that cyclin D1 drove tumorigenesis through interactions with Cdk4, Cdk-independent effects on gene expression are increasingly recognized as key contributors to its pathogenic functions (6, 22). Cyclin D1 was first shown to regulate estrogen response elements through ligand-independent interactions with estrogen receptor coactivators (23, 24). A subsequent computational analysis of gene expression patterns showed transcriptional interactions between the CEBPß transcription factor and cyclin D1 that controlled transcription of several target genes (25). Cyclin D1 both represses peroxisome proliferator–activated receptor {gamma} and blocks BRCA1 repression of the estrogen receptor (26, 27). Recent array analyses have defined genes regulating mitochondrial function as additional cyclin D1 transcriptional targets (28, 29). Using laser capture microdissected tissues, our laboratory recently identified potential cyclin D1–regulated and estrogen-regulated genes that are up-regulated in invasive cancers caused by cyclin D1 (30). Because the combination of radiation and adjuvant hormone treatment is standard therapy for early-stage breast cancers after breast conservation surgery (3140), cyclin D1–regulated genes that are ER responsive could be of interest as potential contributors to treatment failures for these therapies. Whereas a large variety of candidate cyclin D1 target genes have now been identified using microarray analyses, their functional contributions to its pathogenic effects are less well understood. Here, we show that the heat shock protein B8 (HSPB8; HSP22; SSP1) that we recently identified as a contributor to invasion in cyclin D1–induced tumors can also participate in the increased radiation sensitivity caused by cyclin D1. These studies, therefore, identify a cyclin D1 target gene that simultaneously contributes to cyclin D1 pathogenesis yet suggests a potential vulnerability of cyclin D1–induced tumors to treatment by ionizing radiation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and DNA constructs. MDA-MB-157, MDA-MB-231, MDA-MB-415, MDA-MB-435, MDA-MB-436, MDA-MB-453, MDA-MB-468, BT474, BT549, MCF7, and T47D breast cancer cells were grown in conditions indicated by the supplier (American Type Culture Collection). Dr. Toshi Shioda (MGH Cancer Center) provided MCF7 Bus cells. The plasmids pRC-CMV–cyclin D1 and the pRC-CMV–mutant K112E were used as previously described (23, 30). The vector expressing a 40–amino acid N-terminal deletion mutation of cyclin D1 ({delta}N40) that loses its p21 interaction domain was provided by Dr. Rolf Muller (Marburg, Germany; ref. 41). The HSPB8 expression vector was previously described (30). Control cells were transfected with an empty pcDNA3.1 vector. Cells were stably transfected using LipofectAMINE (Invitrogen), and pooled transfectants were selected with G418 (Life Technologies; 800 µg/mL).

p21 (Ambion), p16 (Ambion), HSPB8 (Dharmacon), and scramble (Dharmacon) small interfering RNAs (siRNA) were transfected using oligofectamine (Invitrogen) according to instructions from the providers of the siRNAs. To show efficacy of the siRNAs, cells were harvested 48 h after transfection and analyzed in Western blots as described below. For the studies of the effects of siRNAs on radiation sensitivity, cells were transiently transfected with combinations of p16, p21, HSPB8, or scramble siRNAs, together with either the empty pcDNA3.1 vector or pRC-CMV–cyclin D1 using oligofectamine (Invitrogen). At 48 h after transfection, the cells were irradiated using the indicated doses of radiation. The following day, they were trypsinized and seeded for clonogenic survival assays.

Clonogenic survival assay. Cells in exponential growth phase were counted and plated in triplicate in 60-mm dishes containing 4 mL of medium to yield 50 to 100 colonies per dish. At 24 h later, the cells were exposed to varying doses of irradiation, using a 137Cs irradiation unit with a dose rate of 2 to 6 Gy·min–1. After 14 days of incubation at 37°C, cells were fixed and stained with 1% methylene blue in 50% methanol. Colonies of >50 cells, as assessed by microscopic inspection, were scored as survivors. The number of colonies per well was counted, and the surviving fraction was calculated as the ratio of colonies in treated versus untreated wells. The experiments evaluating the effects of cyclin D1, its KE mutant, and its {delta}N40 mutant on the radiation sensitivity of MCF7 and T47D cells were done in triplicate for each dose, and the mean and SE of two to four repetitions of each experiment are plotted along with a best-fit linear quadratic regression for all data taken together. The siRNA experiments were done in triplicate, and all data from two replications of these experiments were plotted. Significance was assessed using Student's t test.

RNA and protein expression analysis. Levels of expression of cyclin D1, p21, HSPB8, and actin mRNAs were analyzed using total cellular RNAs from the indicated transfectants that were size fractionated (10 µg per lane) on formaldehyde agarose gels, transferred to Hybond-N nylon matrices, and cross-linked by UV light. Filters were hybridized in hybridization solution (Rapidhyb; Amersham) at 65°C with cyclin D1, HSPB8, or actin cDNA fragments {alpha}32-P labeled by the Klenow reaction. For Western analyses, cells were lysed in Laemmli loading buffer. Ten micrograms of protein sample were subjected to 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes. Membranes were incubated with an affinity-purified rabbit polyclonal anti–cyclin D1 (42), an anti-ER antibody (HC-20; Santa Cruz), p21 antibody (C-19; Santa Cruz), or an anti-HSPB8 antibody (2H5 mouse monoclonal antibody; Novus Biological). A mouse monoclonal antibody against actin (Boehringer) assessed loading equivalence. Secondary antibodies were either purchased from Santa Cruz or were those included in an enhanced chemiluminescence detection kit (Amersham).

