Cancer Research Targets  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 67, 11798, December 15, 2007. doi: 10.1158/0008-5472.CAN-06-4471
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schmidt, R. L.
Right arrow Articles by Tang, A. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schmidt, R. L.
Right arrow Articles by Tang, A. H.

Experimental Therapeutics, Molecular Targets, and Chemical Biology

Inhibition of RAS-Mediated Transformation and Tumorigenesis by Targeting the Downstream E3 Ubiquitin Ligase Seven in Absentia Homologue

Rebecca L. Schmidt1, Cheol Hong Park2, Atique U. Ahmed2, Justin H. Gundelach2, Nanette R. Reed2, Shen Cheng2, Bruce E. Knudsen2 and Amy H. Tang1,2

Departments of 1 Biochemistry and Molecular Biology and 2 Surgery, Mayo Clinic Cancer Center, Mayo Clinic College of Medicine, Rochester, Minnesota

Requests for reprints: Amy Tang, Mayo Clinic College of Medicine, 200 First Street Southwest, MS-2-85, Rochester, MN 55905. Phone: 507-538-1878; Fax: 507-284-4957; E-mail: tang.amy{at}mayo.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Constitutively active RAS small GTPases promote the genesis of human cancers. An important goal in cancer biology is to identify means of countervailing activated RAS signaling to reverse malignant transformation. Oncogenic K-RAS mutations are found in virtually all pancreatic adenocarcinomas, making the RAS pathway an ideal target for therapeutic intervention. How to best contravene hyperactivated RAS signaling has remained elusive in human pancreatic cancers. Guided by the Drosophila studies, we reasoned that a downstream mediator of RAS signals might be a suitable anti-RAS target. The E3 ubiquitin ligase seven in absentia (SINA) is an essential downstream component of the Drosophila RAS signal transduction pathway. Thus, we determined the roles of the conserved human homologues of SINA, SIAHs, in mammalian RAS signaling and RAS-mediated tumorigenesis. We report that similar to its Drosophila counterpart, human SIAH is also required for oncogenic RAS signaling in pancreatic cancer. Inhibiting SIAH-dependent proteolysis blocked RAS-mediated focus formation in fibroblasts and abolished the tumor growth of human pancreatic cancer cells in soft agar as well as in athymic nude mice. Given the high level of conservation of RAS and SIAH function, our study provides useful insights into altered proteolysis in the RAS pathway in tumor initiation, progression, and oncogenesis. By targeting SIAH, we have found a novel means to contravene oncogenic RAS signaling and block RAS-mediated transformation/tumorigenesis. Thus, SIAH may offer a novel therapeutic target to halt tumor growth and ameliorate RAS-mediated pancreatic cancer. [Cancer Res 2007;67(24):11798–810]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RAS proteins are evolutionarily conserved small GTPases that shuffle between a GTP-bound active state and GDP-bound inactive state (1, 2). The RAS signaling pathway controls cell proliferation, differentiation, and survival in all multicellular organisms (36). Consequently, proper regulation of RAS signaling is critically important for normal development, and dysregulation of the RAS pathway leads to pathologic diseases (79). Indeed, constitutively active RAS promotes cell proliferation, neoplastic transformation, and tumorigenesis (7, 10, 11). Oncogenic RAS proteins are commonly detected in human cancers including ~90% of pancreatic cancers, ~70% of malignant neoplasias and ~30% of all human cancers (10, 1214). Despite the central importance of RAS signaling in human cancer, direct inhibition of hyperactivated RAS has not achieved sufficient clinical efficacy (8, 11, 15). We reasoned that targeting a highly conserved downstream signaling module of the RAS pathway might provide a more effective strategy for inhibiting oncogenic RAS signaling and RAS-mediated tumorigenesis in human cancer.

Signaling events downstream of RAS are complex, nonlinear, and dynamic (16, 17). RAS transmits signals from receptor tyrosine kinases to the nucleus through multiple downstream signaling pathways, chiefly the RAF/MEK/ERK, PI3K/AKT, and RalGEF pathways (4, 6, 1820). In addition, genome-wide surveys have found numerous putative RAS target genes mediating RAS transformation (21, 22). Despite the identification of these diverse RAS targets, it is still difficult to precisely determine which downstream signaling components represent the best therapeutic targets for blocking RAS-mediated neoplastic transformation/tumorigenesis. Thus, identifying the ideal downstream targets in RAS signal transduction to best contravene oncogenic RAS signaling remains a major challenge in cancer biology.

To address this problem, we exploited the wealth of valuable information and insights gained from genetically tractable model organisms. Genetic studies of Drosophila photoreceptor development have identified many downstream components of the RAS pathway as well as described how the major signaling modules are assembled together (23). The Drosophila studies reveal that the proper transmission of RAS/RAF/MEK/ERK signals requires an E3 ligase, seven in absentia (SINA) being the most downstream component identified thus far (23, 24). Indeed, loss-of-function sina mutations block the ability of activated RAS/RAF/MEK/ERK to specify the R7 neuronal cell fate by preventing the RAS-regulated proteolysis of SINA substrates (23, 25). Thus, the SINA-dependent proteolytic pathway seems to serve as a necessary downstream gatekeeper required for proper RAS signal transduction in Drosophila (25).

SINA belongs to an evolutionarily conserved family of E3 ubiquitin ligases. The human genome has two seven in absentia homologues (SIAH1/2) which share >83% amino acid identity with the Drosophila SINA (ref. 26; Supplementary Fig. S1A). Whether human SIAH is a bona fide signaling component of the mammalian RAS pathway is unclear. Due to the extraordinary amino acid conservation shared among the SINA/SIAH E3 ligases, it is conceivable that SIAH-dependent proteolysis might be similarly required for mammalian RAS signal transduction as described in flies. SINA/SIAHs have been implicated in numerous cellular processes from neuronal differentiation, apoptosis, stress response, protein folding to tumor suppression as well as signaling mediated by key signaling molecules including RAS, β-catenin, APC, p53, and NUMB. SINA/SIAHs have been found to interact with and/or degrade more than 28 distinct partners/substrates, most likely through a unique substrate-recognition degron motif (2729). However, none of the SIAH-interacting proteins are known to play a role in the RAS pathway (25, 3032). Despite the interest in SIAH-mediated proteolysis in mammalian cells, the role of SIAH in RAS signaling transduction or RAS-mediated oncogenesis remains to be defined.

Activation of the RAS/RAF/MEK/ERK signaling pathway is a major driving force in cell proliferation, transformation, and tumorigenesis (8, 9). Therefore, determining whether, similar to that in Drosophila, mammalian SIAH is required for proper transmission of RAS signal and, furthermore, whether SIAH-dependent proteolysis is required for RAS-mediated tumorigenesis are important areas of investigation. In this report, we show that SIAH is required for proper RAS signal transduction. Furthermore, inhibiting SIAH function reduces ERK signaling and blocks RAS-dependent cell transformation and human pancreatic tumor growth in vitro and in vivo. Thus, SIAH may serve as a suitable and novel anti-RAS therapeutic target in the treatment of human pancreatic cancer.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture. Human pancreatic cell lines were purchased from American Type Culture Collection and maintained according to standard procedures.

Reverse transcription-PCR. Qiagen RNeasy Kit was used to isolate mRNA from human cells (Qiagen). The First-Strand cDNA was reverse transcribed with AMV-RT (First-Strand cDNA Synthesis Kit for reverse transcription PCR, Roche) before PCR using gene-specific primer with Taq polymerase (Roche). siah1/2– specific primers were used for PCR synthesis by Taq polymerase (Roche). The 5'- and 3'-primers for siah1 PCR were 5'-ATGAGCCGTCAGACTGCTACAG-3' and 5'-CAGGACTGCATCATCACCCAGT-3'. The 5'- and 3'-primers for siah2 PCR were 5'-GCCATCGTCCTGCTCATTGGCA-3' and 5'-ACCAATATGGGAAGGCAGGCAGGAAGGGGC-3'.

