Cancer Research Cancer Epigenetics  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 67, 10840, November 15, 2007. doi: 10.1158/0008-5472.CAN-07-1034
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schomber, T.
Right arrow Articles by Christofori, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schomber, T.
Right arrow Articles by Christofori, G.

Cell, Tumor, and Stem Cell Biology

Placental Growth Factor-1 Attenuates Vascular Endothelial Growth Factor-A–Dependent Tumor Angiogenesis during ß Cell Carcinogenesis

Tibor Schomber1, Lucie Kopfstein1, Valentin Djonov2, Imke Albrecht1, Vanessa Baeriswyl1, Karin Strittmatter1 and Gerhard Christofori1

1 Institute of Biochemistry and Genetics, Department of Clinical-Biological Sciences, University of Basel, Basel, Switzerland and 2 Institute of Anatomy, University of Berne, Berne, Switzerland

Requests for reprints: Gerhard Christofori, Institute of Biochemistry and Genetics, Department of Clinical Biological Sciences, University of Basel, Mattenstrasse 28, 4058 Basel, Switzerland. Phone: 41-61-267-35-64; Fax: 41-61-267-35-66; E-mail: Gerhard.christofori{at}unibas.ch.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Members of the vascular endothelial growth factor (VEGF) family are critical players in angiogenesis and lymphangiogenesis. Although VEGF-A has been shown to exert fundamental functions in physiologic and pathologic angiogenesis, the exact role of the VEGF family member placental growth factor (PlGF) in tumor angiogenesis has remained controversial. To gain insight into PlGF function during tumor angiogenesis, we have generated transgenic mouse lines expressing human PlGF-1 in the ß cells of the pancreatic islets of Langerhans (Rip1PlGF-1). In single-transgenic Rip1PlGF-1 mice, intra-insular blood vessels are found highly dilated, whereas islet physiology is unaffected. Upon crossing of these mice with the Rip1Tag2 transgenic mouse model of pancreatic ß cell carcinogenesis, tumors of double-transgenic Rip1Tag2;Rip1PlGF-1 mice display reduced growth due to attenuated tumor angiogenesis. The coexpression of transgenic PlGF-1 and endogenous VEGF-A in the ß tumor cells of double-transgenic animals causes the formation of low-angiogenic hPlGF-1/mVEGF-A heterodimers at the expense of highly angiogenic mVEGF-A homodimers resulting in diminished tumor angiogenesis and reduced tumor infiltration by neutrophils, known to contribute to the angiogenic switch in Rip1Tag2 mice. The results indicate that the ratio between the expression levels of two members of the VEGF family of angiogenic factors, PlGF-1 and VEGF-A, determines the overall angiogenic activity and, thus, the extent of tumor angiogenesis and tumor growth. [Cancer Res 2007;67(22):10840–8]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tumor-induced neoangiogenesis is an essential step during tumor progression. Newly formed intratumoral vessels are required for the delivery of nutrients and for sufficient oxygenation of growing tumors. The requirement for tumor angiogenesis has been shown in several experiments blocking different angiogenic pathways by either angiogenic growth factor depletion or by specific targeting of the activity of growth factor receptors (14). The contribution of the prototype angiogenic growth factor vascular endothelial growth factor-A (VEGF-A) to physiologic and pathologic angiogenesis is well established, and first therapeutic approaches to interfere with its function are already in routine clinical use (58). However, the exact functions of the other VEGF family members, VEGF-B, VEGF-C, VEGF-D, VEGF-E, and placental growth factor (PlGF), in tumor growth and metastasis are still controversial. The VEGF family members have in common a cysteine knot VEGF homology domain and exert their varying functions on blood and/or lymph vessel angiogenesis by differentially binding to their cognate receptors VEGFR-1, VEGFR-2, and VEGFR-3 (9, 10).

Similar to VEGF-A, three PlGF isoforms are generated by alternative splicing, which differ in size, receptor binding properties, and expression profiles. Although PlGF-2 binds to VEGFR-1, heparan sulfate proteoglycans (HSPG) and neuropilin-1 and neuropilin-2, PlGF-1 and PlGF-3 exclusively bind to VEGFR-1 (1113). PlGF is expressed during embryonic vasculogenesis; nevertheless, PlGF is not required for embryonic vessel formation because mice lacking PlGF develop normally (14, 15). In contrast, PlGF seems to contribute to pathologic angiogenesis (1517). For example, in PlGF-deficient mice, tumor growth and tumor angiogenesis are markedly reduced (15). Moreover, experiments employing a diabetic wound closure model show that PlGF is required for the recruitment of monocytes and macrophages to the closing wound, and in an ischemic hind limb model, administration of PlGF increased the number of macrophages around collateral side branches (16, 18). Recently, it has been shown that circulating hematopoietic progenitor cells and macrophages contribute to tumor angiogenesis, and that PlGF might induce tumor angiogenesis by the recruitment of these cells to the growing tumors (15, 1922). In fact, gene expression studies in human breast cancers clearly correlate increased PlGF expression with tumor progression and reduced patient survival (23, 24). Studies in transgenic mice expressing PlGF confirmed the assumption that PlGF promotes tumor growth and metastasis (25). These observations have led to first therapeutic approaches to interfere with PlGF function during tumorigenesis (16, 26). However, simultaneous expression of PlGF and VEGF-A within the same cells can lead to the formation of low-angiogenic PlGF/VEGF-A heterodimers with a concomitant reduction of highly angiogenic VEGF-A homodimers and a subsequent reduction of angiogenic activity (27, 28).

We have aimed to gain further insight into the function of PlGF during tumor angiogenesis and tumor growth. We have generated a new transgenic mouse model, where human PlGF-1 is expressed under the control of the rat insulin promoter (Rip1) in the ß cells of pancreatic islets of Langerhans (Rip1PlGF-1). To investigate the functional contribution of hPlGF-1 to tumorigenesis, we then crossed Rip1PlGF-1 mice with the Rip1Tag2 mouse model of multistage ß cell carcinogenesis (29). In Rip1Tag2 transgenic mice, SV40 large T antigen (Tag), under the control of Rip1, is specifically expressed in pancreatic ß cells, resulting in multistage insulinoma development. Beginning at 5 to 7 weeks of age, in a still premalignant stage of tumorigenesis, an angiogenic switch activates the quiescent vasculature and promotes angiogenesis in hyperproliferative lesions (angiogenic islets). This progression to active angiogenesis is characterized by endothelial cell proliferation, dilated blood vessels, and microhemorrhages (30). Neoplastic lesions then progress to benign adenomas and, finally, to invasive carcinomas; yet they usually do not metastasize (31). Among a number of proangiogenic factors expressed in the angiogenic islets, VEGF-A and fibroblast growth factor (FGF) are critically involved in the angiogenic switch during tumor progression in these mice. Conditional ablation of VEGF-A expression or adenoviral expression of soluble FGF receptors or VEGF receptors have efficiently blocked tumor angiogenesis and with it tumor outgrowth (3234).