To assess HSPB8 regulation by the {delta}40 cyclin D1, proliferating MCF-7 cells expressing {delta}40 or the vector control were incubated in phenol red–free DMEM with 5% charcoal-stripped serum for 3 days before treatment. Stable transfectants were then treated for 1 h with 100 nmol/L 17ß-estradiol or vehicle control at 37°C, and total RNA was harvested with Trizol (Invitrogen). mRNA was reverse-transcribed into cDNA and converted to dsDNA; quantitative reverse transcription–PCR (qRT-PCR) was done as described (30).

Human breast cancer specimen laser capture microdissection, RNA isolation and amplification, and qRT-PCR analysis. Laser capture microdissection was described previously (43). For human samples, specimens were collected by snap freezing and stored in –80°C until microdissection. Patient-matched normal breast tissue and DCIS/IDC were microdissected from breast tissue, wherein the normal tissue was at a minimum, 0.3 cm, from any premalignant or malignant lesion. Total RNA was extracted from captured cells and underwent T7-based RNA amplification (43). Estrogen receptor status for each patient sample was provided in the anonymized record. qRT-PCR was done using standard methods (44). Primer sets used included the following: for HSPB8, forward: CCTTTCTTCTGTCCCCTGTGTTT/reverse: CCGCCCATATACACAATACCACTA/probe: CTCCATCAGGAACCAAGCAAAGGCC; for cyclin D1, forward primer: GGATGCTGGAGGTCTGCGA/reverse primer: AGAGGCCACGAACATGCAAG/probe: AGGAGGTCTTCCCGCTGGCCATGAAC. Cyclin D1 status was established by the qRT-PCR results with cyclin D1–positive tumors taken as those showing a 2-fold or greater increase in cyclin D1 mRNA from normal to tumor tissues.

In vivo radiation response. Pellets containing 17ß-estradiol (1.7 mg per pellet) were implanted into nude mice obtained from Charles River Laboratories, 2 days before transplantation with MCF7 cells. On the day of transplantation, subconfluent MCF-7 cells expressing the control vector and cells expressing cyclin D1 and HSPB8 were irradiated to a final dose of 4 Gy. The irradiated cells were trypsinized and counted 1 h after radiation. Unirradiated cells of the three transfection types were harvested in parallel. We then injected 1 x 107 cells into four mice for each of six experimental conditions using three injection sites per mouse. We compared unirradiated vector-transfected, cyclin D1–transfected, and HSPB8-transfected cells and radiated vector-transfected, cyclin D1–transfected, and HSPB8-transfected cells. Mice were monitored weekly for tumors, and tumor volumes were determined using micrometer caliper measurements as described (45). Tumor engraftment rates were determined by counting the number of injections resulting in formation of a tumor, divided by the total number of injection sites. We then divided the engraftment rate for the experimental cells by the rate of engraftment in the vector control injections to determine the fold change in engraftment rate. These data were then plotted as fold change comparing fold change in tumor engraftment rates from vector control to experimental cyclin D1 and HSPB8-expressing cells. Mean tumor volumes, together with SE, were plotted at 2, 3, and 4 weeks after injection. Significance of the difference in tumor volumes was determined using Student's t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We developed breast cancer cell lines overexpressing both cyclin D1 and a cyclin D1 mutant (KE) that cannot interact with Cdks (46) to conclusively evaluate Cdk4 interactions as a cause of the increased radiation sensitivity that has been previously observed in cyclin D1–overexpressing cells (Fig. 1 ). We showed elevated cyclin D1 levels in the pooled, stably transfected breast cancer cell lines (Fig. 1A and C). We then treated them with therapeutically relevant doses of radiation (Fig. 1B and D). Our approach contrasts with the nontherapeutic doses of radiation (20) and nonmalignant cell line (21) tested in two of the previous studies of cyclin D1's effects on radiation sensitivity. Using standard clonogenic survival analyses, cyclin D1 increased the radiation sensitivity of these cells (Fig. 1B and D). Importantly, this effect was not due to Cdk4-dependent pRb phosphorylation because the KE mutant of cyclin D1 caused equivalent increases in radiation sensitivity as wild-type cyclin D1. Cyclin D1's effect was independent of p53 status because it was seen in T47D cells that are p53 mutated (Fig. 1D). Furthermore, cyclin D1 had no differential effect on the expected increase in p53 levels after irradiation in the p53 wild-type MCF7 cells used here that might account for its effects, and the p16/p14ARF locus is lost in these cells, excluding its potential contribution to cyclin D1's effects (Supplementary Fig. S1A–C).


Figure 1
View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. A mutant cyclin D1 (KE) that cannot interact with CDKs increases radiation sensitivity of transfected breast cancer cells. MCF7 and T47D breast cancer cells stably overexpressing wild-type cyclin D1 and the KE mutant of cyclin D1 that fails to phosphorylate pRb were exposed to therapeutic doses of radiation and plated in a standard survival curve analysis. A, pools of MCF7 cells transfected with a vector control (3.1), the wild-type cyclin D1 (D1), and the KE mutant that cannot interact with CDKs (KE) were selected with G418. The pooled transfectants were then assessed for expression of the transfected allele in Northern blots because the transfected allele (t) migrates at a smaller size than the endogenous allele (e). We confirmed that this resulted in a net increase of cyclin D1 protein in the cyclin D1–expressing and KE-expressing cells using a Western blot. B, these pools were then exposed to 1, 2, or 4 Gy in a {gamma} irradiator and then plated. Surviving colonies were counted 2 wk later, and the surviving fraction was determined for three independent plates at each dose. Surviving fraction is plotted on the Y axis versus dose of radiation on the X axis. Mean surviving fractions at each dose for three plates averaged over four independent repetitions of the experiment. Linear logarithmic trend line fit by the method of least squares to the individual data points. The difference between the vector and cyclin D1 surviving fraction is significant at P = 0.0057 and between vector and KE at P = 0.018 by t test. C, T47D cells were transfected and analyzed in the same manner as described in A. D, the T47D transfectants were irradiated and analyzed as described in B, except that doses of 2, 4, and 6 Gy were used. The difference between the vector and cyclin D1 surviving fraction is significant at P = 0.047 and between vector and KE at P = 0.05 by t test.

