| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Endocrinology |
Departments of 1 Immunology and 2 Medicine, Section of Immunology Allergy and Rheumatology, 3 Department of Molecular and Cellular Biology, 4 Program in Cell and Molecular Biology, and 5 Department of Molecular Physiology, Baylor College of Medicine; and 6 Department of Molecular Pathology, M. D. Anderson Cancer Center, Houston, Texas
Requests for reprints: Li-yuan Yu-Lee, Department of Medicine, One Baylor Plaza, Houston, TX 77030. Phone: 713-798-4770; Fax: 713-798-5780; E-mail: yulee{at}bcm.tmc.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In contrast to 23k PRL, which has angiogenic effects in pathogenic conditions such as rheumatoid arthritis (7) or breast cancer (8), 16k PRL has potent antiangiogenic effects. 16k PRL was shown to inhibit the basal, basic fibroblast growth factor (bFGF)–, and vascular endothelial growth factor (VEGF)–stimulated proliferation of endothelial cells (9, 10). 16k PRL inhibited the growth of new capillaries in a chick embryo chorioallantoic membrane assay (9, 11) and blocked rat retinal neovascularization (12). Furthermore, 16k PRL was shown to have antitumor activities in vivo. Bentzien et al. (11) showed that 16k PRL inhibited the tumorigenicity of HCT116 cells in a Rag1(–/–) mouse model. Kim et al. (13) showed that 16k PRL reduced the tumorigenicity of DU145 and PC-3 human prostate cancer cells in a xenograft nude mouse model. As angiogenesis is required for tumor progression in vivo, 16k PRL likely inhibits tumor growth through its antiangiogenic activity.
Several studies have explored the mechanisms by which 16k PRL exerts its antiangiogenic effects on endothelial cells. 16k PRL stimulates plasminogen activator inhibitor-1 (PAI-1), a potent antiangiogenic factor in bovine brain endothelial cells (BBEC; ref. 10). 16k PRL induces caspase-dependent apoptosis with the activation of nuclear factor
B in BBECs (14). Our studies suggest that 16k PRL may inhibit tumor angiogenesis by attenuating the production of nitric oxide (NO), an endothelial cell survival factor, in rat aortic endothelial cells (RAEC; ref. 15). In RAEC, 16k PRL reduces interleukin (IL)-1ß–inducible iNOS gene transcription through inhibition of the p38 mitogen-activated protein kinase (MAPK)–Stat1-IRF-1 pathway (15).
Endothelial cell proliferation and migration are critical properties that drive vessel formation, homeostasis, and angiogenesis (16). Members of the Rho family GTPases, Cdc42, Rac1, and RhoA, are essential factors for cell polarity, motility, adhesion, and actin-mediated changes in cell shape (17). Among the Rho GTPases, Rac1 is critical for cell motility and actin-remodeling (17, 18). Transfection with small interfering RNA (siRNA) oligonucleotides against Rac1 inhibited cell migration in response to a wound scratch in glioblastoma cells (19), whereas overexpression of constitutively active Rac1 (V12) facilitated fibroblast migration and promoted leading edge actin-rich ruffling (20). Other studies have implicated the Ras-Raf pathway in 16k PRL inhibition of VEGF-induced proliferation in endothelial cells (21), but little is known about whether this pathway is involved in 16k PRL regulation of endothelial cell migration. In this report, we show that 16k PRL inhibits endothelial cell migration in both a wound healing and a Matrigel tube formation assay. Furthermore, by using a series of biochemical assays and immunofluorescence image analyses, we show that 16k PRL inhibits the Ras-Tiam1-Rac1-Pak1 signaling pathway in attenuating endothelial cell migration.
| Materials and Methods |
|---|
|
|
|---|
Cell culture. RAECs (23) were maintained in DMEM with 10% fetal bovine serum (FBS; Invitrogen) and 50 µg/mL of gentamicin (Sigma-Aldrich; ref. 15). Human umbilical vein endothelial cells were maintained in M-199 medium containing 10% FBS, 10% bovine calf serum (Invitrogen), 50 µg/mL of gentamicin, and 20 µg/mL of endothelial cell growth supplement (BD Biosciences).