Here, we show that transgenic expression of human PlGF-1 in the islets of Langerhans leads to a dramatic dilation of capillaries within the islets of Langerhans without any apparent effects on islet physiology. In double-transgenic Rip1Tag2;Rip1PlGF-1 mice, however, tumor growth is attenuated due to a significant reduction in tumor angiogenesis caused by the formation of low-angiogenic hPlGF-1/mVEGF-A heterodimers.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of Rip1PlGF-1 transgenic mice. The 450-bp coding sequence of the human PlGF-1 gene (hPlGF-1, gene accession number X54936, nucleotides 322–771) was amplified from cDNA derived from human placenta RNA by PCR using the forward primer 5'-GCTCTAGAGACGTCTGAGAAGATGCCGGT-3' and the reverse primer 5'-CCCAAGCTTGGTGGGTTACCTCCGGGG-3'. The cDNA was cloned under the control of the rat insulin gene II promotor (Rip1; ref. 29). The resulting Rip1PlGF-1 plasmid was used for injection into the pronucleus of fertilized C57Bl/6 oocytes according to standard procedures (35).

The genotypes of two founder strains were confirmed by PCR analysis using the primers 5'-TAATGGGACAAACAGCAAAG-3' and 5'-CCACACTTCCTGGAAGGG-3'. For the generation of double-transgenic Rip1Tag2;Rip1PlGF-1 mice, single-transgenic Rip1PlGF-1 mice were crossed with Rip1Tag2 mice (29). All mice were strictly kept in a C57Bl/6 genetic background. Double-transgenic Rip1Tag2;Rip1PlGF-1 and single-transgenic Rip1Tag2 littermate control mice were sacrificed between 12 and 13 weeks of age. Tumor incidence per mouse was determined by counting all macroscopically detectable pancreatic tumors with a minimal diameter of 1 mm. Tumor volumes were calculated by measuring the tumor diameter and assuming a spherical shape of the tumors. All experimental procedures involving mice were done according to the guidelines of the Swiss Federal Veterinary Office (SFVO) and the regulations of the Cantonal Veterinary Office of Basel Stadt.

Histopathologic analysis. Pancreata from transgenic and control mice were isolated and fixed in 4% paraformaldehyde (PFA) overnight, dehydrated, and embedded in paraffin. Freshly isolated tissue was embedded in OCT compound (Tissue Tek) and snap frozen in liquid nitrogen. For the analysis of cell proliferation, mice were i.p. injected with 100 µg bromodeoxyuridine (BrdUrd; Sigma) per gram of body weight 90 min before sacrifice. Histologic analysis was done on H&E-stained paraffin sections. Immunostaining was done on paraffin sections (5 µm) or on cryosections (7 µm) as previously described (34, 36). The following antibodies were used: rabbit anti-human PlGF (Reliatech), rabbit anti-mouse LYVE-1 (Reliatech), rat anti-mouse CD31 (PharMingen), rat anti-mouse F4/80, rat anti-mouse 7/4 (AbD Serotec GmbH), rat anti-mouse CD45 (BD PharMingen), biotinylated mouse anti-BrdUrd (Zymed), rabbit anti-mouse caspase-3 (Calbiochem), guinea pig anti-insulin (DakoCytomation), and rat anti-CD45 (PharMingen). Secondary antibodies were AlexaFluor 488 or 568 (Molecular Probes). Nuclei were counterstained with 4',6-diamidino-2-phenylindole (DAPI).

Microvessel densities were analyzed by counting CD31-positive intratumoral vessels and the numbers of CD45-, F4/80-, 7/4-, or caspase-3–positive cells in the tumors were determined using Image J software (National Institute of Mental Health, Bethesda, MD). Histologic staging and grading of tumors was done in a blindfold manner on H&E-stained sections. All sections were analyzed with either an Axioskop 2 plus light microscope using Axiovision 3.1. Software (Zeiss) or a Nikon Diaphot 300 immunofluorescence microscope (Nikon) using Openlab 3.1.7. Software (Improvision).

Lectin perfusion. For the analysis of functional blood vessels, mice were tail vein-injected with 100 µL of 1 mg/mL fluorescein-labeled Lycopersicon esculentum lectin (Vector Laboratories) under inhalation anesthesy with isoflurane (Minrad Inc.). After 5 min, mice were heart perfused with 10 mL of 4% paraformaldehyde followed by 10 mL PBS. Isolated pancreata were immersed in ascending concentrations of sucrose (12%, 15%, and 18% for 1 h each), embedded in OCT (Tissue-Tek), and snap frozen in liquid nitrogen.

Methylmethacrylate (Mercox) casting. The vasculature of either Rip1Tag2 or double transgenic Rip1Tag2;PlGF-1 mice was perfused with a solution of 0.9% sodium chloride containing 1% heparin (Liquemine, Roche Pharma AG) and 1% procaine, followed by a freshly prepared solution of Mercox (Japan Vilene Hospital Co. Ltd.) containing 0.1 mL accelerator per 5 mL resin. After 2 to 4 weeks of tissue dissolution in 15% KOH, casts were dehydrated in ethanol and dried in a vacuum desiccator. Samples were glued onto stubs with carbon and spattered with gold and examined in a Philips XL 30 FEG scanning microscope.

Collagen gel assay. Islets from single transgenic Rip1PlGF-1 or dysplastic islets from single-transgenic Rip1Tag2 or double-transgenic Rip1Tag2;Rip1PlGF-1 mice at 6 and 9 weeks of age, respectively, were isolated as described previously (30, 36). Human umbilical vein endothelial cells (HUVEC) were cultured in Medium 199 supplemented with 20% fetal bovine serum (FBS), 4 mmol/L glutamine, 40 µg/mL bovine brain extract, 80 units/mL heparin, and 100 units/mL penicillin (all cell culture articles were purchased from Sigma Chemical Co.). After trypsinization, HUVECs were resuspended in 10% FBS RPMI and cocultured with islets/tumors in a three-dimensional collagen matrix (Vitrogen, Nutacon) as described (30). After 2 to 3 days, the response of endothelial cells to islets and tumors was scored. Approximately 30 of each normal and dysplastic islets were analyzed per genotype.

ELISA. For the detection of peripheral hPlGF-1 homodimers and hPlGF-1/mVEGF-A heterodimers, Quantikine Immunoassays (R&D Systems) were employed. For the detection of hPlGF-1 in sera from single and double transgenic mice, blood samples were incubated at room temperature to allow clotting before they were centrifuged at 2000 x g for 20 min. Serum was removed and either used immediately for analysis or stored at –20°C. Assays were carried out according to the manufacturer's instructions. For the detection of hPlGF-1/mVEGF-A heterodimers, components of the mVEGF-A immunoassay and the hPlGF-1 immunoassay were combined by using a microplate precoated with an affinity-purified polyclonal antibody specific for mouse VEGF-A. For the detection of immobilized heterodimers, an enzyme-linked polyclonal antibody specific for hPlGF-1 was added to the wells. The ELISA was developed, and bound heterodimer concentrations were measured according to the protocol. All experiments were done at least twice, and comparable results were obtained.