 
The KE mutant of cyclin D1 is still capable of binding to and, therefore, titrating p21 (Supplementary Fig. S1D). We therefore evaluated potential interactions between cyclin D1 and p21 that have been proposed to mediate cyclin D1's effects on radiation sensitivity (Fig. 2 ; refs. 17, 20). A previously reported N-terminal deletion of cyclin D1 (D1{delta}40) both truncates its p21 interaction domain and blocks its titration of cellular p21 without blocking its effects on cellular transformation (41). This D1{delta}40 mutant of cyclin D1 increased radiation sensitivity in both MCF7 (Fig. 2A and B) and T47D (Fig. 2C and D) pooled transfectants to nearly the same extent as wild-type cyclin D1, arguing that cyclin D1's ability to titrate p21 is not a sole requirement for cyclin D1's effect on radiation sensitivity.


Figure 2
View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. A cyclin D1 mutant lacking the 40 amino acids at its N terminus that mediate its interactions with p21CIP1 also increases radiation sensitivity of MCF7 and T47D breast cancer cells. A, we transfected MCF7 cells with the vector control, the wild-type cyclin D1 construct, and a 40–amino acid truncation mutant of cyclin D1 that is not capable of interacting with p21 (N40). Pooled transfectants selected in G418-containing media were assessed for expression of the cyclin D1 constructs in a Northern analysis to show the more rapidly migrating transfected constructs. B, the pooled transfectants were then treated with the indicated doses of radiation, and clonal survival was determined as described in Fig. 1. Data were plotted as in Fig. 1. In this case the difference between vector and {delta}N40 was significant at P = 0.05 by t test. C, we further transfected T47D cells with the N terminal truncated N40 mutant and showed its expression in a Northern blot compared with cyclin D1 transfectants. D, we compared the clonal survival curve of this construct to the cyclin D1 transfectants using the methods used in Fig. 1. In this case the difference between vector and {delta}N40 was significant at P = 0.05 by t test.

 
Paradoxically, p21 has been reported to stimulate apoptosis in some cells, and in some conditions, it can also increase radiation sensitivity (47, 48). To formally exclude increased p21 as a potential positive mediator of the increased radiation sensitivity caused by cyclin D1 transfection, we evaluated the effect of a p21 siRNA on the radiation sensitivity of the cyclin D1 transfectants. We first identified p21 siRNAs that substantially knocked down its levels determined using immunoblots (Fig. 3A ). We then transfected vector-transfected and cyclin D1–transfected cells with the p21 siRNAs and evaluated their radiation sensitivity. We further transfected vector-transfected and cyclin D1–transfected cells with a negative control p16 siRNA for comparison with the effects of the p21 siRNA because MCF7 cells are p16 null. Loss of p21 increased radiation sensitivity of both the vector–transfected and cyclin D1–transfected cells compared with the p16 siRNA–transfected controls (Fig. 3B). Thus, increased p21 does not act in our cells to positively mediate radiation sensitivity of cyclin D1–overexpressing cells.


Figure 3
View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Loss of p21 decreases the survival of cyclin D1–overexpressing cells after radiation. A, three p21 siRNA oligonucleotides were evaluated for their effect on p21 protein levels. The siRNAs were transfected into MCF7 cells, and p21 protein levels were determined 72 h after the transfection. B, MCF7 cells containing the empty vector or cyclin D1 were transfected with p21 siRNAs (from lane 3), and their radiation response was analyzed in the clonal survival assay. The vector control and cyclin D1 transfectants were further transfected with p16 siRNAs and analyzed in the clonal survival assay as a negative control to compare with the p21 siRNA-transfected cells because MCF7 cells are p16 null. The difference between the vector and cyclin D1 surviving fraction in the presence of the p16 siRNA is significant at P = 0.039 by t test. The difference between the p21 and p16 siRNA-treated curves is significant at P = 0.05 by t test.

 
Because neither its interactions with CDKs nor its interactions with p21 fully explained cyclin D1's effects on radiation sensitivity, we sought to determine whether any cyclin D1 target gene might play a role in this effect. We recently identified HSPB8 as a highly cyclin D1–responsive gene that is also regulated by estradiol (30). In that report, we showed that both cyclin D1 and its KE mutant increased HSPB8 levels in transfected cells. Here, we show additional evidence that HSPB8 may be an important cyclin D1–regulated target in human breast cancers. First, HSPB8 expression is strikingly limited in vitro to breast cancer cell lines that express both cyclin D1 and the estrogen receptor (Fig. 4A ). In addition, we find a similar association between HSPB8 and cyclin D1/ER status in clinical breast cancer specimens using qRT-PCR to measure their mRNA levels in aRNA previously isolated from 36 laser capture dissected, patient-matched samples (Fig. 4B; ref. 43). We compared fold increases from normal to malignant breast tissues for HSPB8 mRNA levels with the tumors' estrogen receptor and cyclin D1 expression status (Fig. 4B). HSPB8 increased 21-fold during progression from normal to DCIS/IDC in ER-positive tumors (P = 0.003) versus a 15-fold change in ER-negative tumor tissue (not significant). Likewise, HSPB8 increased 22-fold in tumors if they were cyclin D1–positive (P = 0.005) and was further increased 31-fold if tumors were both cyclin D1– and ER-positive (P = 0.022). We also evaluated large data sets available through Oncomine for possible association between ER status and HSPB8 expression (49). In all 13 available studies, HSPB8 levels in breast cancers show statistically increased levels of HSPB8 in ER-positive tumors (P values range from 0.047 to 6.2 x 10–7; Supplementary Fig. S2). Taken with our previous experimental work, these clinical data suggest that regulation of HSPB8 is highly relevant to cyclin D1's function in human tumors.