Endothelial cell migration assay. RAEC (2.5 x 105 cells) were grown to confluence in a 12-well plate, placed in medium containing 1% serum for 24 h, and scratched using either a 200 µL or 1 mL pipette tip. Serum was increased to 5% to facilitate cell migration. RAEC migration was recorded using a Nikon TE2000E microscope system (Nikon Instrument). The area of wound sealing was calculated using NIH ImageJ software.
Matrigel tube formation assay. Matrigel (BD Biosciences; 100 µL) was added to a 96-well plate and incubated for 12 h at 37°C for solidification. RAEC (2.5 x 104 cells) were added to the Matrigel in DMEM containing 5% FBS. Tube formation was recorded using the Nikon microscope system.
Rac1 siRNA transfection. RAEC (2.5 x 105 cells) were mixed with 200 nmol/L of siRNA for Luciferase or rat Rac1 (siGENOME SMARTpool M-080171-01-0010, NM_134366; Dharmacon) in 100 µL of Amaxa nucleofector solution V (Amaxa), and transfected in an Amaxa nucleofector (model AAD-1001). Rac1 protein depletion was determined by Western blot analysis.
Preparation of pull-down substrates. The Rac1-binding substrates were generated as described (24). The Rac1-binding domain in Pak1 (PBD; amino acids 67–150) was amplified by PCR using sense primer (BamHI site underlined): 5' CGC GGATCC AAGAAAGAGAAAGAGCGGCCAGAG 3' and antisense primer (EcoRI site underlined): 5' CCG GAATTC CTA ATGACTTATCTGTAAAGC 3', subcloned into p-GEX2T (Amersham) to generate the GST-Pak1-PBD vector, and confirmed by sequencing. GST-Rac1G15A vector was a gift from Dr. Krister Wennerberg (Cytoskeleton, Denver, CO) and GST-Tiam1 Ras-binding domain (RBD; amino acids 721–840) vector was a gift from Dr. Junji Yamauchi (National Research Institute for Child Health and Development, Setagawa, Japan; refs. 25, 26).
GST pull-down assay. RAEC were subjected to multiple wound scratches using a 200 µL pipette tip and treated simultaneously with 2.5 ng/mL of IL-1ß (WS/IL-1ß) for a more robust activation of Rac1 (27). Cells were harvested in 1.5 mL of lysis buffer [25 mmol/L HEPES (pH 7.5), 150 mmol/L NaCl, 1% NP40, 10 mmol/L MgCl2, 1 mmol/L EDTA and 10% glycerol, 10 µg/mL leupeptin, 10 µg/mL aprotinin, 1 mmol/L sodium fluoride, and 1 mmol/L sodium orthovanadate]. Cell lysates (500 µg) were incubated with 15 µg of GST-Pak1 PBD beads for 1 h at 4°C with rocking. Bound proteins were resolved on a NuPage 4% to 12% Bis-Tris gradient gel (Invitrogen) and transferred to nitrocellulose membranes (Bio-Rad). Active GTP-bound Rac1 was determined by Western blot analysis. Similarly, active Tiam1 was determined using GST-Rac1G15A beads and active Ras was determined with GST-Tiam1 RBD beads in GST pull-down assays (25, 26).
Western blot analysis. RAEC subjected to WS/IL-1ß were harvested in 1.5 mL of lysis buffer [20 mmol/L Tris (pH 7.4), 100 mmol/L NaCl, 5 mmol/L EDTA, and 0.5% Triton X-100] supplemented with 1 mmol/L of phenylmethylsulfonyl fluoride and a protease-inhibitor cocktail (Sigma). Cell lysates (10–20 µg) were blotted with antibodies for Rac1 (1:1,000), ß-tubulin (1:3,000), phospho-Pak1 (Thr423; 1:500), Pak1 (1:1,000), Tiam1 (1:800), Ras (1:1,000), phospho-Akt (Ser473; 1:1,000), or Akt (1:1,000). For secondary antibodies, goat anti-mouse or rabbit horseradish peroxidase antibody (1:2,000; Santa Cruz Biotechnology) was used. Immunoblots were developed by enhanced chemiluminescence (Pierce), and quantified using a Storm960 PhosphorImager (Molecular Dynamics).