Flow cytometry. For analysis of intratumoral macrophages, tumors were washed briefly in cold PBS and subsequently treated with collagenase and DNase I at 37°C for 1 h. After washing in cold PBS and passage through a 40-µm pore size cell strainer (BD Biosciences), cells were stained with propidium iodide, together with either FITC-labeled rat anti-F4/80 (Serotec GmbH) or FITC-labeled rat anti–Gr-1 (eBioscience) and subjected to flow cytometry on a FACSCalibur (BD Biosciences).

Real-time PCR. Total RNA was extracted from fluorescence-activated cell sorting (FACS)–purified tumor cells, CD31-positive endothelial cells, CD45-positive tumor-infiltrating hematopoietic cells, F4/80-positive macrophages, CD140-positive mesenchymal cells, Gr-1–positive granulocytes and total tumor derived from a Rip1Tag2 tumor using the TRIzol reagent (Invitrogen). First-strand cDNA was synthesized from 0.5 µg RNA using M-MLV reverse transcriptase RNase H–(Promega). Quantitative PCR for mouse VEGF-A transcripts was done on an ABI Prism 7000 (Applied Biosystems) using the SYBR-green PCR MasterMix (Applied Biosystems) and normalized versus the mouse ribosomal protein 19 (mRPL19) transcripts. The primers for mVEGF-A were CCTGCAAAACACAGAGACTCGC and CGTTTAACTCAAGCTGCCTCG, and the primers for mRPL19 were ATCCGCAAGCCTGTGACTGT and TCGGGCCAGGGTGTTTTT.

Neutrophil chemotaxis assay. Total bone marrow from C57BL/6 mice was harvested by flushing femurs of two mice with cold PBS. Neutrophils were purified from total bone marrow after red cell lysis by Percoll gradient centrifugation on 60%/80% Percoll gradients. A total of 5 x 105 of the purified neutrophils were plated in triplicates in the upper well of a chemotaxis chamber with 3 µm pore size, whereas plain RPMI 1640, or supplemented with either 10 nmol/L formyl-Met-Leu-Phe (fMLP), 10 ng/mL VEGF-A, or 10 ng/mL PlGF/VEGF-A heterodimer was added to the lower chambers of the chemotaxis chambers. All recombinant proteins were purchased from R&D Systems, with the quality controls done by the manufacturer. The cells were allowed to migrate for 60 min at 37° C, and cells attached to the lower side of the filter were fixed in 4% PFA and stained with crystal violet for subsequent counting of nine high-power fields per well.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human PlGF-1 expression in transgenic Rip1PlGF-1 mice. To investigate the effect of hPlGF-1 on pancreatic islet development in mice and ß cell carcinogenesis in the Rip1Tag2 mouse model, we generated transgenic mouse lines expressing hPlGF-1 under the control of the rat insulin promoter specifically in the insulin-producing ß cells of the islets of Langerhans. A cDNA encoding the 131-amino acid hPlGF-1 isoform was cloned between a rat insulin promoter fragment and the human growth hormone intron and polyadenylation signal. Pronuclear injection of the transgene into fertilized oocytes resulted in two transgenic founder lines, which exhibited stable germ line transmission. Both transgenic Rip1PlGF-1 founder lines were viable and fertile. Expression analysis by reverse transcription-PCR (RT-PCR) and immunohistochemical analyses revealed that one founder line exhibited specific expression of hPlGF-1 in the islets of Langerhans at levels lower than the expression of hPlGF in human placenta (Fig. 1A ; data not shown). Moreover, sandwich ELISA revealed high amounts of PlGF-1 in the serum of transgenic mice, whereas control sera were found negative (Fig. 1B). Examination of paraffin sections from pancreata of transgenic mice revealed highly dilated capillaries as indicated by their increased diameters and also by the appearance of large erythrocyte clusters within this lumina (Fig. 1A). Additional analysis of semi-thin sections from Rip1PlGF-1 pancreata confirmed the observation of intra-insular capillary dilation in the transgenic mice (Fig. 1A).


Figure 1
View larger version (67K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Histologic analysis and detection of transgene expression in Rip1PlGF-1 mice. A, top, immunohistochemical staining for PlGF-1 expression (gray) on paraffin sections of 6-week-old Rip1PlGF-1 and wild-type control mice. Middle and bottom, H&E and toluidine blue, respectively, stainings of histologic sections of Rip1PlGF-1 and wild-type control mice demonstrating hyperdilated intra-insular vessels. Bars, 100 µm. B, detection of transgenic human PlGF-1 in sera of control C57Bl/6 mice and single-transgenic Rip1PlGF-1 mice by quantitative sandwich ELISA assay. Three mice per genotype were analyzed. Columns, mean; bars, SEM.

 
Hyperdilated intra-insular vessels in Rip1PlGF-1 mice. To determine whether the dilated vessels observed in the islets of Rip1PlGF-1 mice were lined with endothelial cells, histologic sections were stained for the endothelial cell marker CD31. The majority of the dilated capillaries of Rip1PlGF-1 islets stained positive for CD31 (Fig. 2 ). In contrast, CD31-positive vessels in islets of control mice did not exhibit apparent lumina (Fig. 2). The dilation of Rip1PlGF-1 intra-insular vessels was further manifested by the analysis of Mercox vessel casts from transgenic versus control mice using scanning electron microscopy (Fig. 2). To further examine the functionality of these enlarged vessels, Rip1PlGF-1 and control mice were i.v. injected with FITC-conjugated lectin to visualize vessel perfusion and morphology. Again, the enlarged vessels in Rip1PlGF-1 mice seemed fully perfused, but heavily dilated as compared with littermate controls (Fig. 2). Blood vessels in the exocrine pancreas, outside the islets of Langerhans, were not affected by the ß cell–specific expression of PlGF-1 (data not shown).


Figure 2
View larger version (104K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Hyperdilation of intra-insular capillaries in Rip1PlGF-1 mice. Immunohistolochemical staining for CD31 (gray) of pancreatic sections from wild-type and Rip1PlGF-1 mice, as indicated. Mercox vascular casts from control C57Bl/6 and Rip1PlGF-1 transgenic mice visualizing the hyperdilation of intra-insular capillaries in Rip1PlGF-1 mice. Bars, 100 µm. Visualization of perfused blood vessel by perfusion staining with FITC-coupled tomato lectin (green) in islets of C57Bl/6 control and Rip1PlGF-1 mice, as indicated. Dashed line, islets. Bottom, left, higher magnification insets.