Figure 4
View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. HSPB8 expression correlates with estrogen receptor and cyclin D1 expression. HSPB8 mRNA expression levels correlated with ER status of cells and cyclin D1 levels. A, expression of HSPB8 was assessed in a panel of breast cancer cells using RNA blots. The indicated breast cancer cell lines were tested for HSPB8 mRNA in Northern blots, and the ethidium bromide stained gel is shown as a loading control. Western blots were then done to evaluate ER and cyclin D1 protein levels in the same cell lines for comparison to the HSPB8 expression in those cells. An actin loading control is shown. B, increased expression of HSPB8 in human tumor samples is compared with their cyclin D1 and estrogen receptor status. Columns, mean HSPB8 expression change, comparing patient-matched invasive tumor-normal pairs for patient-matched human specimens, for each sample; bars, SE. HSPB8 fold changes are shown for tumors that were cyclin D1 and ER negative (D1 neg ER neg), ER or progesterone receptor positive (ER/PR positive), cyclin D1 positive (D1 pos), and cyclin D1 and ER positive (D1 pos ER pos). C, mRNA was harvested from MCF-7 cells transfected with control vector or pCMV-{delta}40–cyclin D1 ({delta}40 ccnD1) in the absence (open columns) and presence (shaded columns) of 17ß-estradiol. We used qRT-PCR to assess fold increases in expression of HSPB8. Columns, mean of three determinations; bars, SD. The fold increase from untreated-vector to estradiol treated–vector samples was significant at P = 7 x 10–5, from untreated-vector to untreated–{delta}40 samples was significant at P = 2 x 10–6, and from untreated-vector to estradiol treated–{delta}40 samples was significant at P = 5 x 10–7.

 
Importantly, because the D1{delta}40 mutant of cyclin D1 increases radiation sensitivity, we tested its effects on HSPB8 expression in transfected MCF7 cells to be certain that HSPB8 is also a target gene for {delta}40-mutated cyclin D1 (Fig. 4C). We had previously shown that cyclin D1 and the KE mutant increased HSPB8 expression. Here, we show that the D1{delta}40 mutant caused a 4.5-fold increase in HSPB8 levels and increased 9-fold when the cyclin D1–expressing cells were treated with estradiol (Fig. 4C).

To determine whether HSPB8 could mediate cyclin D1's effects on radiation sensitivity, we developed pooled transfectants expressing increased HSPB8 (Fig. 5A ). Using our radiation treatment protocol, we found that HSPB8 markedly increased the radiation sensitivity of these transfectants (Fig. 5B). We then identified siRNAs that knocked HSPB8 protein levels down by >90% (Fig. 5C). Using transient transfections to evaluate the effect of blocking HSPB8 increases on the radiation sensitivity of the cyclin D1–overexpressing cells, we found that decreased HSPB8 made cells more radiation resistant and blocked a portion of cyclin D1's enhancement of radiation sensitivity (Fig. 5D).


Figure 5
View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. HSPB8 expression alters radiation sensitivity of transfected breast cancer cells. A, immunoblots evaluated cyclin D1 (cyc D1), HSPB8, and actin levels in pools of MCF7 cells stably transfected with a cyclin D1 expression vector, an HSPB8 expression vector, and an empty vector control. B, the HSPB8 transfected cells were then evaluated for radiation sensitivity using the same methods described in the previous figures. The difference between vector and HSPB8 curves was significant at P = 0.046 by t test. C, MCF7 cells were transiently transfected with cyclin D1 in combination with a scrambled siRNA (D1-scL) or the HSPB8 siRNA (D1-siH). In addition, MCF7 cells were transiently transfected with an empty control vector in combination with a scrambled oligonucleotide (3.1-scL) or the HSPB8 siRNA (3.1-siH). Expression levels of cyclin D1, HSPB8, and actin were then evaluated in Western blots. The transient transfection with cyclin D1 increased HSPB8 levels ~2-fold when these blots were quantified in image analysis; the HSPB8 knockdown was ~8-fold in each case. D, the transiently transfected cells were then analyzed for their radiation sensitivity using the previously described methods. Points, data from two separate repetitions of the curve and the best-fit linear-log regression. The difference between vector and cyclin D1 treated with the scrambled siRNA curves was significant at P = 0.00034 by t test. The difference between the HSPB8 siRNA and scrambled control siRNA-treated vector samples was significant at P = 0.034, and the difference between the HSPB8 siRNA and scrambled control siRNA-treated cyclin D1 samples was significant at P = 0.05.