Immunoprecipitation. RAEC were prepared as described for Western blotting, except that the buffer also contained 1 mmol/L of serine/threonine phosphatase inhibitor and 1 mmol/L of tyrosine inhibitor (Sigma). Cell lysates (750 µg) were incubated with 2 µg of anti-Pak1 antibody overnight at 4°C. Protein G agarose beads (20 µg) were added for 3 h at 4°C. Immunoprecipitated proteins were analyzed by Western blotting using anti–phospho-Pak1(Thr423) antibody followed by reblotting using anti-Pak1 antibody.
Immunofluorescence imaging. RAEC cells were cultured on glass coverslips coated with poly-D-lysine (1 mg/mL, 70,000–15,000 Da; Sigma) and subjected to WS/IL-1ß. Cells were fixed in PEM buffer [80 mmol/L PIPES (pH 7.0), 1 mmol/L EGTA, 1 mmol/L MgCl2], and permeabilized with ice-cold ethanol for 5 min at –20°C. The coverslips were blocked in 2% bovine serum albumin and 2% goat serum in TBS-T [20 mmol/L Tris (pH 7.4), 150 mmol/L NaCl, 0.05% Tween 20] for 1 h at room temperature, and incubated with anti–phospho-Pak1(Thr423) antibody (1:200) overnight at 4°C, followed by goat anti-rabbit IgG–conjugated Alexa-Fluor 488 (1:500; Molecular Probes) for 2 h at room temperature. The coverslips were then incubated with 10 nmol/L of rhodamine-conjugated phalloidin for 30 min and counterstained using SlowFade Light Antifade Kit with 4',6-diamidino-2-phenylindole (Molecular Probes). Images were obtained with the Nikon microscope system and compiled using Adobe Photoshop 9.0 (Adobe Systems).
Statistical analysis. All results were confirmed in multiple independent experiments, with each time point or condition assayed in duplicates or triplicates within each experiment. Densitometry data were analyzed by using Student's t test and expressed as mean ± SE. P < 0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
20% sealing 8 h after wound scratch (Fig. 1A, b and f), suggesting that 16k PRL attenuated wound-induced cell migration. 16k PRL also attenuated the migration of primary human umbilical vein endothelial cells in the wound-healing assay (see Supplementary Fig. S1).
|
4 h compared with 6 h for control cells (Fig. 1A, f). The addition of 16k PRL to IL-1ß significantly blocked RAEC migration (Fig. 1A, d and f). These observations indicate that IL-1ß enhances RAEC migration in response to wound scratch, and that 16k PRL inhibits IL-1ß–inducible RAEC migration. Rac1 mediates endothelial cell migration in response to wound scratch. Cell migration is largely regulated by Rac1 activity (17). To analyze whether Rac1 may be involved in the migration of RAEC in the wound healing assay, RAEC were treated with the Rac1-specific inhibitor NSC23766, which blocks Rac1 binding to its guanine nucleotide exchange factor Tiam1 in fibroblasts (28). Treatment of RAEC with 50 µmol/L of NSC23766 inhibited wound scratch–induced cell migration (Fig. 1A, e and f), suggesting that Rac1 is involved in RAEC migration. To further strengthen this observation, we knocked down Rac1 levels by incubating cells for 48 h with Rac1 siRNA oligonucleotides (Fig. 1B, g), and analyzed wound-sealing over an 8-h time course after wound scratch. Control RAEC treated with Luciferase siRNA completed 70% sealing 8 h after wound scratch (Fig. 1B, a and f). In contrast, RAEC treated with Rac1 siRNA were significantly blocked in their ability to seal the wound area (Fig. 1B, b and f). The degree of inhibition of wound sealing mediated by Rac1 siRNA was comparable to that observed with the Rac1 inhibitor (Fig. 1B, compare b with e, and see f) in RAEC. These studies show that Rac1 levels as well as Rac1 activity are involved in RAEC migration in a wound-healing assay.