 
We next assessed whether the high levels of transgenic hPlGF-1 expressed in pancreatic islets resulted in increased numbers of intra-insular blood vessels. The numbers of CD31-positive vessels per square millimeter were unchanged (746 ± 88 versus 854 ± 168 for Rip1PlGF-1 and control mice, respectively; mean values ± SE), whereas the percentage of CD31-positive islet surface area was significantly increased in Rip1PlGF-1 mice (12.57 ± 1.1% versus 8.77 ± 1.0% for RipPlGF-1 and control mice, respectively; mean values ± SE, P = 0.024, unpaired Student's t test). Staining of paraffin sections from Rip1PlGF-1 and control mice for the lymphatic endothelial marker LYVE-1 showed that hPlGF-1 did not induce lymphangiogenesis (data not shown).

To investigate whether PlGF-1 exerted a direct proangiogenic function, we cocultured freshly isolated islets of either Rip1PlGF-1 mice or hyperplastic islets of Rip1Tag2 mice in a three-dimensional collagen matrix together with HUVECs. In this assay, angiogenic islets derived from Rip1Tag2 mice induce endothelial cell migration, proliferation, and tube formation, whereas nonangiogenic islets do not stimulate endothelial cells (30, 36). In agreement with previous studies (36), we found that 74% of hyperplastic islets from Rip1Tag2 control mice evoked an angiogenic response of the cocultured endothelial cells, whereas none of the Rip1PlGF-1 islets induced an endothelial cell reaction (data not shown). In contrast, about 50% of cultured islets from 9-week-old Rip1VEGF-A165 transgenic mice were shown to trigger an angiogenic response in this ex vivo assay (36).

Together, these results indicate that transgenic expression of hPlGF-1 in pancreatic islets induces the dilation of intra-insular capillaries, but does not directly induce angiogenesis.

Reduced tumor growth in Rip1Tag2;Rip1PlGF-1 double-transgenic mice. To investigate the biological function of PlGF-1 during tumor progression, we crossed Rip1PlGF-1 mice with Rip1Tag2 transgenic mice and analyzed the effects of hPlGF-1 expression on ß cell tumorigenesis in double-transgenic mice. Rip1Tag2;Rip1PlGF-1 mice displayed a significantly reduced tumor outgrowth at the age of 12 to 13 weeks as compared with their single-transgenic Rip1Tag2 littermates (Fig. 3A ). However, the number of macroscopically detectable tumors per mouse was unaffected (5.78 ± 0.51 for Rip1Tag2 versus 6.26 ± 0.6 for Rip1Tag2;Rip1PlGF-1, ± SE). Metastasis to regional lymph nodes or distant organs, such as lung or liver, was not detected in Rip1Tag2;Rip1PlGF-1 mice. Histologic analysis of tumor progression revealed that the number of normal and hyperplastic islets in Rip1Tag2;PlGF-1 mice was slightly increased, whereas the number of adenomas was significantly decreased. The numbers of carcinomas was unchanged (Fig. 3B).


Figure 3
View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Impaired tumor growth in Rip1Tag2;Rip1PlGF-1 mice. A, tumor volumes in Rip1Tag2;Rip1PlGF-1 and Rip1Tag2 mice at the age of 12 to 13 wk. Single points represent the total tumor volume per Rip1Tag2;Rip1PlGF-1 (n = 15) and Rip1Tag2 (n = 19) mouse. **, P = 0.0012, Mann-Whitney test. B, staging of tumors in normal islets/hyperplastic islets, adenoma, and carcinoma per mouse in Rip1Tag2;Rip1PlGF-1 (n = 7) and Rip1Tag2 (n = 8) mice (±SE; *, P < 0.05; unpaired Student's t test). C, proliferation rate of ß tumor cells in Rip1Tag2;Rip1PlGF-1 and Rip1Tag2 mice. Tumor cell proliferation was determined by BrdUrd incorporation analysis in pancreatic sections of Rip1Tag2;Rip1PlGF-1 (n = 7) and Rip1Tag2 (n = 6) mice. A total of 7 to 10 microscopic fields per mouse were analyzed (magnification, 400x). D, quantification of apoptotic cells by immunofluorescence staining of the cleaved isoform of caspase-3. Areas of tumors from Rip1Tag2;Rip1PlGF-1 (n = 24) and Rip1Tag2 (n = 23) mice with positive staining were quantified *, P < 0.05, unpaired Student's t test.

 
To investigate the molecular basis for the diminished tumor growth in Rip1Tag2;Rip1PlGF-1 mice, potential changes in the rates of tumor cell proliferation and apoptosis were investigated. The numbers of proliferating BrdUrd-positive ß cells were not significantly different from Rip1Tag2 control to Rip1Tag2;Rip1PlGF-1 tumors (Fig. 3C). However, analysis of apoptosis by staining for cleaved caspase-3–positive cells within the tumors revealed a significant increase in apoptotic cells in Rip1Tag2;Rip1PlGF-1 tumors as compared with Rip1Tag2 control tumors (Fig. 3D). These results indicate that attenuated tumor growth and tumor progression in Rip1Tag2;Rip1PlGF-1 mice is not a consequence of decreased tumor cell proliferation, but rather of reduced tumor cell viability.

Attenuated tumor angiogenesis in Rip1Tag2;Rip1PlGF-1 mice. The observed decrease in tumor growth and the increase in tumor cell apoptosis in Rip1Tag2;Rip1PlGF-1 mice may result from alterations in tumor-induced angiogenesis. Staining for the endothelial cell surface marker CD31 on pancreatic sections revealed a significant decrease in the number of intratumoral blood vessels in Rip1Tag2;Rip1PlGF-1 tumors as compared with tumors of Rip1Tag2 mice (Fig. 4A and B ). In particular, intratumoral microvessels were affected by this decrease, whereas larger vessels were not affected (Fig. 4A).


Figure 4
View larger version (90K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Attenuated angiogenesis in tumors of Rip1Tag2;Rip1PlGF-1 mice. A, immunofluorescent analysis of intratumoral vessel density. Representative fresh frozen pancrea sections from Rip1Tag2 and Rip1Tag2;Rip1PlGF-1 mice stained with anti-CD31 antibodies (green). Nuclei were visualized by staining with DAPI (blue). Bottom left, higher magnification insets. Bars, 100 µm. B, quantification of intratumor vessel density by immunofluorescence analysis of tumors from Rip1Tag2 (N = 8, n = 26) and Rip1Tag2;Rip1PlGF-1 mice (N = 9, n = 30) as shown in A. N, number of analyzed mice; n, number of analyzed tumors. Vessel density was evaluated by analyzing CD31-positive staining per square millimeter at 200x magnification using computer-assisted image analysis. ***, P = 0.0002, Mann-Whitney test. C, reduced angiogenic activity in dysplastic islets of Rip1Tag2;Rip1PlGF-1 mice. Dysplastic islets isolated from Rip1Tag2 and Rip1Tag2;Rip1PlGF-1 mice were cocultured with HUVEC in a three-dimensional collagen gel to determine their angiogenic properties. Shown are the percentage of plated dysplastic islets exhibiting a strong angiogenic response (n = 35 for Rip1Tag2 and n = 24 for Rip1Tag2;Rip1PlGF-1).