 
To test the potential in vivo relevance of our findings, we evaluated the radiation sensitivity of MCF7 cells expressing cyclin D1 and HSPB8 using nude mouse xenografts (Fig. 6 ). Tumor engraftment and growth rates of unirradiated MCF7 cells transfected with HSPB8 and cyclin D1 were increased (Fig. 6A and B). Cyclin D1 expression doubled the engraftment rate, and HSPB8 increased engraftment by 75%. The resulting HSPB8 transfected tumors were 78% larger at the initial measurement at 2 weeks and 58% larger in the cyclin D1–transfected cells 3 weeks after transplantation. Radiation treatment had the opposite effect on both engraftment and tumor growth rates in cells transfected with cyclin D1 and HSPB8 (Fig. 6A and B). Cyclin D1 expression caused a 37% decrease in tumor engraftment after radiation treatment, and by the end of the observation period, cyclin D1–transfected tumors were 49.9% of the size of the vector control tumors (P = 5.7 x 10–4 by t test). HSPB8 caused a 55% decrease in tumor engraftment, and by the end of the observation period, HSPB8 tumors were 47.3% of the size of the vector control tumors (P = 0.0012 by t test).


Figure 6
View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Cyclin D1 and HSPB8 increase radiation sensitivity in an MCF7 xenograft model in vivo. A, we compared the rate of tumor engraftment of cyclin D1– and HSPB8-expressing MCF7 cells to those of vector controls when injected into nude mice. Tumor engraftment rates were determined by counting the number of injections resulting in formation of a tumor, divided by the total number of injection sites. We then divided the engraftment rate for the experimental cells by the rate of engraftment in the vector control injections to determine the fold change in engraftment rate. Fold changes in tumor engraftment rates at week 2 comparing with cyclin D1– (CCND1) and HSPB8-expressing cells to vector control transfectants using unirradiated (open bars) and cells irradiated with 4 Gy (filled bars). B, we compared the tumor volumes of cyclin D1– and HSPB8-expressing MCF7 tumors to those of vector controls after tumors formed in nude mice. Time after transplantation is shown along the X axis in weeks, and tumor volume (cm3) is plotted along the Y axis. The HSPB8 tumors are shown as square symbols with a solid line connecting the points. The cyclin D1 tumors are shown as diamonds with a dashed line connecting them. The vector control samples are shown as triangles with a dotted line connecting them. In each case, the unirradiated cells are closed symbols and the irradiated cells are open symbols. Points, mean for the tumors that developed in each condition (not inclusive of the tumors that failed to develop); bars, SE. The difference between mean tumor sizes of the irradiated cyclin D1– and vector-transfected samples was significant at P = 0.00057 after 4 wk of observation. The difference between mean tumor sizes of the irradiated HSPB8- and vector-transfected samples was significant at P = 0.0012 after 4 wk of observation.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Radiation therapy is a standard part of primary treatment for early-stage breast cancers after breast conservation surgery (3133). Adjuvant hormone therapy is also a key part of early breast cancer treatment (3436). The combination of radiation and adjuvant hormone therapy has additive benefits in several clinical studies (3740). Nevertheless, treatment failures for both modalities continue to contribute to breast cancer mortality. Few preclinical studies have explored the nature of potential interactions between hormonal and radiation therapies (50). Interestingly, although cyclin D1 has a clear association with hormone-positive breast cancer and can increase radiation sensitivity, the potential vulnerability of breast cancers expressing cyclin D1 to radiation treatment has received little notice. We recently identified several estrogen- and cyclin D1–regulated genes that contribute to the invasive phenotype of breast cancers in transgenic models and in clinical specimens (30). Here, we show that one of them, HSPB8, can mediate some of cyclin D1's enhancement of radiation sensitivity.

We initially sought to evaluate known mechanisms that might account for cyclin D1's enhancement of radiation sensitivity using a genetic approach. In contrast to previous studies, we used mutated forms of cyclin D1 that alter its effects on pRb phosphorylation and p21 titration to test those contributions to altered radiation sensitivity. Our data show that cyclin D1's enhancement of radiation sensitivity persists even when its ability to phosphorylate pRb or interact with p21 are lost (Figs. 1 and 2). These findings imply that some CDK-independent function of cyclin D1 likely contributes to this effect. On the other hand, our data do not completely eliminate potential contributions of both pRb and p21 titration to cyclin D1's enhancement of radiation sensitivity. In both of our experiments the mutated cyclin D1 was relatively more resistant than the wild type, indicating that some effect on sensitivity was lost due to the mutations. In particular, biochemical evidence linking p21 titration to cyclin D1's effect is strong (17, 20), and loss of p21 markedly enhances radiation sensitivity in our model (Fig. 3). However, our genetic evidences do show that CDK-dependent and p21 titration–dependent effects do not fully account for cyclin D1's role in radiation responsiveness.

Because neither pRb phosphorylation nor p21 titration could fully explain cyclin D1's enhancement of radiation, we then considered whether any cyclin D1 target genes might be contributing to its effects. We recently identified genes whose expression was increased by cyclin D1 and wherein cyclin D1 enhanced ER-coactivator binding to their promoters in an estradiol-independent manner. All of these genes were also estradiol responsive (30). Here, we further show a tight correlation between the most responsive of those genes, HSPB8, and the cyclin D1 and ER status of breast cancer cells (Fig. 4). To evaluate whether a CDK-independent regulation of gene expression might be contributing to its effects on radiation sensitivity, we therefore tested the potential for HSPB8 to contribute to its radiation effects. We clearly found that HSPB8 could enhance radiation sensitivity on its own (Figs. 5B and 6). Indeed HSPB8 was more potent than cyclin D1 alone, possibly due to the higher HSPB8 levels achieved by its direct transfection compared with the cyclin D1 transfectants (Fig. 5A). We then knocked down HSPB8 levels and found that its loss reversed some of the radiation sensitivity of cyclin D1 overexpressers (Fig. 5C and D). This incomplete reversion may result from the relatively weaker knockdown effects seen in transient transfectants; a more complete loss of HSPB8 might produce a larger effect. However, it seems likely that HSPB8 is not the sole contributor to cyclin D1's effects.