Rac1 mediates IL-1ß–inducible endothelial cell migration in response to wound scratch. We next determined if the IL-1ß–inducible RAEC migration might be mediated through Rac1. In control RAEC treated with Luciferase siRNA, IL-1ß stimulation showed nearly 80% wound sealing 8 h after wound scratch (Fig. 1B, c and f). The IL-1ß–inducible wound sealing activity was reduced, after Rac1 knockdown, to a similar level as that observed with the Rac1 inhibitor (Fig. 1B, compare d with e, and see f) in RAEC. These studies indicate that IL-1ß–inducible wound sealing activity is mediated through Rac1, as Rac1 knockdown prevented IL-1ß–mediated RAEC migration.
16k PRL inhibits tubular network formation in Matrigel. We further investigated the effects of 16k PRL on endothelial cell migration by using the Matrigel matrix tube formation assay, another well-established system for examining angiogenesis under in vitro conditions (29). Control RAEC cultured in Matrigel for 8 h fused into extensive tubular networks (Fig. 1C, a). In contrast, 16k PRL–treated RAEC were unable to form tubular networks (Fig. 1C, b). These observations show that 16k PRL inhibits RAEC migration in the Matrigel endothelial cell tube formation assay. The addition of IL-1ß stimulated a more robust Matrigel tube formation response than that observed in control cells (Fig. 1C, c), further supporting the observation that IL-1ß induces endothelial cell migration. The addition of 16k PRL to IL-1ß blocked RAEC Matrigel tube formation (Fig. 1C, d). Treatment of RAEC with 50 µmol/L of NSC23766 inhibited Matrigel tube formation (Fig. 1C, e), suggesting that Rac1 is also involved in the RAEC tubular network formation in Matrigel.
16k PRL down-regulates Rac1 activation in response to wound scratch. The cell migration assays (Fig. 1) suggest that 16k PRL may target the Rac1 pathway in endothelial cells. To examine whether the effect of 16k PRL on RAEC migration is mediated through Rac1 at the biochemical level, we analyzed Rac1 activation by using a GST pull-down assay. In this assay, GTP-bound active Rac1 is selectively retained by binding to the Pak1-binding domain (PBD) of its substrate Pak1 in the GST-Pak1 PBD matrix. Treatment of RAEC with either wound scratch or IL-1ß alone induced a weak activation of Rac1 (data not shown). To generate a more robust activation of Rac1, we devised a protocol (WS/IL-ß) that combines multiple wound scratches with the addition of 2.5 ng/mL of IL-1ß (27). In control RAEC, WS/IL-1ß induced a rapid but transient activation of Rac1 at 1 to 2 h (Fig. 2A ). Rac1 activation returned to basal levels at 4 h but increased again at 8 h (Fig. 2A), a time corresponding to active cell migration as observed in the wound healing assay (Fig. 1A). Thus, WS/IL-ß induced a biphasic 4- to 5-fold activation of Rac1 in endothelial cells. In contrast, RAEC subjected to WS/IL-ß in the presence of 16k PRL were unable to activate Rac1 at either the 2- or 8-h time point (Fig. 2A), suggesting that 16k PRL inhibited Rac1 activation in endothelial cells. Further analysis showed that 16k PRL inhibited Rac1 activation in both a time- and dose-dependent manner, with 20 nmol/L of 16k PRL exhibiting the most pronounced inhibition of Rac1 activation (Fig. 2B). Together, these findings suggest that 16k PRL inhibits WS/IL-ß–induced Rac1 activation in endothelial cells.
|
|
16k PRL reduces Pak1 phosphorylation and phospho-Pak1 translocation in response to wound scratch. A major downstream effector of Rac1 is Pak1. Pak1 becomes activated by autophosphorylation at Thr423 upon binding of GTP-Rac1 to the Pak-binding domain (30). Active Pak1 phosphorylates and inactivates the myosin light chain kinase, and phosphorylates and activates LIM kinase 1. Inactivation of the myosin light chain kinase blocks actin-myosin contraction (31), whereas activated LIM kinase 1 further phosphorylates cofilin and inactivates cofilin-mediated actin depolymerization (32). In this way, activated Pak1 allows actin-myosin elongation and actin polymerization, which together are crucial for lamellipodia formation and cell migration. We next examined whether 16k PRL inhibits RAEC migration through inhibition of the Rac1-Pak1 pathway. Treatment of RAEC with WS/IL-1ß–induced Pak1 autophosphorylation on Thr423 from 2 to 8 h (Fig. 4A ), in which the slight delay relative to Rac1 activation (Fig. 2A) is consistent with Pak1 being a downstream target of Rac1. The elevated level of phospho-Pak1 at 4 h may be due to signaling from other Rho GTPases that also activate Pak1 phosphorylation (33). 16k PRL significantly decreased Pak1 autophosphorylation across all time points (Fig. 4A). These results show that 16k PRL inhibits WS/IL-1ß–induced Pak1 autophosphorylation in endothelial cells.