Generation of human SIAH1/2proteolysis-deficient mutations. The human SIAH1/2proteolysis-deficient (hSIAH1/2PD) mutant proteins were generated using site-directed mutagenesis to introduce two point mutations (2 Cys -> 2 Ser) in their RING domains (SIAH1C41S-C44S and SIAH2C80S-C83S). Two-step PCR was used to synthesize the full-length siah1/2PD transgene using primers 5'-TCTCCAGTCTCCTTTGACTATGTGTTACCGCCC-3' and 5'-GGGCGGTAACACATAGTCAAAGGAGACTGGAGA-3' for siah-1. 5'-GAGCTGACCTCGCTCTTCGAGTCTC-CGGTCTCC-3' and 5'-GGAGACCGGAGACTCGAAGAGCGAGGTCAGCTC-3' for siah-2. The integrity of siah1/2WT/PD transgenes was confirmed by sequencing. The siah1/2 transgenes were subcloned into pcDNA3, pGEX, and pLentiviral expression constructs.

Expression of human SIAH1/2WT/PD proteins. High-fidelity PCR was carried out using the following primers: (a) siah1-5'-POLYOMA-tagged primer with EcoRI site: 5'-GGCGAATTCAGGAGAACGCCACCATGGAATATATGCCAATGGAAATGGAATATATGCCAATGGAACATATGAGCCGTCAGACTGCTACAGCATTACC-3' and siah1-3' primer with XhoI site: 5'-GGCCTCGAGTCAACACATGGAAATAGTTACATTG-3' for the synthesis of hSIAH1WT/PD with a 5'-POLYOMA tag. (b) siah1-5'-FLAG–tagged PCR primer with EcoRI site: 5'-GGCGAATTCAGGAGAACGCCACCATGGATTACAAGGATGACGACGATAAGAGCCGTCAGACTGCTACAGCATTACC-3' and siah1-3' primer with XhoI site for the synthesis of hSIAH1WT/PD with a 5'-FLAG tag. (c) siah2-5'-FLAG–tagged primer with EcoRI site: 5'-GGCGAATTCAGGAGAACGCCACCATGGATTACAAGGATGACGACGATAAGAGCCGCCCGTCCTCCACCGGCCCCAGCGC-3' and siah2-3' primer with XhoI site: 5'-GGCCTCGAGTCATGGACAACATGTAGAAATAGTAA-3' for the synthesis of hSIAH2WT/PD with a 5'-FLAG tag.

Rat fibroblast focus formation assays. Rat-1 fibroblasts were transfected independently with 10 µg of plasmids (1:5 ratio of H-rasV12 with siah1/2WT, siah1/2PD, or pcDNA3) using LipofectAMINE (Invitrogen) in triplicate. After transfection, the cells were split 1:3, resulting in nine 100-mm plates per experimental condition. After 14 to 21 days when the foci became visible, the cells were fixed in 10% methanol and 10% acetic acid and foci were stained with 0.2% Crystal Violet in 10% ethanol. As controls, Rat-1 fibroblasts expressing H-RASV12 alone (positive control) or SIAH1/2WT, SIAH1/2PD, or pcDNA3 alone (negative controls) were assayed for foci formation.

Soft agar growth assays. Soft agar growth assays were performed as described (33). Two hundred cells were plated in 24-well plates or 2,000 cells in six-well plates. Triplicates of pLentiviral-infected cells or stable lines were resuspended in 0.4% low-melting agarose and plated on top of a layer of 0.8% agarose in complete DMEM (33). The colonies that formed at 2 weeks were imaged and scored. Three separate experiments were done in triplicate, and standard statistical analyses were performed. All data were evaluated by Student's t test with P < 0.001 considered significant.

Generation of stable MiaPaCa cell lines expressing SIAH1/2PD. The pcDNA3 or pcDNA3-siah1/2PD plasmid was used to transfect MiaPaCa cells via electroporation (Bio-Rad GenePulser Xcell). Stable MiaPaCa-pcDNA3 and MiaPaCa-SIAH1/2PD cell lines were established over a 4-week period in 2 mg/mL of G418 selection medium (Invitrogen). Multiple MiaPaCa stable lines expressing SIAH1/2PD at various levels (low, medium, and high) were generated and used in the tumorigenesis assays in athymic nude mice.

Production of pLenti-siah1/2-shRNA and pLenti-SIAH1/2PD viruses. Multiple attenuated Lentiviral vector was used to deliver siah1/2-shRNA constructs and SIAH1/2PD into human cancer cells (34). The three-component system was used to generate the Lentiviruses following standard procedures (35, 36).

For shRNA knockdown, we employed the MISSION pLentiviral mediated gene-specific short hairpin RNA (shRNA) system (37). Control and siah1/2-specific shRNA knockdown constructs were purchased from Sigma. High-titer Lentiviruses were produced using FuGENE (Roche) transfection kit as described (34, 36).

hS1-no. 1 CCGGGTCGCCCAAAGCTCACATGTTCTCGAGAACATGTGAGCTTTGGGCGACTTTTT.
hS1-no. 2 CCGGTCACCAGCAGTTCTTCGCAATCTCGAGATTGCGAAGAACTGCTGGTGATTTTT.
hS1-no. 3 CCGGCACACCTTTGAGCTTAATCTTCTCGAGAAGATTAAGCTCAAAGGTGTGTTTTT.
hS1-no. 4 CCGGCCCTGTAAATATGCGTCTTCTCTCGAGAGAAGACGCATATTTACAGGGTTTTT.
hS1-no. 5 CCGGCTGATAGGAACACGCAAGCAACTCGAGTTGCTTGCGTGTTCCTATCAGTTTTT.
hS2-no. 5: CCGGGCTGGCTAATAGACACTGAATCTCGAGATTCAGTGTCTATTAGCCAGCTTTTT.
hS2-no. 6: CCGGGCCTACAGACTGGAGTTGAATCTCGAGATTCAACTCCAGTCTGTAGGCTTTTT.
hS2-no. 7: CCGGCATACGGAGAAACCAGAACATCTCGAGATGTTCTGGTTTCTCCGTATGTTTTT.
hS2-no. 8: CCGGACACAGCCATAGCACATCTTTCTCGAGAAAGATGTGCTATGGCTGTGTTTTTT.
hS2-no. 9: CCGGCGCTAATAAACCCTGCAGCAACTCGAGTTGCTGCAGGGTTTATTAGCGTTTTT.
.

The pHR-SIN-BX-IRES-Em and pHR-SIN-BX-IRES-SIAH1/2PD bicistronic vector was used to express enhanced green fluorescent protein (eGFP) and SIAH1/2PD, respectively. The viral titer was determined and the Lentiviruses were used to infect cancer cells using an infection ratio of 1:20 (cells to viruses). The biosafety protocols were approved by the Mayo Institutional Biosafety Committee and the BL2+ procedures were followed vigorously.