The association between cyclin D1 expression and estrogen receptor status of breast cancer cells is firmly established (9). A portion of this linkage may be due to cyclin D1's regulation by the estrogen receptor (51). However, cyclin D1 has also been shown to bind to estrogen receptor coactivators and thereby stimulate estrogen response elements in a ligand-independent manner (23, 24). This induction is independent of both cdk4 and estrogen ligand and depends on direct protein interactions between cyclin D1 and either the steroid coactivator-1 or the p300/CRB-binding protein–associated protein (52, 53). Our previous publication showed that cyclin D1 expression enhanced p300 coactivator binding to the HSPB8 promoters (30). Thus, HSPB8 is an important cyclin D1 target gene because it is the first reported endogenous target to behave as a ligand-independent responder to cyclin D1. We compared the regulation of several other proposed candidate genes in our cyclin D1–transfected cells to assess the uniqueness of this response. One previously proposed candidate target of cyclin D1, the DR5, had been reported to contribute to its effects on radiation sensitivity (21). In contrast to the previous studies, cyclin D1 expression had no effect on DR5 levels in our overexpressing breast cancer cells (Supplementary Fig. S3A). Another laboratory has proposed that cyclin D1 interacts with CEBPß to regulate a different set of genes (25). Unlike HSPB8, none of the reported cyclin D1–CEBPß–responsive genes were cyclin D1–responsive or estrogen-responsive in our transfectants. Thus, of the known candidate cyclin D1 target genes, HSPB8 is a unique explanation for the pRb-independent and p21-independent radiation effects seen in our transfectants.

HSPB8 is a heat-inducible small HSP with chaperone activities (54). Mutations in HSPB8 cause Charcot-Marie tooth disease, a distal motor neuropathy (55). It is a member of, and interacts with, a number of other small HSPs (56). In particular, it can interact with {alpha}B crystallin. Because {alpha}B crystallin was recently shown to be involved in ubiquitination interactions involving cyclin D1 (57), we speculate that HSPB8 interactions with {alpha}B crystallin may be playing a role in the radiation response of cyclin D1–overexpressing cells. Genes regulated by HSPB8's chaperone function will be interesting to identify in future experiments.

Taken in combination, our results show that HSPB8, a CDK-independent target of cyclin D1, can mediate cyclin D1's effects on radiation sensitivity. We previously showed that cyclin D1 can regulate HSPB8 levels in a ligand-independent and steroid coactivator–dependent manner (30). HSPB8 expression is tightly correlated with cyclin D1 and ER status in breast cancer specimens (Fig. 4). Now, we show that HSPB8 enhances radiation sensitivity on its own in vitro and in vivo, and its loss in cyclin D1–overexpressing cells blocks some of cyclin D1's effects (Figs. 5 and 6). Our result suggests the intriguing possibility that radiation therapy might be better delivered to ER-positive and cyclin D1–positive breast cancers along with estradiol itself, rather than in combination with anti-estrogenic agents, as it is currently delivered. Given the importance of radiation and hormonal therapies to the treatment of early-stage breast cancer, further evaluations of the mechanisms of its regulation by cyclin D1 and its effects on radiation sensitivity will be important.


    Acknowledgments
 
Grant support: NIH National Cancer Institute grants RO1 CA69069 (S. Trent, C. Yang, and E.V. Schmidt) and RO1 CA112021 (C. Li) and Harvard Breast Cancer Specialized Programs of Research Excellence grant P50 CA89393 (C. Li).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Reagents contributed by other investigators are listed in the materials section.

Received 4/23/07. Revised 7/24/07. Accepted 8/30/07.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ormandy CJ, Musgrove EA, Hui R, Daly RJ, Sutherland RL. Cyclin D1, EMS1 and 11q13 amplification in breast cancer. Breast Cancer Res Treat 2003;78:323–35.[CrossRef][Medline]
  2. Diehl JA. Cycling to cancer with cyclin D1. Cancer Biol Ther 2002;1:226–31.[Medline]
  3. Sweeney KJ, Swarbrick A, Sutherland RL, Musgrove EA. Lack of relationship between CDK activity and G1 cyclin expression in breast cancer cells. Oncogene 1998;16:2865–78.[CrossRef][Medline]
  4. Quelle DE, Ashmun RA, Shurtleff SA, et al. Overexpression of mouse D-type cyclins accelerates G1 phase in rodent fibroblasts. Genes Dev 1993;7:1559–71.[Abstract/Free Full Text]
  5. LaBaer J, Garrett MD, Stevenson LF, et al. New functional activities for the p21 family of CDK inhibitors. Genes Dev 1997;11:847–62.[Abstract/Free Full Text]
  6. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions. Endocrinology 2004;145:5439–47.[Abstract/Free Full Text]
  7. Bernards R. CDK-independent activities of D type cyclins. Biochim Biophys Acta 1999;1424:M17–22.[Medline]
  8. Neve RM, Chin K, Fridlyand J, et al. A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell 2006;10:515–27.[CrossRef][Medline]
  9. Chin K, DeVries S, Fridlyand J, et al. Genomic and transcriptional aberrations linked to breast cancer pathophysiologies. Cancer Cell 2006;10:529–41.[CrossRef][Medline]
  10. Bieche I, Olivi M, Nogues C, Vidaud M, Lidereau R. Prognostic value of CCND1 gene status in sporadic breast tumours, as determined by real-time quantitative PCR assays. Br J Cancer 2002;86:580–6.[CrossRef][Medline]
  11. van Diest PJ, Michalides RJ, Jannink L, et al. Cyclin D1 expression in invasive breast cancer. Correlations and prognostic value. Am J Pathol 1997;150:705–11.[Abstract]
  12. Umekita Y, Ohi Y, Sagara Y, Yoshida H. Overexpression of cyclinD1 predicts for poor prognosis in estrogen receptor-negative breast cancer patients. Int J Cancer 2002;98:415–8.[CrossRef][Medline]
  13. Kenny FS, Hui R, Musgrove EA, et al. Overexpression of cyclin D1 messenger RNA predicts for poor prognosis in estrogen receptor-positive breast cancer. Clin Cancer Res 1999;5:2069–76.[Abstract/Free Full Text]
  14. Weinstat-Saslow D, Merino MJ, Manrow RE, et al. Overexpression of cyclin D mRNA distinguishes invasive and in situ breast carcinomas from non-malignant lesions. Nat Med 1995;1:p1257–60.[CrossRef]
  15. Shapiro GI. Cyclin-dependent kinase pathways as targets for cancer treatment. J Clin Oncol 2006;24:1770–83.[Abstract/Free Full Text]
  16. Nahta R, Trent S, Yang C, Schmidt EV. Epidermal growth factor receptor expression is a candidate target of the synergistic combination of trastuzumab and flavopiridol in breast cancer. Cancer Res 2003;63:3626–31.[Abstract/Free Full Text]
  17. Coco Martin JM, Balkenende A, Verschoor T, Lallemand F, Michalides R. Cyclin D1 overexpression enhances radiation-induced apoptosis and radiosensitivity in a breast tumor cell line. Cancer Res 1999;59:1134–40.[Abstract/Free Full Text]
  18. Yoo SS, Carter D, Turner BC, et al. Prognostic significance of cyclin D1 protein levels in early-stage larynx cancer treated with primary radiation. Int J Cancer 2000;90:22–8.[CrossRef][Medline]
  19. Shintani S, Mihara M, Ueyama Y, Matsumura T, Wong DT. Cyclin D1 overexpression associates with radiosensitivity in oral squamous cell carcinoma. Int J Cancer 2001;96:159–65.[CrossRef][Medline]
  20. Agami R, Bernards R. Distinct initiation and maintenance mechanisms cooperate to induce G1 cell cycle arrest in response to DNA damage. Cell 2000;102:55–66.[CrossRef][Medline]
  21. Zhou Q, Fukushima P, DeGraff W, et al. Radiation and the Apo2L/TRAIL apoptotic pathway preferentially inhibit the colonization of premalignant human breast cells overexpressing cyclin D1. Cancer Res 2000;60:2611–5.[Abstract/Free Full Text]
  22. Ewen ME, Lamb J. The activities of cyclin D1 that drive tumorigenesis. Trends Mol Med 2004;10:158–62.[CrossRef][Medline]
  23. Zwijsen RM, Wientjens E, Klompmaker R, van der Sman J, Bernards R, Michalides RJ. CDK-independent activation of estrogen receptor by cyclin D1. Cell 1997;88:p405–15.[CrossRef]
  24. Neuman E, Ladha MH, Lin N, et al. Cyclin D1 stimulation of estrogen receptor transcriptional activity independent of cdk4. Mol Cell Biol 1997;17:p5338–47.
  25. Lamb J, Ramaswamy S, Ford HL, et al. A mechanism of cyclin D1 action encoded in the patterns of gene expression in human cancer. Cell 2003;114:323–34.[CrossRef][Medline]
  26. Wang C, Fan S, Li Z, et al. Cyclin D1 antagonizes BRCA1 repression of estrogen receptor {alpha} activity. Cancer Res 2005;65:6557–67.[Abstract/Free Full Text]
  27. Wang C, Pattabiraman N, Zhou JN, et al. Cyclin D1 repression of peroxisome proliferator-activated receptor {gamma} expression and transactivation. Mol Cell Biol 2003;23:6159–73.[Abstract/Free Full Text]
  28. Wang C, Li Z, Lu Y, et al. Cyclin D1 repression of nuclear respiratory factor 1 integrates nuclear DNA synthesis and mitochondrial function. Proc Natl Acad Sci U S A 2006;103:11567–72.[Abstract/Free Full Text]
  29. Sakamaki T, Casimiro MC, Ju X, et al. Cyclin D1 determines mitochondrial function in vivo. Mol Cell Biol 2006;26:5449–69.[Abstract/Free Full Text]
  30. Yang C, Trent S, Ionescu-Tiba V, et al. Identification of cyclin D1- and estrogen-regulated genes contributing to breast carcinogenesis and progression. Cancer Res 2006;66:11649–58.[Abstract/Free Full Text]
  31. Carlson RW, McCormick B. Update: NCCN breast cancer clinical practice guidelines. J Natl Compr Canc Netw 2005;3 Suppl 1:S7–11.[Medline]
  32. Fisher B, Anderson S, Bryant J, et al. Twenty-year follow-up of a randomized trial comparing total mastectomy, lumpectomy, and lumpectomy plus irradiation for the treatment of invasive breast cancer. N Engl J Med 2002;347:1233–41.[Abstract/Free Full Text]
  33. Fisher B, Jeong JH, Anderson S, Bryant J, Fisher ER, Wolmark N. Twenty-five-year follow-up of a randomized trial comparing radical mastectomy, total mastectomy, and total mastectomy followed by irradiation. N Engl J Med 2002;347:567–75.[Abstract/Free Full Text]
  34. Carlson RW, Brown E, Burstein HJ, et al. NCCN task force report: adjuvant therapy for breast cancer. J Natl Compr Canc Netw 2006;4 Suppl 1:S1–26.
  35. Emens LA, Davidson NE. Adjuvant hormonal therapy for premenopausal women with breast cancer. Clin Cancer Res 2003;9:486–94S.
  36. Ma CX, Ellis MJ. Neoadjuvant endocrine therapy for locally advanced breast cancer. Semin Oncol 2006;33:650–6.[CrossRef][Medline]
  37. Fisher B, Bryant J, Dignam JJ, et al. Tamoxifen, radiation therapy, or both for prevention of ipsilateral breast tumor recurrence after lumpectomy in women with invasive breast cancers of one centimeter or less. J Clin Oncol 2002;20:4141–9.[Abstract/Free Full Text]
  38. Hughes KS, Schnaper LA, Berry D, et al. Lumpectomy plus tamoxifen with or without irradiation in women 70 years of age or older with early breast cancer. N Engl J Med 2004;351:971–7.[Abstract/Free Full Text]
  39. Fyles AW, McCready DR, Manchul LA, et al. Tamoxifen with or without breast irradiation in women 50 years of age or older with early breast cancer. N Engl J Med 2004;351:963–70.[Abstract/Free Full Text]
  40. Azria D, Gourgou S, Sozzi WJ, et al. Concomitant use of tamoxifen with radiotherapy enhances subcutaneous breast fibrosis in hypersensitive patients. Br J Cancer 2004;91:1251–60.[CrossRef][Medline]
  41. Zwicker J, Brusselbach S, Jooss KU, et al. Functional domains in cyclin D1: pRb-kinase activity is not essential for transformation. Oncogene 1999;18:19–25.[CrossRef][Medline]
  42. Zukerberg LR, Yang WI, Gadd M, et al. Cyclin D1 (PRAD1) protein expression in breast cancer: approximately one-third of infiltrating mammary carcinomas show overexpression of the cyclin D1 oncogene. Mod Pathol 1995;8:560–7.[Medline]
  43. Ma XJ, Salunga R, Tuggle JT, et al. Gene expression profiles of human breast cancer progression. Proc Natl Acad Sci U S A 2003;100:5974–9.[Abstract/Free Full Text]
  44. Yang C, Ionescu-Tiba V, Burns K, et al. The role of the cyclin D1-dependent kinases in ErbB2-mediated breast cancer. Am J Pathol 2004;164:1031–8.[Abstract/Free Full Text]
  45. Arteaga CL, Holt JT. Tissue-targeted antisense c-fos retroviral vector inhibits established breast cancer xenografts in nude mice. Cancer Res 1996;56:1098–103.[Abstract/Free Full Text]
  46. Hinds PW, Dowdy SF, Eaton EN, Arnold A, Weinberg RA. Function of a human cyclin gene as an oncogene. Proc Natl Acad Sci U S A 1994;91:709–13.[Abstract/Free Full Text]
  47. Gartel AL, Tyner AL. The role of the cyclin-dependent kinase inhibitor p21 in apoptosis. Mol Cancer Ther 2002;1:639–49.[Abstract/Free Full Text]
  48. Fotedar R, Brickner H, Saadatmandi N, et al. Effect of p21waf1/cip1 transgene on radiation induced apoptosis in T cells. Oncogene 1999;18:3652–8.[CrossRef][Medline]
  49. Rhodes DR, Kalyana-Sundaram S, Mahavisno V, et al. Oncomine 3.0: genes, pathways, and networks in a collection of 18,000 cancer gene expression profiles. Neoplasia 2007;9:166–80.[CrossRef][Medline]
  50. Toillon RA, Magne N, Laios I, et al. Interaction between estrogen receptor {alpha}, ionizing radiation and (anti-) estrogens in breast cancer cells. Breast Cancer Res Treat 2005;93:207–15.[CrossRef][Medline]
  51. Eeckhoute J, Carroll JS, Geistlinger TR, Torres-Arzayus MI, Brown M. A cell-type-specific transcriptional network required for estrogen regulation of cyclin D1 and cell cycle progression in breast cancer. Genes Dev 2006;20:2513–26.[Abstract/Free Full Text]
  52. Zwijsen RM, Buckle RS, Hijmans EM, Loomans CJ, Bernards R. Ligand-independent recruitment of steroid receptor coactivators to estrogen receptor by cyclin D1. Genes Dev 1998;12:p3488–98.
  53. McMahon C, Suthiphongchai T, DiRenzo J, Ewen ME. P/CAF associates with cyclin D1 and potentiates its activation of the estrogen receptor. Proc Natl Acad Sci U S A 1999;96:5382–7.[Abstract/Free Full Text]
  54. Chowdary TK, Raman B, Ramakrishna T, Rao CM. Mammalian Hsp22 is a heat-inducible small heat-shock protein with chaperone-like activity. Biochem J 2004;381:379–87.[CrossRef][Medline]
  55. Irobi J, Van Impe K, Seeman P, et al. Hot-spot residue in small heat-shock protein 22 causes distal motor neuropathy. Nat Genet 2004;36:597–601.[CrossRef][Medline]
  56. Sun X, Fontaine JM, Rest JS, Shelden EA, Welsh MJ, Benndorf R. Interaction of human HSP22 (HSPB8) with other small heat shock proteins. J Biol Chem 2004;279:2394–402.[Abstract/Free Full Text]
  57. Lin DI, Barbash O, Kumar KG, et al. Phosphorylation-dependent ubiquitination of cyclin D1 by the SCF(FBX4-{alpha}B crystallin) complex. Mol Cell 2006;24:355–66.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trent, S.
Right arrow Articles by Schmidt, E. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trent, S.
Right arrow Articles by Schmidt, E. V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online