|
RAEC subjected to WS/IL-ß showed elevated accumulation of phospho-Pak1 in the lamellipodia as well as a robust formation of actin network (Fig. 4B, c). In contrast, 16k PRL blocked WS/IL-ß–inducible translocation of phospho-Pak1 as well as actin network formation at the leading edge lamellipodia (Fig. 4B, d), which is consistent with the general lack of phospho-Pak1 present in these cells after 16k PRL treatment (Fig. 4A). Thus, 16k PRL reduces Pak1 phosphorylation and phospho-Pak1 translocation to the leading edge lamellipodia of migrating REAC in response to wounding.
16k PRL does not interfere with PI3K signaling in RAECs. Rac1 can be activated through both PI3K-dependent and -independent mechanisms (35, 36). To examine whether WS/IL-1ß–induced Rac1 activation might also be mediated through PI3K, we preincubated RAEC for 1 h with 100 nmol/L of wortmannin, a PI3K-specific inhibitor, before WS/IL-1ß treatment. A 2-h incubation with WS/IL-1ß induced Rac1 activation (Fig. 5A, lane 2 ), and this activation was inhibited by the Rac1 inhibitor NSC23766 but not by wortmannin (Fig. 5A, lane 4 versus lane 3). In contrast, phosphorylation of Akt, a well-described downstream target of PI3K, was inhibited by wortmannin but not by the Rac1 inhibitor (Fig. 5A, lane 3 versus lane 4). These results showed that the PI3K-Akt pathway is not involved in the WS/IL-1ß response in endothelial cells.
|
| Discussion |
|---|
|
|
|---|
|
80% completed (Fig. 1). Palacios and D'Souza-Schory reported elevated Rac1 activation at 8 h with increased cell motility after epithelial cell scattering (37). Thus, IL-1ß stimulation coupled with the initial cellular response to wounding might contribute to the first peak of Rac1 activation (Fig. 2), whereas the second peak of Rac1 activity might be correlated with increased cell motility (Fig. 1). Interestingly, 16k PRL efficiently blocked Rac1 activation at both the early and later time points, suggesting that 16k PRL could attenuate IL-1ß signaling (15), cell-to-cell contact and cell motility in RAEC. In line with the biphasic activation of Rac1, WS/IL-1ß induced biphasic activation of upstream activators of Rac1, the guanine nucleotide exchange factor Tiam1 (Fig. 3A) and its upstream activator Ras (Fig. 3B) in RAEC. The kinetics of Ras activation slightly preceded that of Tiam1, which is consistent with Ras signaling through Tiam1 to Rac1 (38). The direct activation by Ras of Tiam1-Rac1 has been observed in neuronal Schwann cells (26). Depending on the cell type and stimulus (35, 36), Ras can activate Rac1 through PI3K signaling and PI3K could mediate Tiam1-Rac1 activation. We showed that in RAEC, WS/IL-1ß does not activate the PI3K pathway and that 16k PRL inhibits Ras signaling in a PI3K-independent manner (Fig. 5). D'Angelo et al. reported that 16k PRL inhibits VEGF-induced Ras-Raf-1-MEK-ERK activation pathway in BBEC (21). Thus, 16k PRL targets Ras signaling in response to either a growth factor– (21) or wound-induced activation in endothelial cells (Fig. 6; ref. 15).