Athymic nude mice tumor formation assays. One million MiaPaCa or Panc-1 cells were injected s.c. and bilaterally into the dorsal left and right scapular areas of 5-week-old male athymic nude mice NCr nu/nu (NCI/NIH) using 19-gauge needles. Each mouse received two injections of a 200 µL mixture of 1 x 106 cells in 100 µL of 1x PBS and 100 µL of growth factor–reduced MATRIGEL (BD Biosciences). Liquid bandage (NewSkin, MedTech) was used to seal off the injection sites. Six MiaPaCa and two Panc-1 stable lines expressing SIAH1/2PD at different levels along with the control cells were injected into groups of 10 to 15 nude mice. Tumor growth was monitored for 7 to 10 weeks for MiaPaCa and 10 to 15 weeks for Panc-1 cells. Our tumor take rate was 85% to 100%. The tumors were measured with a caliper every 3 days, and tumor volume was calculated as 0.5 x L x H x W. Mice were sacrificed when control tumors reached 15% body weight. The tumors were surgically removed, measured, weighed, and processed. All data were evaluated by Student's t test with P < 0.001 considered significant. All of the animal experiments and surgical procedures were approved by the Mayo Institutional Animal Care and Use Committee.

Histology and immunohistochemistry. Immunohistochemical staining was performed on formalin-fixed and paraffin-embedded tumor tissues as described (38). Five-micrometer-cut sections were deparaffinized, rehydrated in graded ethanol, and stained with H&E, von Willebrand factor (vWF), or anti-SIAH 24E6 antibodies.

Western blot and antibodies. Western blot and immunoprecipitation were performed as described (25). Mouse anti–SIAH-2, rabbit {alpha}-ACTIN, mouse {alpha}-FLAG M2 monoclonal antibody (mAb) and EZview Red anti–FLAG-M2 affinity gel were purchased from Sigma and used as described. Mouse-{alpha} POLYOMA mAb was used at a 1:10 dilution. Rabbit-{alpha}-phospho-ERK, -ERK, -phospho-MEK, -MEK were purchased from Cell Signaling and used at 1:1,000 dilution. Rabbit-{alpha}-p21 was purchased from Santa Cruz Biotechnology and used at 1:1,000 dilution. Mouse-{alpha}-HIF1{alpha} was purchased from BD Transduction Laboratories and used at 1:500 dilution. HRP- and FITC-conjugated secondary antibodies were purchased from Jackson ImmunoResearch Laboratories and used at 1:2,000. Enhanced chemiluminescence was performed as described (Pierce).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SIAH is expressed in proliferating human cells. Oncogenic K-RAS is detected in the vast majority of pancreatic cancers and is thought to be an early event in pancreatic tumorigenesis (13, 39). However, the roles of mammalian SIAH in the RAS pathway are not well defined. We first developed four mAbs against Drosophila SINA, and tested for cross-reactivity to human SIAHs. Indeed, these anti-SINA mAbs were specific in recognizing the SINA/SIAH family of E3 ligases, as confirmed by Western blot and immunohistochemistry (Supplementary Table S1; Supplementary Fig. S1). Using the anti-SINA/SIAH mAbs, we examined the SIAH expression and localization in normal tissues, human pancreatic cancer cells, and tumor specimens. SIAH expression was detected in all human cancer cell lines and tumor tissues as well as in normal proliferating cells such as skin follicles, kidney, gut, and the germinal center (Fig. 1 ; Supplementary Fig. S2). The SIAH expression pattern was predominantly nuclear in proliferating cells regardless of the transformation status (Fig. 1B). In contrast, SIAH expression was undetectable in normal nonproliferating human tissues (Fig. 1A), indicating a strong correlation between increased SIAH-dependent proteolysis and active cell proliferation, consistent with its roles in modulating RAS-mediated cell proliferation in normal development and tumorigenesis (Fig. 1; Supplementary Fig. S2).


Figure 1
View larger version (70K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. SIAH is expressed in proliferating cells. A, SIAH expression in human cancer cells. H&E, H&E staining for the serial paraffin sections of an invasive grade 3 (of 4) human colorectal adenocarcinoma. H&E staining was used to view tissue morphology/cell histology. The section reflects a part of the tumor mass that was defined as a villous adenoma located in the cecum. SIAH, SIAH staining. A majority of the tumor cells in the colorectal adenoma stain with SIAH. The normal differentiated colorectal epithelium cells show little or no background SIAH staining whereas the basal undifferentiated and proliferating columnar epithelium cells show some SIAH staining, indicating that the antibodies are specific for proliferating cells and do not stain normal and nondividing cells. Ki67, as a control, a majority of SIAH (+) tumor cells were also stained positive for Ki67, a well-established marker for proliferating cells. B, representative image showing predominantly nuclear SIAH localization in human pancreatic cancer cells (CAPAN-2) as visualized by (b1) SIAH, (b2) Ki67, (b3) DAPI, and (b4) merge. C, Western blot analysis indicates that endogenous SIAH is expressed in 13 human cancer cell lines examined. SIAH is expressed in proliferating cells and its expression is independent of K-RAS activation. D, both siah1/2 transcripts are expressed in human pancreatic cells. RT-PCR was performed on a panel of human pancreatic cells that included normal epithelial cells (HPDE6), tumor cells (BxPC-3), and cancer cells (Panc-1 and MiaPaCa). The relative levels of siah1/2 transcripts in these cells were estimated semiquantitatively by diluting the cDNA templates serially. GAPDH transcript is used as a positive control.

 
Because the anti-SINA mAbs recognize both human SIAH-1 and SIAH-2 (Supplementary Fig. S1), we could not differentiate whether one or both SIAH orthologues were up-regulated in proliferating cells. To address this question, we measured the siah1/2 transcript levels in human pancreatic cells. Semiquantitative RT-PCR was performed using siah1/2-specific primers to amplify mRNA isolated from either normal epithelial cells (HPDE6), tumor cells with wild-type RAS (BxPC-3), or cancer cells with oncogenic RAS (Panc-1 and MiaPaCa). Despite their drastic differences in tumorigenic potential, both siah1 and siah2 mRNA transcripts were expressed at similar levels in these proliferating pancreatic cells (Fig. 1D). Thus, it is likely that SIAH-1 and SIAH-2 are both expressed in normal and neoplastic proliferating cells.

Expression of SIAHPD blocks H-RASV12–mediated focus formation in Rat-1 fibroblasts. Because SINA is a known downstream component of the Drosophila RAS signaling pathway and virtually all human pancreatic cancers contain hyperactivating K-RAS mutations, we next asked whether modulating SIAH activity might provide a means for suppressing RAS-mediated neoplastic transformation/tumorigenesis. It is known that SINA/SIAH functions as a dimer (25, 40). The use of dominant-negative mutants can be an effective strategy to inhibit the endogenous protein that are known to dimerize (41). Toward this end, we constructed mutant SIAH1/2 proteins by introducing two point mutations (2 Cys -> 2 Ser) in the conserved RING domains. These SIAH mutations inactivate the E3 ligase activity and block self-ubiquitination and substrate degradation (Supplementary Fig. S3A). Because these mutant SIAHs bind substrates but cannot degrade them, we termed the mutant forms of SIAHproteolysis-deficient (SIAHPD). Mutant SIAH2PD can bind to wild-type SIAH-2 (SIAH2WT), and the binding of mutant SIAH2PD to SIAH2WT adversely interferes with SIAH2 activity and substrate ubiquitination (Supplementary Fig. S3). Thus, the SIAH1/2PD mutants function as dominant-negatives and are useful tools to dissect the roles of SIAH1/2 in RAS signal transduction.

We first sought to determine whether mammalian SIAH functions downstream of RAS and participates in RAS-dependent transformation. Toward this end, SIAH1/2WT or SIAH1/2PD was expressed in Rat-1 fibroblasts under the control of the cytomegalovirus promoter in combination with oncogenic H-RAS (H-RASV12), and the effects on RAS-mediated focus formation were monitored. Our results showed that SIAH1/2PD expression dramatically decreased the number of foci induced by H-RASV12, as compared with positive controls transfected with H-RASV12 alone (Fig. 2A and B ). In contrast, SIAH1/2WT expression did not alter the number of foci induced by H-RASv12 under the same conditions, suggesting that SIAHWT expression alone is not sufficient to drive focus formation and cellular transformation (Fig. 2C). These results indicate that blocking SIAH function inhibits RAS-mediated transformation in fibroblasts.