 
Based on the apparent differences in microvessel densities, we next analyzed the angiogenic activity of dysplastic islets from Rip1Tag2;Rip1PlGF-1 and Rip1Tag2 mice by the three-dimensional collagen coculturing assay described above. Notably, the numbers of angiogenic dysplastic islets that exhibited angiogenic activity in this assay were markedly reduced in Rip1Tag2;Rip1PlGF-1 mice as compared with Rip1Tag2 mice (Fig. 4C).

Together with the reduced vessel density observed in tumors of Rip1Tag2;Rip1PlGF-1 mice, these results indicate that hPlGF-1 represses tumor outgrowth by attenuating tumor angiogenesis.

Formation of hPlGF-1/VEGF-A heterodimers. Previously, it has been reported that recombinant PlGF/VEGF-A heterodimers exert a 20- to 50-fold lower mitogenic activity on endothelial cells than recombinant VEGF-A/VEGF-A homodimers (37, 38). Moreover, the forced expression of PlGF-1 or PlGF-2 in orthotopic transplantation models resulted in the formation of such PLGF/VEGF-A heterodimers and, with it, in diminished tumor angiogenesis (27, 28).

Hence, to investigate the molecular basis of diminished angiogenesis in the tumors of Rip1Tag2;Rip1PlGF-1 mice, we examined the formation of PlGF-1/VEGF-A heterodimers using an ELISA assay designed to specifically recognize human PlGF/murine VEGF-A heterodimers. High levels of hPlGF-1/mVEGF-A heterodimers and hPlGF-1 were detected in tumor lysates from Rip1Tag2;Rip1PlGF-1 mice, whereas control tumor lysates were negative (Fig. 5A ). Conversely, the amount of total mVEGF-A was found reduced in tumors of Rip1Tag2;Rip1PlGF-1 mice as compared with Rip1Tag2 tumors. These results indicate that the high amounts of hPlGF-1/mVEGF-A heterodimers found in Rip1Tag2;Rip1PlGF-1 tumors are generated at the expense of highly angiogenic mVEGF-A homodimers. Such reduction of angiogenic VEGF-A homodimers is thus most likely the cause for the observed attenuated tumor angiogenesis in Rip1Tag2;Rip1PlGF-1 mice.


Figure 5
View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Quantification of tumoral VEGF-A expression and hPlGF-1/mVEGF-A heterodimers formation in tumors of Rip1Tag2;PlGF-1 mice. A, heterodimers consisting of endogenous murine VEGF-A and transgenic hPlGF-1 and the amount of total mVEGF-A and total PlGF-1 were determined by quantitative ELISA assays. Shown are the amounts in picograms per microgram of total protein from tumors of the indicated genotypes (n = 3); bars, SE. B, evaluation of VEGF-A mRNA expression by quantitative PCR in total tumor and sorted tumor cell compartments derived from a Rip1Tag2 mouse. Shown are the VEGF-A mRNA expression profiles relative to the internal control gene ribosomal protein 19 (mRPL19) of the indicated cell populations.

 
To assess the relative contribution of the different tumor compartments to the total tumoral VEGF-A expression, cells contained in primary Rip1Tag2 tumors were purified by FACS, and mVEGF-A mRNA expression was quantified by real-time PCR. Although endothelial cells and total tumor-infiltrating hematopoietic cells showed low expression of VEGF-A, tumor cells expressed high levels of VEGF-A, followed by macrophages and granulocytes (Fig. 5B).

To evaluate a potential effect of PlGF-1/VEGF-A heterodimer on VEGF-A–induced proliferation of endothelial cells, HUVECs were cultured in the presence of constant amounts of VEGF-A homodimers and increasing concentrations of PlGF/VEGF-A heterodimers. PlGF/VEGF-A heterodimer had no measurable effect by itself, whereas VEGF-A homodimers induced HUVEC proliferation. Low concentrations of PlGF/VEGF-A heterodimers added to VEGF-A homodimer led to increased proliferation of HUVEC, whereas increasing concentrations of PlGF/VEGF-A heterodimers decreased these proliferation levels, indicating that PlGF/VEGF-A heterodimers exert a mild dominant-negative effect only at high concentrations (Supplementary Fig. S1).

Reduced infiltration of granulocytes. VEGF-A is known to recruit bone marrow–derived myeloid cells to sites of active angiogenesis, and these cells contribute to ongoing angiogenesis (39, 40). Furthermore, the contribution of macrophages to tumor progression and tumor-associated angiogenesis is well established (reviewed by Condeelis and Pollard; ref. 22). Analysis of tumors from double-transgenic Rip1Tag2;Rip1PlGF-1 mice and single-transgenic Rip1Tag2 mice for hematopoietic cell infiltration by immunofluorescence staining for the pan-hematopoietic cell surface marker CD45 revealed that the extent of tumor infiltration by CD45-positive cells was not significantly altered by the expression of hPlGF-1 in Rip1Tag2;Rip1PlGF-1 mice (Supplementary Fig. S2A). In contrast, the numbers of tumor-infiltrating F4/80-positive macrophages were significantly decreased (Fig. 6A, right ), an observation confirmed by flow-cytometric analysis of cells from dissociated total tumors (Fig. 6A, left).


Figure 6
View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Reduced infiltration of macrophages and neutrophils in tumors of Rip1Tag2;Rip1PlGF-1 mice. A, tumor-infiltrating macrophages. The amount of intratumoral F4/80-positive macrophages was assessed by FACS analysis (left) from tumor single cell suspensions of either Rip1Tag2 mice (N = 9; n = 11) or Rip1Tag2;Rip1PlGF-1 (N = 5, n = 12) mice. Values represent the percentage of F4/80-positive/propidium iodide–negative cells per tumor (P = 0.08, unpaired Student's t test). The FACS results were confirmed by immunofluorescence analysis of F4/80-positive cells on tumor sections from Rip1Tag2 mice (N = 11; n = 51) or Rip1Tag2;Rip1PlGF-1 (N = 9; n = 38; P = 0.0085; unpaired Student's t test). N, number of analyzed mice; n, number of analyzed tumors. B, tumor-infiltrating granulocytes. Gr-1–positive intratumoral granulocytes were quantified by FACS analysis (left) from tumor single cell suspensions of either Rip1Tag2 mice (N = 12; n = 14) or Rip1Tag2;Rip1PlGF-1 (N = 5, n = 11) mice. Values represent the percentage of Gr-1–positive/propidium iodide–negative cells per tumor (P = 0.0002, unpaired Student's t test). Immunofluorescence staining for 7/4-positive neutrophils (right) on tumor sections from Rip1Tag2 mice (N = 9; n = 28) or Rip1Tag2;Rip1PlGF-1 mice (N = 7; n = 24; P = 0.046, unpaired Student's t test). C, neutrophil migration assay. Bone marrow–derived neutrophils were cultured in the upper chamber of a Transwell in plain RPMI 1640. The lower chamber was filled with plain RPMI 1640 or supplemented with either 10 nmol/L fMLP, 10 ng/mL VEGF-A, or 10 ng/mL PlGF-1/VEGF-A heterodimers as indicated. ***, P = 0.0003; **, P = 0.0018, unpaired Student's t test.

 
Recently, it has been reported that matrix metalloproteinase 9 (MMP9)–expressing Gr-1–positive neutrophils contribute to the angiogenic switch during early tumor progression in Rip1Tag2 mice (41). Flow-cytometric examination of dissociated cells from tumors of Rip1Tag2;Rip1PlGF-1 mice revealed that the numbers of infiltrating Gr-1–positive cells were reduced 4-fold in tumors of Rip1Tag2;Rip1PlGF-1 mice as compared with tumors of Rip1Tag2 mice (Fig. 6B, left; Supplementary Fig. S2B). This observation was confirmed by immunofluorescence stainings on tumor section with the neutrophil-specific antibody 7/4 (Fig. 6B, right). The reduction of neutrophils in Rip1Tag2;Rip1PlGF-1 tumors is likely attributable to the diminished formation of VEGF-A homodimers, which have been shown to be a chemoattractant and migration/proliferation factor for myeloid cells (39, 42, 43).

To assess whether PlGF/VEGF-A heterodimers induces migration of neutrophils, bone marrow–derived neutrophils were stimulated with PlGF/VEGF-A heterodimer and VEGF-A homodimer in an in vitro migration assay. Indeed, PlGF/VEGF-A heterodimers were less efficient in inducing neutrophil migration than VEGF-A homodimers (Fig. 6C). This lower capacity of PlGF/VEGF-A heterodimers to induce neutrophil migration, together with reduced amounts of total VEGF-A most likely accounts for the reduced numbers of intratumoral neutrophils found in double-transgenic Rip1Tag2;Rip1PlGF-1 mice. Based on the reported functional role of neutrophils to the angiogenic switch in Rip1Tag2 tumorigenesis, the reduction in neutrophil numbers may also contribute to the reduction in tumor angiogenesis observed in Rip1Tag2;Rip1PlGF-1 mice. The reduced number of macrophages in the tumors of Rip1Tag2;Rip1PlGF-1 mice may also account for attenuated tumor growth.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have investigated the effects of transgenic expression of human PlGF-1 in pancreatic ß cells during islet development in Rip1PlGF-1 mice and during ß cell carcinogenesis in double-transgenic Rip1Tag2;Rip1PlGF-1 mice. Examination of single-transgenic Rip1PlGF-1 mice reveals that intra-insular blood vessels are markedly dilated, whereas their overall numbers are unchanged. With the enlarged vessel diameters, an increased number of CD31-positive endothelial cells is observed. These results indicate that the transgenic expression of PlGF-1 in ß cells of islets of Langerhans does not lead to sprouting angiogenesis but rather to vessel dilation. These findings are underlined by the fact that islets from Rip1PlGF-1 mice are not able to induce an angiogenic response by endothelial cells in a three-dimensional collagen coculture assay. In contrast, transgenic expression of the 165-amino acid isoform of human VEGF-A in pancreatic ß cells induces an angiogenic response in this assay (36). This observation is in agreement with several reports demonstrating the inability of PlGF to exert a direct angiogenic activity on endothelial cells in vitro (44, 45). Notably, although high levels of hPlGF-1 are detectable in the sera from Rip1PlGF-1 transgenic mice, no phenotypic alterations or physiologic or metabolic defects are apparent in other organs analyzed.

The functional roles of PlGF in pathologic processes have in most parts remained controversial. Employing PlGF knock-out mouse models, several reports have shown that the lack of PlGF results into an impairment of inflammatory responses as well as wound healing and tumor growth (15, 16, 46). In contrast, work from other laboratories has shown that PlGF induces inflammatory responses, accelerates wound healing, and also supports tumor growth due to an induction of angiogenesis in the tumor periphery (17, 25, 47).

Transgenic expression of human PlGF-1 during ß cell carcinogenesis in double-transgenic Rip1Tag2;Rip1PlGF-1 mice impairs tumor growth as compared with single-transgenic Rip1Tag2 littermates. This reduced tumor growth is most likely due to a decrease in tumor angiogenesis because microvessel densities are significantly reduced in tumors from Rip1Tag2;Rip1PlGF-1 as compared with Rip1Tag2 littermate controls. This result contrasts previous work in which cancer cells have been s.c. implanted into transgenic mice expressing PlGF in skin keratinocytes. In this context, PlGF supports tumor growth by promoting tumor angiogenesis (25). However, in clear difference to this model, in the Rip1Tag2;Rip1PlGF-1 double-transgenic mice reported here, PlGF-1 and VEGF-A are coexpressed within ß tumor cells leading to the formation of PlGF-1/VEGF-A heterodimers. With the formation of these heterodimers, VEGF-A is sequestered, and its angiogenic activity is impaired. Moreover, at high concentrations, these heterodimers exert a dominant-negative effect on VEGF-A–stimulated endothelial cell proliferation. These results are consistent with two recent reports demonstrating that the forced expression of PlGF-1 or PlGF-2 in orthotopic tumor models attenuates tumor growth by decreasing intratumoral vessel density (27, 28). Using different murine tumor models, these investigators have shown that the simultaneous expression of VEGF-A, together with PlGF in the same cell, leads to the formation of low angiogenic VEGF-A/PlGF heterodimers at the expense of highly angiogenic VEGF-A homodimers. Consistent with the impairment of tumor angiogenesis and the lack of sufficient tumor oxygenation and nutrition, the number of apoptotic cells in the tumors of Rip1Tag2;Rip1PlGF-1 mice is significantly increased by the expression of PlGF-1, whereas tumor cell proliferation is unaltered. Finally, Rip1Tag2;Rip1PlGF-1 mice also display a delay in tumor progression with higher numbers of nonmalignant hyperplasia and adenoma and reduced numbers of invasive carcinoma.

Previously, PlGF has been reported to attract bone marrow–derived endothelial precursor cells to sites of ongoing angiogenesis where they incorporate into newly formed blood vessels (19). Examination of tumor-infiltrating hematopoietic cells in Rip1Tag2;Rip1PlGF-1 tumors revealed no major difference in the overall amount of CD45-positive bone marrow–derived cells as compared with Rip1Tag2 control tumors. Nevertheless, F4/80-positive macrophages are decreased in numbers in tumors of Rip1Tag2;Rip1PlGF-1 mice as compared with tumors from Rip1Tag2 mice. Furthermore, a significant reduction of infiltrating Gr-1– or 7/4-positive neutrophils is observed in tumors of Rip1Tag2;Rip1PlGF-1 double-transgenic mice as compared with Rip1Tag2 single-transgenic controls. Neutrophils have been shown to exert a critical function in the onset of tumor angiogenesis in the Rip1Tag2 mouse model by providing MMP9, which in turn, releases extracellular matrix-bound VEGF-A and, thus, promotes tumor angiogenesis (33, 41). Depletion of these cells by the administration of Gr-1–inactivating antibodies leads to a delay in the angiogenic switch in early dysplasias of Rip1Tag2 mice (41). Hence, the reduction of neutrophils in tumors of Rip1Tag2;Rip1PlGF-1 mice might therefore also contribute to the attenuation of tumor angiogenesis observed in these mice. Again, diminished levels of VEGF-A homodimers caused by the formation of PlGF-1/VEGF-A heterodimers seem to cause the reduction in tumor-infiltrating neutrophils because PlGF-1/VEGF-A heterodimers exhibit a significantly lower chemotactic activity on neutrophils as compared with VEGF homodimers (Fig. 6C).

The analysis of Rip1PlGF-1 mice further underlines the observation that under physiologic conditions, PlGF-1 does not induce de novo angiogenesis. However, under pathologic conditions, together with previous observations, our report highlights the notion that the source of PlGF expression is critical for the angiogenic function of PlGF during tumorigenesis. In experimental models, where PlGF is not coexpressed with VEGF-A in the same cell, PlGF leads to accelerated tumor growth and vasculogenesis in the tumor periphery (25). Alternatively, when PlGF is coexpressed with VEGF-A in the same cell, this coexpression results in the formation of low-angiogenic PlGF/VEGF-A heterodimers at the expense of highly angiogenic VEGF-A homodimers. Whether the various alternatively spliced isoforms of PlGF exert different functions in combination with VEGF-A or other VEGF family members, as well as the regulation of PlGF's gene expression in the tumoral and stromal compartments of tumors and its contribution to carcinogenesis in patients, remains to be explored.


    Acknowledgments
 
Grant support: Novartis Pharma Inc. (T. Schomber and G. Christofori), the National Centre of Competence in Research, Molecular Oncology of the Swiss National Science Foundation (G. Christofori), the EU-FP6 Framework Programme Lymphangiogenomics LSHG-CT-2004-503573 (G. Christofori), the Swiss National Science Foundation (3100A0-104000/1), and Bernese Cancer League (V. Djonov).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We are grateful to H. Antoniadis, U. Schmieder, K. Sala, and R. Jost for technical support.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 3/19/07. Revised 8/29/07. Accepted 9/17/07.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ferrara N, Kerbel RS. Angiogenesis as a therapeutic target. Nature 2005;438:967–74.[CrossRef][Medline]
  2. Ferrara N. VEGF as a therapeutic target in cancer. Oncology 2005;69 Suppl 3:11–6.[CrossRef][Medline]
  3. Hicklin DJ, Ellis LM. Role of the vascular endothelial growth factor pathway in tumor growth and angiogenesis. J Clin Oncol 2005;23:1011–27.[Abstract/Free Full Text]
  4. Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. Nat Med 2003;9:669–76.[CrossRef][Medline]
  5. Shojaei F, Ferrara N. Antiangiogenesis to treat cancer and intraocular neovascular disorders. Lab Invest 2007;87:227–30.
  6. Schneider BP, Sledge GWJ. Drug insight: VEGF as a therapeutic target for breast cancer. Nat Clin Pract Oncol 2007;4:181–9.[CrossRef][Medline]
  7. Kowanetz M, Ferrara N. Vascular endothelial growth factor signaling pathways: therapeutic perspective. Clin Cancer Res 2006;12:5018–22.[Abstract/Free Full Text]
  8. Gasparini G, Longo R, Toi M, Ferrara N. Angiogenic inhibitors: a new therapeutic strategy in oncology. Nat Clin Pract Oncol 2005;2:562–77.[CrossRef][Medline]
  9. Shibuya M, Claesson-Welsh L. Signal transduction by VEGF receptors in regulation of angiogenesis and lymphangiogenesis. Exp Cell Res 2006;312:549–60.[CrossRef][Medline]
  10. Olsson AK, Dimberg A, Kreuger J, Claesson-Welsh L. VEGF receptor signalling—in control of vascular function. Nat Rev Mol Cell Biol 2006;7:359–71.[CrossRef][Medline]
  11. Hauser S, Weich HA. A heparin-binding form of placenta growth factor (PlGF-2) is expressed in human umbilical vein endothelial cells and in placenta. Growth Factors 1993;9:259–68.[Medline]
  12. Cao Y, Ji WR, Qi P, Rosin A, Cao Y. Placenta growth factor: identification and characterization of a novel isoform generated by RNA alternative splicing. Biochem Biophys Res Commun 1997;235:493–8.[CrossRef][Medline]
  13. Maglione D, Guerriero V, Viglietto G, et al. Two alternative mRNAs coding for the angiogenic factor, placenta growth factor (PlGF), are transcribed from a single gene of chromosome 14. Oncogene 1993;8:925–31.[Medline]
  14. Achen MG, Gad JM, Stacker SA, Wilks AF. Placenta growth factor and vascular endothelial growth factor are co-expressed during early embryonic development. Growth Factors 1997;15:69–80.[Medline]
  15. Carmeliet P, Moons L, Luttun A, et al. Synergism between vascular endothelial growth factor and placental growth factor contributes to angiogenesis and plasma extravasation in pathological conditions. Nat Med 2001;7:575–83.[CrossRef][Medline]
  16. Luttun A, Tjwa M, Moons L, et al. Revascularization of ischemic tissues by PlGF treatment, and inhibition of tumor angiogenesis, arthritis and atherosclerosis by anti-Flt1. Nat Med 2002;8:831–40.[CrossRef][Medline]
  17. Oura H, Bertoncini J, Velasco P, Brown LF, Carmeliet P, Detmar M. A critical role of placental growth factor in the induction of inflammation and edema formation. Blood 2003;101:560–7.[Abstract/Free Full Text]
  18. Cianfarani F, Zambruno G, Brogelli L, et al. Placenta growth factor in diabetic wound healing: altered expression and therapeutic potential. Am J Pathol 2006;169:1167–82.[Abstract/Free Full Text]
  19. Rafii S, Lyden D, Benezra R, Hattori K, Heissig B. Vascular and haematopoietic stem cells: novel targets for anti-angiogenesis therapy? Nat Rev Cancer 2002;2:826–35.[CrossRef][Medline]
  20. Bertolini F, Shaked Y, Mancuso P, Kerbel RS. The multifaceted circulating endothelial cell in cancer: towards marker and target identification. Nat Rev Cancer 2006;6:835–45.[CrossRef][Medline]
  21. Lin EY, Li JF, Gnatovskiy L, et al. Macrophages regulate the angiogenic switch in a mouse model of breast cancer. Cancer Res 2006;66:11238–46.[Abstract/Free Full Text]
  22. Condeelis J, Pollard JW. Macrophages: obligate partners for tumor cell migration, invasion, and metastasis. Cell 2006;124:263–6.[CrossRef][Medline]
  23. Parr C, Watkins G, Boulton M, Cai J, Jiang WG. Placenta growth factor is over-expressed and has prognostic value in human breast cancer. Eur J Cancer 2005;41:2819–27.[CrossRef][Medline]
  24. Zhang L, Chen J, Ke Y, Mansel RE, Jiang WG. Expression of placenta growth factor (PlGF) in non–small cell lung cancer (NSCLC) and the clinical and prognostic significance. World J Surg Oncol 2005;3:68.[CrossRef][Medline]
  25. Marcellini M, De Luca N, Riccioni T, et al. Increased melanoma growth and metastasis spreading in mice overexpressing placenta growth factor. Am J Pathol 2006;169:643–54.[Abstract/Free Full Text]
  26. Luttun A, Tjwa M, Carmeliet P. Placental growth factor (PlGF) and its receptor Flt-1 (VEGFR-1): novel therapeutic targets for angiogenic disorders. Ann N Y Acad Sci 2002;979:80–93.[Medline]
  27. Eriksson A, Cao R, Pawliuk R, et al. Placenta growth factor-1 antagonizes VEGF-induced angiogenesis and tumor growth by the formation of functionally inactive PlGF-1/VEGF heterodimers. Cancer Cell 2002;1:99–108.[CrossRef][Medline]
  28. Xu L, Cochran DM, Tong RT, et al. Placenta growth factor overexpression inhibits tumor growth, angiogenesis, and metastasis by depleting vascular endothelial growth factor homodimers in orthotopic mouse models. Cancer Res 2006;66:3971–7.[Abstract/Free Full Text]
  29. Hanahan D. Heritable formation of pancreatic ß-cell tumours in transgenic mice expressing recombinant insulin/simian virus 40 oncogenes. Nature 1985;315:115–22.[CrossRef][Medline]
  30. Folkman J, Watson K, Ingber D, Hanahan D. Induction of angiogenesis during the transition from hyperplasia to neoplasia. Nature 1989;339:58–61.[CrossRef][Medline]
  31. Perl AK, Wilgenbus P, Dahl U, Semb H, Christofori G. A causal role for E-cadherin in the transition from adenoma to carcinoma. Nature 1998;392:190–3.[CrossRef][Medline]
  32. Inoue M, Hager JH, Ferrara N, Gerber HP, Hanahan D. VEGF-A has a critical, nonredundant role in angiogenic switching and pancreatic ß cell carcinogenesis. Cancer Cell 2002;1:193–202.[CrossRef][Medline]
  33. Bergers G, Brekken R, McMahon G, et al. Matrix metalloproteinase-9 triggers the angiogenic switch during carcinogenesis. Nat Cell Biol 2000;2:737–44.[CrossRef][Medline]
  34. Compagni A, Wilgenbus P, Impagnatiello MA, Cotten M, Christofori G. Fibroblast growth factors are required for efficient tumor angiogenesis. Cancer Res 2000;60:7163–9.[Abstract/Free Full Text]
  35. Labosky PA, Barlow DP, Hogan BL. Embryonic germ cell lines and their derivation from mouse primordial germ cells. Ciba Found Symp 1994;182:157–68; discussion 168–78.[Medline]
  36. Gannon G, Mandriota SJ, Cui L, Baetens D, Pepper MS, Christofori G. Overexpression of vascular endothelial growth factor-A165 enhances tumor angiogenesis but not metastasis during ß-cell carcinogenesis. Cancer Res 2002;62:603–8.[Abstract/Free Full Text]
  37. Cao Y, Chen H, Zhou L, et al. Heterodimers of placenta growth factor/vascular endothelial growth factor. Endothelial activity, tumor cell expression, and high affinity binding to Flk-1/KDR. J Biol Chem 1996;271:3154–62.[Abstract/Free Full Text]
  38. DiSalvo J, Bayne ML, Conn G, et al. Purification and characterization of a naturally occurring vascular endothelial growth factor.placenta growth factor heterodimer. J Biol Chem 1995;270:7717–23.[Abstract/Free Full Text]
  39. Grunewald M, Avraham I, Dor Y, et al. VEGF-induced adult neovascularization: recruitment, retention, and role of accessory cells. Cell 2006;124:175–89.[CrossRef][Medline]
  40. Zentilin L, Tafuro S, Zacchigna S, et al. Bone marrow mononuclear cells are recruited to the sites of VEGF-induced neovascularization but are not incorporated into the newly formed vessels. Blood 2006;107:3546–54.[Abstract/Free Full Text]
  41. Nozawa H, Chiu C, Hanahan D. Infiltrating neutrophils mediate the initial angiogenic switch in a mouse model of multistage carcinogenesis. Proc Natl Acad Sci U S A 2006;103:12493–8.[Abstract/Free Full Text]
  42. Hiratsuka S, Minowa O, Kuno J, Noda T, Shibuya M. Flt-1 lacking the tyrosine kinase domain is sufficient for normal development and angiogenesis in mice. Proc Natl Acad Sci U S A 1998;95:9349–54.[Abstract/Free Full Text]
  43. Murakami M, Iwai S, Hiratsuka S, et al. Signaling of vascular endothelial growth factor receptor-1 tyrosine kinase promotes rheumatoid arthritis through activation of monocytes/macrophages. Blood 2006;108:1849–56.[Abstract/Free Full Text]
  44. Esser S, Lampugnani MG, Corada M, Dejana E, Risau W. Vascular endothelial growth factor induces VE-cadherin tyrosine phosphorylation in endothelial cells. J Cell Sci 1998;111:1853–65.[Abstract]
  45. Oh SJ, Jeltsch MM, Birkenhager R, et al. VEGF and VEGF-C: specific induction of angiogenesis and lymphangiogenesis in the differentiated avian chorioallantoic membrane. Dev Biol 1997;188:96–109.[CrossRef][Medline]
  46. Luttun A, Brusselmans K, Fukao H, et al. Loss of placental growth factor protects mice against vascular permeability in pathological conditions. Biochem Biophys Res Commun 2002;295:428–34.[CrossRef][Medline]
  47. Odorisio T, Schietroma C, Zaccaria ML, et al. Mice overexpressing placenta growth factor exhibit increased vascularization and vessel permeability. J Cell Sci 2002;115:2559–67.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
E.-M. Hedlund, K. Hosaka, Z. Zhong, R. Cao, and Y. Cao
Malignant cell-derived PlGF promotes normalization and remodeling of the tumor vasculature
PNAS, October 13, 2009; 106(41): 17505 - 17510.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
Y. Cao
Positive and Negative Modulation of Angiogenesis by VEGFR1 Ligands
Sci. Signal., February 24, 2009; 2(59): re1 - re1.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schomber, T.
Right arrow Articles by Christofori, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schomber, T.
Right arrow Articles by Christofori, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online