Actin and microtubule cytoskeletal networks play a central role in regulating membrane extensions in lamellipodia and cell polarity, respectively, and thereby regulate directed cell movement (17, 20). Rac1 regulates actin polymerization and lamellipodia protrusions at the leading edge whereas Cdc42 controls filopodia protrusions and cell polarity (20, 39). A major common downstream effector for Rac1 and Cdc42 is Pak1 (39, 40). Phospho-Pak1 stimulates the formation of actin meshwork in the leading edge lamellipodia (34), a process that is crucial for cell migration. In WS/IL-1ß–treated RAEC, instead of the biphasic activation kinetics observed for Ras-Tiam1-Rac1 signaling, phospho-Pak1 levels were increased at 2 h and remained elevated till 8 h (Fig. 4A). The sustained Pak1 activation could be due to the combined activities of Rac1 and Cdc42. The robust formation of actin-rich filopodia and lamellipodia in WS/IL-1ß–treated RAEC would support this idea (Fig. 4B). Whether 16k PRL blocks the activities of both Rac1 and Cdc42 in inhibiting phospho-Pak1 activation remains to be determined. 16k PRL blocked phospho-Pak1 activation, its translocation into the lamellipodia, and formation of the actin meshwork at the lamellipodia (Fig. 4B), suggesting that 16k PRL diminished the dynamic actin organization at the lamellipodia to attenuate cell migration. Additionally, 16k PRL–treated cells also exhibited a higher degree of misorientation of the microtubule-organizing center relative to the direction of cell migration (data not shown), which indicates that 16k PRL may also affect cell polarity through the effects of Cdc42 activity (39). Taken together, 16k PRL may reduce actin dynamics at the lamellipodia, cell polarity, as well as cell-to-cell contacts through down-regulation of Rho GTPase activities to attenuate endothelial cell migration.
16k PRL is a strong antiangiogenic and antitumor agent (9, 11, 13) that inhibits growth factor–mediated proliferation (9) and differentiation (15, 41, 42) of endothelial cells and induces apoptosis in endothelial cells (3, 14). Inhibition of tumor growth by 16k PRL in two in vivo cancer models (11, 13) was correlated with a reduction in microvessel density, which is consistent with 16k PRL inhibition of the endothelial compartment in tumors (4, 42). We and others found that 16k PRL inhibits capillary tube formation in Matrigel (Fig. 1C) as well as in type I collagen gels (9). Rac1 has been suggested to mediate endothelial cell tube formation by regulating the expression of cell adhesion molecules vascular cell adhesion molecule-1, intercellular adhesion molecule-1, and E-selectin (43, 44). Whether 16k PRL–mediated Rac1 down-regulation (Fig. 2) affects endothelial cell adhesion properties, which in turn regulate endothelial cell migration and vessel network formation (Fig. 1), remains to be determined.
Additional mechanisms for inhibition of angiogenesis by 16k PRL have been suggested. 16k PRL inhibits bFGF-mediated urokinase activity (urokinase type plasminogen activator; uPA) through the induction of PAI-1, the inhibitor of uPA, in BBEC (41). In breast cancer cells, the Rac1-MKK3-p38 MAPK pathway stimulates uPA expression via stabilization of uPA mRNA (45). It would be interesting to determine if 16k PRL inhibition of Rac1 contributes to the down-regulation of uPA expression in endothelial cells. 16k PRL has also been shown to inhibit the production of NO, a factor important for endothelial cell survival, migration, and capillary tube formation (46). 16k PRL antagonizes VEGF-inducible endothelial nitric oxide synthase activation (42) as well as IL-1ß–inducible iNOS expression (15) to block NO production in endothelial cells. Preliminary studies showed that the NO inhibitor L-NAME prevented RAEC migration in both the wound healing and Matrigel tube formation assays to a similar extent as that observed with Rac1-specific inhibitor (data not shown). These studies raise the interesting possibility that the NO-mediated pathway (15) and the Rac1-mediated pathway (Fig. 6) may collaborate to promote endothelial cell migration and angiogenesis.