Figure 2
View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. SIAH1/2PD but not SIAH1/2WT suppresses oncogenic RAS-mediated foci formation in rat fibroblasts. A to C, SIAH1/2WT, SIAH1/2PD, and pcDNA vector were transfected alone or together with activated H-RasV12 in Rat-1 fibroblasts to examine whether RAS-mediated foci formation could be inhibited by the proteolysis-deficient mutant SIAHs. Transfections using single plasmid (pcDNA3 vector, pcDNA3-siah1/2WT, or pcDNA3-siah1/2PD) were used as negative controls. No foci were generated in these controls. Three representative 100-mm tissue culture plates (a1, b1, and c1); columns, mean of the experimental results (a2, b2, and c2). A and B, expression of human SIAH1/2PD dramatically reduced the number of foci induced by oncogenic H-RasV12 when compared with cells transfected with H-RasV12 alone. C, SIAH1/2WT was cotransfected with H-RasV12. Expression of human SIAH1/2WT does not affect RAS-mediated foci formation whereas SIAH1/2PD dramatically suppresses RAS-mediated foci formation.

 
SIAH is required for anchorage-independent tumor growth of human pancreatic cancer cells in soft agar. We next sought to determine whether SIAH participates in RAS-mediated anchorage-independent growth and malignant transformation of human pancreatic cancer cells. We used either the pcDNA3 or pLentiviral vector to deliver SIAH1/2PD into MiaPaCa and Panc-1 cells, and examined whether SIAH2PD expression could inhibit the anchorage-independent tumor growth of these cancer cells in soft agar. Indeed, the colony formation of both MiaPaCa-SIAH2PD and Panc-1-SIAH2PD cells were significantly less than those of control cells (Fig. 3b2 and b3 ). Thus, these results support the notion that SIAH2PD expression blocks the RAS-mediated anchorage-independent tumor growth of human pancreatic cancer cells.


Figure 3
View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. SIAH deficiency compromises anchorage-independent tumor growth in soft agar. A, the MISSION pLentiviral-mediated gene-specific shRNA knockdown system was effective in knocking down endogenous siah-2 transcripts in Panc-1 cells. a1, RT-PCR was used to semiquantitatively estimate the extent of the siah-2 knockdown as 2- to 3-fold for shRNA constructs nos. 6 and 8. a2, to show the efficacy of shRNA knockdown, a MiaPaCa stable line (line 7) expressing the FLAG-tagged SIAH2PD at a high level was treated with pLenti-shRNA viruses carrying the siah-2 knockdown constructs. Multiple pLenti-shRNA constructs (nos. 6, 7, and 8) were effective in knocking down the exogenously expressed SIAH2PD. a3, the pLenti-shRNA constructs (nos. 6 and 8) were also effective in knocking down endogenously expressed SIAH2. Note that phospho-ERK activity was markedly down-regulated in siah-2 knockdown cells (nos. 6 and 8). a4, mouse anti–SIAH-2 mAb purchased from Sigma was used to examine endogenous SIAH-2 expression in Panc-1 cells by Western blots. Note that SIAH2 expression is reduced in siah-2 knockdown cells (no. 6) and phospho-ERK activity was markedly down-regulated in siah-2 knockdown cells (no. 6) as well as SIAH2PD-expressing cells. a5, the pLenti-shRNA constructs (nos. 6 and 8) were also effective in reducing the anti–SIAH 24E6H3 staining in Panc-1 cells, showing the mAb specificity against SIAH2. B, RAS-mediated anchorage-independent growth of uninfected Panc-1 cells and Panc-1 cells infected with either pLenti-shRNA siah-2 knockdown viruses (nos. 6, 7, or 8) separately, pLenti-shRNA control and pLenti-GFP viruses, or pLenti-SIAH2PD viruses were examined using soft agar assays. b1, two thousand infected Panc-1 cells were plated into six-well plates in triplicate. Columns, mean experimental results shown above the representative Panc-1 colony images captured at days 1, 7, and 14. Note that pLenti-shRNA–mediated knockdown of siah-2 (no. 8) was effective in blocking Panc-1 colony formation in soft agar. b2, two hundred infected Panc-1 cells were plated into 24-well plates in triplicate. Every colony formed at day 14 was counted; columns, mean of the experimental results is shown above the colony images. Note that SIAH-deficiency either through shRNA knockdown (no. 6) or stable SIAH2PD expression is equally effective in blocking colony formation in soft agar. b3, two thousand MiaPaCa cells and MiaPaCa stable lines expressing either pcDNA3 or FLAG-tagged SIAH2PD were plated in triplicate into six-well plates. Columns, mean of experimental results is shown above the representative MiaPaCa colony images captured. Note that MiaPaCa cells stably expressing SIAH2PD are defective in forming colonies in soft agar.

 
To substantiate the above observations, we used an alternative approach to disrupt endogenous SIAH function by using interfering short hairpin shRNA to further delineate SIAH function in the mammalian RAS pathway. Employing the MISSION pLentiviral-shRNA system to silence siah1/2 expression (37), we achieved an ~2- to 3-fold knockdown of siah2 transcripts in human cancer cells using the siah2-specific shRNA constructs (nos. 6 and 8), as shown by semiquantitative RT-PCR, Western blot analyses, and immunochemical staining (Fig. 3A). Furthermore, to show the knockdown efficacy of these siah2-shRNA constructs, we used a MiaPaCa-SIAH2PD stable line (Supplementary Fig. S4A1, line 7) and showed that the exogenous N-terminal tagged FLAG-SIAH2PD was specifically knocked down by a number of pLenti-shRNA constructs against the siah-2 gene (Fig. 3a2).

Using these shRNA constructs, we next determined whether a reduction in siah-2 expression affects anchorage-independent cell growth and tumorigenesis of human pancreatic cancer cells. Similar to results obtained using SIAH2PD, the siah-2 transcript knockdown markedly reduced colony formation of these cancer cells in soft agar (Fig. 3b1 and b2). Interestingly, in analyzing the effects of either SIAH2PD expression or siah2 knockdown on RAS signaling, we observed that the phospho-ERK signal was significantly reduced in these cancer cells with decreased SIAH function (Fig. 3a3 and a4). The results from these experiments using both shRNA-mediated knockdown and SIAHPD suggest that SIAH is required for RAS-mediated malignant transformation and anchorage-independent tumor growth of human pancreatic cancer cells in soft agar. Furthermore, reduction of ERK signaling upon SIAH2 inhibition suggests that SIAH2 or SIAH2 substrates may be part of a regulatory feedback loop that is involved in modulating RAS/RAF/MEK/MAPK signaling in human pancreatic cancer cells.

Expression of SIAH1/2PD abolishes human pancreatic tumor formation in athymic nude mice. Oncogenic K-RAS mutations are known to drive pancreatic tumor initiation and cancer progression (13). We next examined whether SIAH participates in K-RAS–mediated tumorigenesis in vivo. First, we asked whether blocking SIAH function could inhibit K-RAS–mediated pancreatic tumor formation of MiaPaCa and Panc-1 cells (representing highly aggressive human pancreatic adenocarcinomas) in athymic nude mice. SIAH1/2PD or vector control was introduced into these cancer cells using pcDNA3 transfection or pLentiviral infection, and the manipulated cancer cells were implanted in nude mice. Subsequently, the tumor formation of these cancer cells was monitored to determine the efficacy of SIAH1/2PD molecules in blocking RAS-mediated pancreatic tumorigenesis in vivo.

Stable MiaPaCa-SIAH1/2PD cell lines were cloned, amplified, and checked for SIAH1/2PD expression (Supplementary Fig. S4A). One million MiaPaCa cells expressing either pcDNA3 or SIAH1/2PD were then implanted s.c. into athymic nude mice. Tumor formation was monitored over a 7-week period, as shown by the growth curve in Fig. 4B . Fifty-five of 60 injections of 106 MiaPaCa-pcDNA3 cells into 30 nude mice generated large tumors within 6 weeks. In contrast, none of the 110 injections of 106 MiaPaCa-SIAH1/2PD cells into 55 nude mice generated any sizable tumors (Fig. 4A–C). Thus, the expression of SIAH1/2PD in MiaPaCa cells severely impeded the formation of pancreatic tumors in nude mice (Fig. 4). These MiaPaCa tumors expressing the mutant forms of SIAH1/2PD did, however, exhibit a slight amount of growth beyond 10 weeks, indicating that these SIAH1/2PD-expressing MiaPaCa cells, although growth-defective, were still viable in vivo (Supplementary Fig. S4C). Because SIAHs form homodimers and heterodimers (40), and both SIAH1PD and SIAH2PD have similar antitumor effects for MiaPaCa cells in nude mice, it is conceivable that SIAH1/2PD may interfere with both endogenous SIAH1 and SIAH2 functions. Thus, we focused on characterizing the SIAH2PD phenotypes in subsequent studies.


Figure 4
View larger version (80K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Human SIAH1/2PD blocks MiaPaCa tumor growth in athymic nude mice. One million MiaPaCa cells stably expressing pcDNA3, human SIAH1PD-5' Polyoma-tagged (SIAH-1-PD), or human SIAH2PD-5'-FLAG–tagged (SIAH-2-PD) were injected s.c. into the right and left flanks of 5-week-old male athymic nude mice (n = 10–15 mice per construct/group). Tumor growth was measured every 3 d until 7 wk after injection. A, five representative mice in each injection group are shown, with the tumors that developed at both injection sites shown below the corresponding mice. Blocking SIAH function dramatically suppresses the tumor growth of human pancreatic cancer cells in athymic nude mice when compared with MiaPaCa cells transfected with pcDNA3 vector alone. Graphs displaying the tumor growth rates (B) and average tumor mass following resection of the human pancreatic cells (C) carrying pcDNA or the SIAH1/2PD transgene in nude mice. D, histology was performed on the large and small tumors originating from the MiaPaCa-pcDNA and MiaPaCa-SIAH1/2PD cells. d1 to d4 and d9 to d12, H&E was used to view tumor tissue morphology of the human pancreatic cancer cells resected from the nude mice. Human cancer cells are clearly visible because they are bigger in size and have bigger nuclei than mouse cells, and stained with anti-SIAH 24E6 mAb. d5 to d8, anti-SIAH mAb (24E6) stains human cells but not surrounding mouse cells. d13 to d16, anti-vWF antibodies stain both large and small tumors.

 
For analysis of in vivo tumor formation by another independent human pancreatic cancer cell line, an HIV-based pLentivirus that allows for the coexpression of SIAH2PD and eGFP in a bicistronic fashion under the control of the SFFV promotor was used to infect Panc-1 cells (34, 36). Almost 100% of the cells were infected as indicated by the eGFP marker (Fig. 5b2 ). Both heterogeneous populations of Panc-1 cells infected with high-titer pLenti-eGFP control viruses or pLenti-SIAH2PD-eGFP viruses, as well as multiple stable Panc-1-GFP or Panc-1-SIAH2PD-eGFP cell lines were established. The SIAH2PD expression levels in the Panc-1-SIAH2PD stable cell lines are shown (Fig. 6B , Panc-1-SIAH2PD-eGFP stable line 2 and 3). Tumorigenesis was examined in nude mice using both heterogeneously infected Panc-1 cells as well as the Panc-1 stable lines. One million Panc-1-eGFP and Panc-1-SIAH2PD-eGFP cells were implanted s.c. into athymic nude mice, and tumor formation was monitored over 3 months. The eGFP expression slowed the Panc-1 tumor growth rate due to some GFP toxicity (Fig. 5b1). Nevertheless, a remarkable blockage in pancreatic tumor growth was observed in Panc-1-SIAH2PD cells, even following extended tumor incubation periods of up to 4 months in nude mice (Supplementary Fig. S4D). Thus, these results clearly show that blocking SIAH function dramatically reduces the tumor formation by two highly aggressive pancreatic cancer cell lines in vivo (Figs. 4 and 5).


Figure 5
View larger version (71K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Human SIAH2PD blocks Panc-1 tumor growth in athymic nude mice. One million Panc-1 cells either heterogeneously infected or stably expressing eGFP or human SIAH2PD-5'-FLAG–tagged-eGFP (SIAH-2-PD) were injected s.c. into the right and left flanks of 5-week-old male athymic nude mice (n = 10 mice per construct/group). One million uninfected Panc-1 cells were injected as controls. A, five representative mice in each injection group, with the tumors that developed at both injection sites shown below the corresponding mice. Blocking SIAH function dramatically suppresses the tumor growth of Panc-1 cells in nude mice when compared with uninfected Panc-1 and Panc-1 cells expressing eGFP. B, tumor growth, tumor volume, and weights post-surgery (b1). Graph displaying the tumor growth rates of uninfected Panc-1 cells or Panc-1 expressing GFP or SIAH2PD-GFP transgene stably or heterogeneously in nude mice. Note that the presence of GFP slowed tumor growth due to some GFP toxicity. b2, the GFP and bright-field images of pLentiviral-infected Panc-1 cells expressing either GFP or SIAH2PD-GFP heterogeneously are shown at days 2 to 7 postinfection. The pLentiviral infection rate was close to 100% in the heterogeneous Panc-1 population. Graph displaying average volume (b3) and mass (b4) of these tumors following surgical resection. C, histology was performed on the large and small tumors originating from the Panc-1, Panc-1-SIAH2PD-5F–stable line and Panc-1 heterogeneously infected with pLenti-GFP or pLenti-SIAH2PD-GFP viruses. c1 to c8, H&E was used to view the tissue morphology of Panc-1 tumors resected from the nude mice. Human cells are bigger in size and have bigger nuclei than mouse cells. c9 to c16, anti-SIAH mAb (24E6) stains human cells but not the surrounding mouse cells. c17 to c24, anti-vWF antibodies stain both large and small tumors.

 

Figure 6
View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. SIAH-deficiency reduces MAPK signaling and a schematic model summarizing the proposed role of SIAH-dependent proteolysis in the mammalian RAS signal transduction pathway. A, a panel of human pancreatic cells was mock-infected or infected with pLenti-GFP or pLenti-SIAH2PD viruses. Note that phospho-ERK signaling was also down-regulated in Panc-1 and MiaPaCa cells with oncogenic RAS, whereas phospho-ERK signaling was not significantly altered in normal pancreatic epithelial cells (HPDE6) or tumor cells with wild-type RAS (BxPC-3). B, the signaling events downstream of RAS were examined by Western blots in stable lines of three pancreatic tumor/cancer cells. The expression of SIAH2PD dramatically suppressed MAPK signaling and phospho-ERK expression in both MiaPaCa and Panc-1 stable lines with constitutively activated RAS signal although the MAPK signaling and phospho-ERK expression remained unchanged in BxPC-3 cells with wild-type RAS. C, the human RAS signal transduction pathway is highly conserved with the RAS pathway described in model organisms and contains the same downstream signaling modules such as RAS, RAF, MEK, MAPK, and the ETS family of transcription factors. c1, the RAS signal transduction pathway in Drosophila. SINA is the most downstream component identified in the RAS pathway and it is absolutely required for transmission of activated RAS/RAF/MAPK/ETS signals in the fly. c2, our proposed model in which SIAH is a downstream component of the mammalian RAS signal transduction pathway. SIAH-dependent proteolysis is required for proper mammalian RAS signaling. SIAH-deficiency might affect MAPK signaling through a negative feedback loop control mechanism. By blocking SIAH function, we can inhibit RAS signaling and RAS-dependent transformation and tumorigenesis in mammalian systems.

 
To better understand SIAH1/2PD-mediated tumor suppression at the cellular level, a careful immunohistochemical analysis of the large and small tumors resected from the nude mice was performed to assess changes in cellular morphology, tumor architecture, and angiogenesis. The control and SIAH1/2PD-expressing MiaPaCa and Panc-1 tumors were fixed, sectioned, and stained with H&E, anti–SIAH 24E6 mAb (SIAH), and vWF. The human pancreatic cancer cells could be easily distinguished from the surrounding mouse cells based on their large cell size, large nuclei, and SIAH 24E6 staining (Figs. 4D and 5C). The anti–SIAH 24E6 mAb specifically stained the proliferating human cancer cells but not the surrounding mouse cells (Figs. 4d5d8 and 5c9c16). Despite the obvious differences in tumor size, the SIAH staining patterns were quite similar in both large and small tumors, suggesting that the implanted human cancer cells were growth-suppressed and tumorigenesis-inhibited in the presence of SIAH1/2PD (Figs. 4d5d8 and 5c9c16). Staining for vWF was also present in all tumors regardless of tumor size, suggesting that the vascularized tissues and blood vessels were not significantly altered by expression of SIAH1/2PD in these tumors (Figs. 4d13d16 and 5c17c24). Thus, the SIAH1/2PD-mediated block in pancreatic tumorigenesis seems to be independent of adverse effects on angiogenesis and tumor vasculature and may rather be a result of altered cancer cell/cell and cancer/stromal cell interactions or some disruptions in tumor microenvironment that compromises tumor growth in vivo.

Because SIAH is expressed in proliferating cells, the reduced growth of pancreatic tumor cells in athymic nude mice could be due to impaired cell cycle, cell proliferation, or apoptosis. To address these possibilities, we monitored the cell cycle and proliferation of MiaPaCa-SIAH1/2PD and control cells in tissue culture. We found that the cell cycle profiles, apoptosis, and bromodeoxyuridine incorporation of MiaPaCa-SIAH1/2PD were indistinguishable from MiaPaCa-pcDNA3 cells (Supplementary Fig. S4B; data not shown). In addition, the MiaPaCa-SIAH1/2PD cells proliferated at the same rate (doubling time, ~1.5 days) as MiaPaCa and MiaPaCa-pcDNA3 control cells under tissue culture conditions (Supplementary Fig. S4B1B2). It seemed that blocking SIAH function does not impede cell growth and cell proliferation rate in tissue culture because all of the necessary growth factors and nutrients are provided in the medium. Thus, SIAH may be a necessary licensing factor for tumorigenesis in vivo.

SIAH-2 is known to regulate the hypoxia-inducible factor HIF-1{alpha} by targeting prolyl-hydroxylases PHD1 and PHD3 for degradation (42). Therefore, we examined whether the lack of pancreatic tumor growth in vivo might be due to a lack of HIF-1{alpha} production in response to low oxygen in MiaPaCa-SIAH1/2PD cells. Control and MiaPaCa-SIAH1/2PD cells were incubated under hypoxic conditions, and HIF-1{alpha} expression was determined by Western blot. Similar levels of HIF-1{alpha} were induced in both control and MiaPaCa-SIAH1/2PD cells under hypoxic conditions, indicating that the SIAH1/2PD-mediated tumor suppression was not due to an aberrant response to hypoxia (Supplementary Fig. S5).

SIAH-deficiency attenuates MAPK signaling. Our results indicate that reduced SIAH function via SIAH1/2PD expression or that siah shRNA knockdown prevents both MiaPaCa and Panc-1 adenocarcinoma formation in nude mice independent of alterations in cell proliferation, apoptosis, angiogenesis, or hypoxia response. Because SIAH is required for RAS-mediated transformation in fibroblasts and tumor growth in soft agar, blocking SIAH function may suppress pancreatic tumor growth by modulating RAS signal transduction. Thus, we examined the alterations of the major signaling pathways that function downstream of RAS in SIAH-deficient cells. The MEK/ERK/p38/JNK/AKT signaling pathways were analyzed by Western blot using phospho-specific antibodies in pancreatic cancer cells untreated or infected with either pLenti-eGFP or pLenti-SIAH2PD-eGFP viruses. Surprisingly, although SIAH is a downstream component of RAS signaling, SIAH-deficiency results in a significant reduction in ERK signaling (Figs. 3a3 and a4 and 6A and B). This suggests the interesting possibility that the RAS/RAF/MEK/ERK signaling pathway may be modulated by SIAH2 or SIAH2 substrates/partners through a regulatory feedback loop mechanism, thereby controlling RAS-mediated tumorigenesis in human cancer (Fig. 6C).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Oncogenic RAS mutations promote neoplastic transformation and tumorigenesis (10, 13). To date, direct targeting of hyperactivated K-RAS has shown rather limited therapeutic efficacy in the treatment of human pancreatic cancer (8). As such, additional targets and therapies are urgently needed. Here, we show that a downstream component of the mammalian RAS signaling pathway, SIAH, plays an essential role in RAS-mediated transformation and tumorigenesis. Thus, as an enzyme, SIAH E3 ligase may serve as an ideal target in the development of novel therapeutics for the treatment of pancreatic cancers in which aberrant RAS signaling is an early signaling event and a major driving force in neoplastic transformation and pancreatic tumorigenesis.

Genetic studies in Drosophila/Caenorhabditis elegans have provided pivotal insights into RAS signal transduction cascades. SINA is the most downstream component identified in the Drosophila RAS pathway (23). As a logical extension of our Drosophila studies, we asked whether human SIAH E3 ligases might similarly serve as a downstream gatekeeper for RAS signal transduction in cancer. SIAH is expressed in proliferating cells (both normal and malignant cells) but not in nonproliferating cells (Fig. 1; Supplementary Fig. S2). Because the RAS pathway is active in proliferating cells, it is conceivable that SIAH expression may be required for transmitting the active RAS signal which drives cell proliferation. Importantly, we observed that blocking SIAH function by SIAHPD suppresses RAS-mediated fibroblast transformation, anchorage-independent tumor growth in soft agar, and pancreatic cancer growth in nude mice (Figs. 35). Similarly, shRNA-mediated siah mRNA knockdown also reduced the anchorage-independent growth of pancreatic cancer cells in soft agar (Fig. 3B). Interestingly, SIAH-deficiency in two pancreatic cancer cell lines containing oncogenic K-RAS, MiaPaCa, and Panc-1 resulted in a significant reduction in ERK signaling (Figs. 3a3 and a4 and 6A and B). Thus, the inhibitory effects of reduced SIAH function on the growth of pancreatic tumors, either through SIAHPD expression or shRNA-mediated siah knockdown, may occur through effects on upstream components of RAS/MEK/ERK signaling as a result of a SIAH- or SIAH substrate–regulated feedback loop mechanism (Fig. 6C).

Although SIAH is expressed in proliferating cells, human pancreatic cancer cells stably expressing mutant SIAH1/2PD did not exhibit obvious defects in cell cycle progression, proliferation rate, or bromodeoxyuridine incorporation under tissue culture condition. Expression of SIAH2PD or knockdown of siah-2 transcripts in a panel of normal and malignant human pancreatic cells followed by Western blot analysis of components of the RAS/RAF/MEK/MAPK cascade did, however, reveal that ERK signaling in cells with wild-type RAS (HPDE6 and BxPC-3) was less affected than those with oncogenic RAS (Panc-1 and MiaPaCa; Fig. 6A and B). The differential requirement for SIAH in RAS signaling in cells expressing wild-type RAS versus oncogenic RAS could be due to rewiring of cancer signaling pathways induced by hyperactivated K-RAS and a higher dependency on increased SIAH activity for transmitting proper RAS signaling in cancer cells. The roles of SIAH in RAS signaling and RAS-mediated transformation/tumorigenesis are still open areas of investigation. Human pancreatic cancer cells expressing SIAH1/2PD did exhibit a markedly reduced capacity to form tumors in both soft agar and nude mouse tumor assays (Figs. 35), although there were no dramatic inhibitory effects on cell proliferation and cell cycle progression under tissue culture conditions (Supplementary Fig. S4). Thus, SIAH-dependent proteolysis may play a role in modulating cancer cell behavior and tumor microenvironment in a manner essential for sustaining tumor growth.

Using dominant-negative constructs to block SIAH function may have other unintended side effects. SIAH forms homodimers as well as heterodimers (40), and for proteins that form dimers, the dominant-negative approach is a useful strategy for blocking endogenous protein function (41). Indeed, the ERK pathway was specifically affected in a similar fashion both when shRNA-mediated siah-2 knockdown and expression of SIAH2PD were used to inhibit endogenous SIAH function, indicating the specificity and efficacy of both agents in blocking RAS signaling in human cancer cells (Figs. 3a2a5 and 6A and B). Our results, in which inhibiting SIAH significantly impairs human pancreatic tumorigenesis in nude mice, provides an important step forward in identifying novel therapeutics of blocking RAS signaling by targeting the downstream SIAH-dependent proteolytic machinery. Moreover, by targeting SIAH specifically to inhibit tumor formation, one might avoid complications engendered by other agents that lead to a general inhibition of cell proliferation or proteosome function systemically.

Pancreatic cancer is the fifth leading cause of cancer-related death with a median survival of only 6 months (13, 14); however, conventional therapies have little effect on the course of this disease (13). As such, there is an urgent need to understand the molecular events underlying the cause and progression of pancreatic cancers and develop novel therapeutic agents to treat this devastating form of cancer. The RAS and ubiquitin-mediated proteolysis pathways have a demonstrated importance in neoplastic transformation and tumorigenesis (8, 9, 4345). Small molecules that block proteosome activity have shown some clinical promise as novel antineoplastic agents in treating patients with relapsed and refractory multiple myeloma; however, the systemic toxicity due to global inhibition of proteosome function is of significant concern (46, 47). Thus, the development of specific inhibitors that selectively target key E3 ligases, such as MDM2 and SIAH, thereby inhibiting important signaling pathways dysregulated in human cancer, would be highly desirable and effective (43, 44, 48).

How regulated proteolysis in the RAS pathway contributes to neoplastic transformation/tumorigenesis remains to be elucidated. Here, we show that RAS signal transduction depends on proper SIAH function in cancer cells. (a) SIAH is expressed in dividing cells whereas its expression is absent in nondividing cells. (b) Blocking SIAH function through either the dominant-negative SIAH1/2PD or shRNA-mediated siah-2 knockdown inhibits RAS-mediated foci formation in fibroblasts, anchorage-independent tumor growth in soft agar, and human pancreatic tumor formation in nude mice. (c) Although SIAH is a downstream component of RAS signaling, inhibition of SIAH function results in a reduction in ERK signaling. Thus, SIAH may be a necessary downstream transducer of activated RAS signaling in mammalian cells and that SIAH-mediated proteolysis is required for RAS-dependent neoplastic transformation/tumorigenesis. Furthermore, as the inhibition of SIAH enzymatic activity impaired the ability of highly aggressive human pancreatic cancer cells to form tumors in vivo, this raises an exciting possibility that targeting of SIAH may be a viable anticancer therapeutic option. The next generation of small molecules aimed at targeting SIAH-mediated proteolysis in RAS signaling pathways may yield highly selective therapeutics that could halt the progression of human pancreatic cancer and save the lives of those with this devastating disease.


    Acknowledgments
 
Grant support: Mayo Clinic Pobanz Family Predoctoral Research Fellowship (R.L. Schmidt), NIH GM 069922 (A.H. Tang), Lustgarten Foundation for Pancreatic Cancer Research (RFA05-046; A.H. Tang), Mayo Clinic Specialized Programs of Research Excellence in Pancreatic Cancer (A.H. Tang), Mayo Prostate Specialized Programs of Research Excellence Career Development Award (A.H. Tang), and a startup fund from the Mayo Foundation (A.H. Tang).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We are grateful to Junjie Chen, Scott Kauffman, Jeffrey Platt, Edward Leof, Peter Harris, Jan van Deursen, Heather Thompson, Adina Bailey, and Nick Zagorski for reading of this manuscript and their valuable comments. We thank Eric Fearon for providing untagged human siah1/2 cDNAs, Thomas Smyrk and Joseph Grande for assistance with immunopathology, Yashuhira Ikeda for pLentiviral vectors and advice for Lentivirus production, Debabrata Mukhopadhyay for assistance with the hypoxia treatment, Karen Lien for assistance with immunohistochemical staining, and James Tarara for assistance with flow cytometry.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 12/ 6/06. Revised 9/ 1/07. Accepted 10/23/07.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Barbacid M. ras genes. Annu Rev Biochem 1987;56:779–827.[CrossRef][Medline]
  2. Lowy DR, Willumsen BM. Function and regulation of ras. Annu Rev Biochem 1993;62:851–91.[CrossRef][Medline]
  3. Bollag G, McCormick F. Regulators and effectors of ras proteins. Annu Rev Cell Biol 1991;7:601–32.[CrossRef][Medline]
  4. Campbell SL, Khosravi-Far R, Rossman KL, Clark GJ, Der CJ. Increasing complexity of Ras signaling. Oncogene 1998;17:1395–413.[CrossRef][Medline]
  5. Marshall C. How do small GTPase signal transduction pathways regulate cell cycle entry? Curr Opin Cell Biol 1999;11:732–6.[CrossRef][Medline]
  6. Shields JM, Pruitt K, McFall A, Shaub A, Der CJ. Understanding Ras: ‘it ain't over 'til it's over’. Trends Cell Biol 2000;10:147–54.[CrossRef][Medline]
  7. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000;100:57–70.[CrossRef][Medline]
  8. Downward J. Targeting RAS signalling pathways in cancer therapy. Nat Rev Cancer 2003;3:11–22.[CrossRef][Medline]
  9. Schubbert S, Shannon K, Bollag G. Hyperactive Ras in developmental disorders and cancer. Nat Rev Cancer 2007;7:295–308.[CrossRef][Medline]
  10. Bos JL. ras oncogenes in human cancer: a review. Cancer Res 1989;49:4682–9.[Abstract/Free Full Text]
  11. Downward J. Cancer biology: signatures guide drug choice. Nature 2006;439:274–5.[CrossRef][Medline]
  12. Almoguera C, Shibata D, Forrester K, Martin J, Arnheim N, Perucho M. Most human carcinomas of the exocrine pancreas contain mutant c-K-ras genes. Cell 1988;53:549–54.[CrossRef][Medline]
  13. Bardeesy N, DePinho RA. Pancreatic cancer biology and genetics. Nat Rev Cancer 2002;2:897–909.[CrossRef][Medline]
  14. Jemal A, Siegel R, Ward E, et al. Cancer statistics, 2006. CA Cancer J Clin 2006;56:106–30.[Abstract/Free Full Text]
  15. Sebolt-Leopold JS, Herrera R. Targeting the mitogen-activated protein kinase cascade to treat cancer. Nat Rev Cancer 2004;4:937–47.[CrossRef][Medline]
  16. Huang E, Ishida S, Pittman J, et al. Gene expression phenotypic models that predict the activity of oncogenic pathways. Nat Genet 2003;34:226–30.[CrossRef][Medline]
  17. Bild AH, Yao G, Chang JT, et al. Oncogenic pathway signatures in human cancers as a guide to targeted therapies. Nature 2006;439:353–7.[CrossRef][Medline]
  18. Wolthuis RM, Bos JL. Ras caught in another affair: the exchange factors for Ral. Curr Opin Genet Dev 1999;9:112–7.[CrossRef][Medline]
  19. Ulku AS, Der CJ. Ras signaling, deregulation of gene expression and oncogenesis. Cancer Treat Res 2003;115:189–208.[Medline]
  20. Repasky GA, Chenette EJ, Der CJ. Renewing the conspiracy theory debate: does Raf function alone to mediate Ras oncogenesis? Trends Cell Biol 2004;14:639–47.[CrossRef][Medline]
  21. Zuber J, Tchernitsa OI, Hinzmann B, et al. A genome-wide survey of RAS transformation targets. Nat Genet 2000;24:144–52.[CrossRef][Medline]
  22. Vasseur S, Malicet C, Calvo EL, et al. Gene expression profiling by DNA microarray analysis in mouse embryonic fibroblasts transformed by rasV12 mutated protein and the E1A oncogene. Mol Cancer 2003;2:19.[CrossRef][Medline]
  23. Zipursky SL, Rubin GM. Determination of neuronal cell fate: lessons from the R7 neuron of Drosophila. Annu Rev Neurosci 1994;17:373–97.[CrossRef][Medline]
  24. Carthew RW, Rubin GM. Seven in absentia, a gene required for specification of R7 cell fate in the Drosophila eye. Cell 1990;63:561–77.[CrossRef][Medline]
  25. Tang AH, Neufeld TP, Kwan E, Rubin GM. PHYL acts to down-regulate TTK88, a transcriptional repressor of neuronal cell fates, by a SINA-dependent mechanism. Cell 1997;90:459–67.[CrossRef][Medline]
  26. Hu G, Chung YL, Glover T, Valentine V, Look AT, Fearon ER. Characterization of human homologs of the Drosophila seven in absentia (sina) gene. Genomics 1997;46:103–11.[CrossRef][Medline]
  27. House CM, Hancock NC, Moller A, et al. Elucidation of the substrate binding site of Siah ubiquitin ligase. Structure 2006;14:695–701.[Medline]
  28. Santelli E, Leone M, Li C, et al. Structural analysis of Siah1-Siah-interacting protein interactions and insights into the assembly of an E3 ligase multiprotein complex. J Biol Chem 2005;280:34278–87.[Abstract/Free Full Text]
  29. Polekhina G, House CM, Traficante N, et al. Siah ubiquitin ligase is structurally related to TRAF and modulates TNF-{alpha} signaling. Nat Struct Biol 2002;9:68–75.[CrossRef][Medline]
  30. Amson RB, Nemani M, Roperch JP, et al. Isolation of 10 differentially expressed cDNAs in p53-induced apoptosis: activation of the vertebrate homologue of the drosophila seven in absentia gene. Proc Natl Acad Sci U S A 1996;93:3953–7.[Abstract/Free Full Text]
  31. Nemani M, Linares-Cruz G, Bruzzoni-Giovanelli H, et al. Activation of the human homologue of the Drosophila sina gene in apoptosis and tumor suppression. Proc Natl Acad Sci U S A 1996;93:9039–42.[Abstract/Free Full Text]
  32. Roperch JP, Lethrone F, Prieur S, et al. SIAH-1 promotes apoptosis and tumor suppression through a network involving the regulation of protein folding, unfolding, and trafficking: identification of common effectors with p53 and p21(Waf1). Proc Natl Acad Sci U S A 1999;96:8070–3.[Abstract/Free Full Text]
  33. Cox AD, Der CJ. Biological assays for cellular transformation. Methods Enzymol 1994;238:277–94.[Medline]
  34. Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 1997;15:871–5.[CrossRef][Medline]
  35. Bainbridge JW, Stephens C, Parsley K, et al. In vivo gene transfer to the mouse eye using an HIV-based lentiviral vector; efficient long-term transduction of corneal endothelium and retinal pigment epithelium. Gene Ther 2001;8:1665–8.[CrossRef][Medline]
  36. Naldini L, Blomer U, Gallay P, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 1996;272:263–7.[Abstract]
  37. Moffat J, Grueneberg DA, Yang X, et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 2006;124:1283–98.[CrossRef][Medline]
  38. Dempsey LA, Plummer TB, Coombes SL, Platt JL. Heparanase expression in invasive trophoblasts and acute vascular damage. Glycobiology 2000;10:467–75.[Abstract/Free Full Text]
  39. Hruban RH, Goggins M, Parsons J, Kern SE. Progression model for pancreatic cancer. Clin Cancer Res 2000;6:2969–72.[Free Full Text]
  40. Depaux A, Regnier-Ricard F, Germani A, Varin-Blank N. Dimerization of hSiah proteins regulates their stability. Biochem Biophys Res Commun 2006;348:857–63.[CrossRef][Medline]
  41. Herskowitz I. Functional inactivation of genes by dominant negative mutations. Nature 1987;329:219–22.[CrossRef][Medline]
  42. Nakayama K, Frew IJ, Hagensen M, et al. Siah2 regulates stability of prolyl-hydroxylases, controls HIF1{alpha} abundance, and modulates physiological responses to hypoxia. Cell 2004;117:941–52.[CrossRef][Medline]
  43. Adams J. The proteasome: a suitable antineoplastic target. Nat Rev Cancer 2004;4:349–60.[CrossRef][Medline]
  44. Hoeller D, Hecker CM, Dikic I. Ubiquitin and ubiquitin-like proteins in cancer pathogenesis. Nat Rev Cancer 2006;6:776–88.[CrossRef][Medline]
  45. Nakayama KI, Nakayama K. Ubiquitin ligases: cell-cycle control and cancer. Nat Rev Cancer 2006;6:369–81.[CrossRef][Medline]
  46. Chauhan D, Hideshima T, Anderson KC. Proteasome inhibition in multiple myeloma: therapeutic implication. Annu Rev Pharmacol Toxicol 2005;45:465–76.[CrossRef][Medline]
  47. Voorhees PM, Orlowski RZ. The proteasome and proteasome inhibitors in cancer therapy. Annu Rev Pharmacol Toxicol 2006;46:189–213.[CrossRef][Medline]
  48. Vassilev LT, Vu BT, Graves B, et al. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science 2004;303:844–8.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
K. Nakayama, J. Qi, and Z. Ronai
The Ubiquitin Ligase Siah2 and the Hypoxia Response
Mol. Cancer Res., April 1, 2009; 7(4): 443 - 451.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
A. U. Ahmed, R. L. Schmidt, C. H. Park, N. R. Reed, S. E. Hesse, C. F. Thomas, J. R. Molina, C. Deschamps, P. Yang, M. C. Aubry, et al.
Effect of Disrupting Seven-in-Absentia Homolog 2 Function on Lung Cancer Cell Growth
J Natl Cancer Inst, November 19, 2008; 100(22): 1606 - 1629.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schmidt, R. L.
Right arrow Articles by Tang, A. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schmidt, R. L.
Right arrow Articles by Tang, A. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online