Recent studies have elucidated a role for 16k PRL as a natural inhibitor of ocular angiogenesis as one way to maintain avascularity in the eye (47). The loss of angiogenesis inhibitors may lead to retinal neovascularization observed in retinopathy of prematurity, diabetic retinopathy, and macular degeneration (48). Interestingly, many tissues can process 23k PRL into 16k PRL through the local release of cathepsin D (6). The pathologic outcome of excessive 16k PRL was manifested in postpartum cardiomyopathy in which cardiomyocyte cathepsin D processing of high levels of 23k PRL present after delivery led to decreased myocardial capillary density, degeneration of cardiac capillary network, and reduced cardiac function in postpartum women (49). Thus, 16k PRL is a potent endogenous "vasoinhibin" that regulates vascular functions (48).
16k PRL likely functions through a cell surface receptor that is distinct from the 23k PRL receptor (50). Although the receptor(s) for 16k PRL has not been identified, progress in elucidating 16k PRL–mediated functions in antiangiogenic and antitumor mechanisms have been made. Understanding 16k PRL actions in normal physiology as well as abnormal angiogenesis should help in the application of 16k PRL in the treatment of vascular diseases and tumors.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Dr. Krister Wennerberg for the GST-Rac1G15A vector and Dr. Junji Yamauchi for the GST-Tiam1 RBD vector.
| Footnotes |
|---|
Received 3/16/07. Revised 8/31/07. Accepted 9/12/07.
| References |
|---|
|
|
|---|
B. Mol Endocrinol 2003;17:1815–23.
B-dependent fractalkine induction in rat aortic endothelial cells stimulated by IL-1ß, TNF-
, and LPS. J Leukoc Biol 2000;67:577–84.[Abstract]
-PAK reveals effects of the kinase on actin and focal complexes. Mol Cell Biol 1997;17:1129–43.[Abstract]
in endothelial cells. J Pharmacol Exp Ther 2003;305:573–80.This article has been cited by other articles:
![]() |
C. Clapp, S. Thebault, M. C. Jeziorski, and G. Martinez De La Escalera Peptide Hormone Regulation of Angiogenesis Physiol Rev, October 1, 2009; 89(4): 1177 - 1215. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Charoenphandhu, L.-i. Nakkrasae, K. Kraidith, J. Teerapornpuntakit, K. Thongchote, N. Thongon, and N. Krishnamra Two-step stimulation of intestinal Ca2+ absorption during lactation by long-term prolactin exposure and suckling-induced prolactin surge Am J Physiol Endocrinol Metab, September 1, 2009; 297(3): E609 - E619. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Azab, F. Azab, S. Blotta, C. M. Pitsillides, B. Thompson, J. M. Runnels, A. M. Roccaro, H. T. Ngo, M. R. Melhem, A. Sacco, et al. RhoA and Rac1 GTPases play major and differential roles in stromal cell-derived factor-1-induced cell adhesion and chemotaxis in multiple myeloma Blood, July 16, 2009; 114(3): 619 - 629. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Thongon, L.-i. Nakkrasae, J. Thongbunchoo, N. Krishnamra, and N. Charoenphandhu Enhancement of calcium transport in Caco-2 monolayer through PKC{zeta}-dependent Cav1.3-mediated transcellular and rectifying paracellular pathways by prolactin Am J Physiol Cell Physiol, June 1, 2009; 296(6): C1373 - C1382. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. P. Desai, K. E. Chapman, and C. M. Waters Mechanical stretch decreases migration of alveolar epithelial cells through mechanisms involving Rac1 and Tiam1 Am J Physiol Lung Cell Mol Physiol, November 1, 2008; 295(5): L958 - L965. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-L. Ma, T. Zhang, J. Meng, Z.-Y. Qin, F. Du, Q.-Y. Wang, and S.-L. Wei The role of T-lymphoma invasion and metastasis inducing protein 1 in early pregnancy in mice Mol. Hum. Reprod., October 1, 2008; 14(10): 589 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Clapp, S. Thebault, E. Arnold, C. Garcia, J. C. Rivera, and G. M. de la Escalera Vasoinhibins: novel inhibitors of ocular angiogenesis Am J Physiol Endocrinol Metab, October 1, 2008; 295(4): E772 - E778. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Thongon, L.-i. Nakkrasae, J. Thongbunchoo, N. Krishnamra, and N. Charoenphandhu Prolactin stimulates transepithelial calcium transport and modulates paracellular permselectivity in Caco-2 monolayer: mediation by PKC and ROCK pathways Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1158 - C1168. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |