| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
Departments of 1 Cancer Biology, 2 Radiation Biology, and 3 Neurosurgery, Comprehensive Cancer Center, Wake Forest University School of Medicine, Winston-Salem, North Carolina
Requests for reprints: Steven J. Kridel, Department of Cancer Biology, Comprehensive Cancer Center, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157. Phone: 336-716-7299; Fax: 336-716-0255; E-mail: skridel{at}wfubmc.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and concomitant inhibition of protein synthesis. PERK-deficient transformed mouse embryonic fibroblasts and HT-29 colon carcinoma cells that express a dominant negative PERK (
C-PERK) are hypersensitive to FAS inhibitor–induced cell death. Pharmacologic inhibition of FAS also induces the processing of X-box binding protein-1, indicating that the IRE1 arm of the ER stress response is activated when FAS is inhibited. Induction of ER stress is further confirmed by the increased expression of the ER stress–regulated genes CHOP, ATF4, and GRP78. FAS inhibitor–induced ER stress is activated prior to the detection of caspase 3 and PARP cleavage, primary indicators of cell death, whereas orlistat-induced cell death is rescued by coincubation with the global translation inhibitor cycloheximide. Lastly, FAS inhibitors cooperate with the ER stress inducer thapsigargin to enhance tumor cell killing. These results provide the first evidence that FAS inhibitors induce ER stress and establish an important mechanistic link between FAS activity and ER function. [Cancer Res 2007;67(3):1262–9] |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The functional connection between FAS and tumor progression has been provided by the discovery and design of small molecule drugs that inhibit the catalytic activity of FAS (8, 9). Cerulenin and C75, which target the keto-acyl synthase domain of FAS, were the first small molecules to be described as inhibitors of FAS activity in human tumor cells. These pharmacologic agents inhibit FAS activity and induce cell death in many tumor cell lines in vitro (5, 7). The compounds are also effective at inhibiting the growth of human tumor xenografts in vivo and have chemopreventive abilities (10–12). We were the first to describe orlistat as an inhibitor of the thioesterase domain of FAS (13). Orlistat inhibits FAS activity and induces cell death in a variety of tumor cell lines and is able to effectively inhibit the growth of prostate tumor xenografts in mice (13–15). The data linking FAS function and tumor cell survival emphasizes the relevance of FAS as an attractive antitumor target. The importance of fatty acid synthesis in tumor cells is further underscored by data demonstrating that pharmacologic and genetic inhibition of two upstream enzymes in the fatty acid synthesis pathway, ATP citrate lyase and acetyl CoA carboxylase, also induces cell death in tumor cell lines (16–18).
Because FAS is a target for therapeutic intervention, it is important to fully understand the role of FAS in tumor cells as well as the antitumor effects of FAS inhibitors. Given that the endoplasmic reticulum (ER) is the major site for phospholipid synthesis in cells, it is not surprising that previous studies have identified a link between pathways that regulate lipid synthesis and the ER stress response (19–21). Fatty acid synthesis in general, and FAS activity in particular, drives phospholipid synthesis which primarily occurs in the ER (22). Because of the direct connection between FAS activity and phospholipid synthesis, we tested the hypothesis that pharmacologic blockade of FAS activity might induce ER stress in tumor cells (22). The data presented herein shows for the first time that inhibition of FAS induces ER stress specifically in a variety of tumor cells and not in normal cells. Importantly, we also show that FAS inhibitors cooperate with a known ER stress inducer, thapsigargin, to induce cell death. The data also provide evidence that FAS inhibitors might be combined with PERK inhibitors to more effectively treat cancer. The evidence suggests that increased FAS expression in tumor cells is important for ER function to maintain membrane biogenesis and suggests a role for ER stress in the antitumor effects of FAS inhibitors.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, phospho-eIF2, cleaved caspase 3, and cleaved PARP were from Cell Signaling Technologies (Beverly, MA). Antibody against FAS was from BD Transduction Labs (San Diego, CA). Antibody against ß-tubulin was from NeoMarkers (Fremont, CA). TRIzol was from Invitrogen. Avian myeloblastosis virus–reverse transcriptase and Taq Polymerase were from Promega (Madison, WI). 35S-Methionine and 14C-acetate were purchased from GE Healthcare (formerly Amersham Biosciences, Piscataway, NJ). Oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA), except for those designed for short interfering RNA (siRNA), which were synthesized by Dharmacon (Lafayette, CO). All other reagents were purchased from Sigma (St. Louis, MO), Calbiochem (San Diego, CA), or Bio-Rad (Hercules, CA).
Cell culture and drug treatments. Prostate tumor cell lines were maintained in RPMI 1640 supplemented with 10% fetal bovine serum at 37°C and 5% CO2. Wild-type and PERK–/– mouse embryonic fibroblasts (MEF), obtained from David Ron (Skirball Institute of Biomolecular Medicine, New York University School of Medicine, New York, NY), HeLa cervical cancer cells, and FS-4 human foreskin fibroblasts were maintained in DMEM-high glucose supplemented with 10% fetal bovine serum. HT-29 colon carcinoma cells were maintained in McCoy's 5A medium supplemented with 10% fetal bovine serum. HT-29 cells expressing the pBabe-puro empty vector or the pBabe-puro-C-PERK construct were maintained with 1 µg/mL of puromycin and supplemented with 20% fetal bovine serum, nonessential amino acids, and 2-mercaptoethanol. Cells were treated for the indicated times and drug concentrations as indicated. Orlistat was extracted from capsules in ethanol as described previously and stored at –80°C (13). Further dilutions were made in DMSO.
Generation of C-PERK–expressing cells. To generate human tumor cells with deficient PERK signaling, HT-29 cells seeded in six-well plates were transfected with 1 µg of pBabe-puro or pBabe-puro-C-PERK using LipofectAMINE (Invitrogen). These plasmids have been described previously (23). Stable populations of each construct were selected by incubating transfected cells with 3 µg/mL of puromycin for 48 h. The transfected cell populations were then maintained in 1 µg/mL of puromycin for subsequent experiments in the medium described above.
Immunoblot analysis. Cells were harvested after the indicated treatments, washed with ice-cold PBS, and lysed in buffer containing 1% Triton X-100 and a complete protease, kinase, and phosphatase inhibitor cocktail. Protein samples were electrophoresed through 7.5%, 10%, or 12% SDS-polyacrylamide gels and transferred to nitrocellulose, except for blots to detect phospho-eIF2 and eIF2, which were transferred to Immobilon-P membrane (polyvinylidene difluoride). Immunoreactive bands were detected by enhanced chemiluminescence (Perkin Elmer Life Sciences, Inc., Boston, MA).
Metabolic labeling of protein and fatty acid synthesis. To measure fatty acid synthesis, 1 x 105 cells per well were seeded in 24-well plates. Cells were treated with C75 (10 µg/mL), orlistat (25, 50 µmol/L), or cerulenin (5, 10 µg/mL) for 2 h. 14C-Acetate (1 µCi) was added to each well for 2 h. Cells were collected, washed, and lipids were extracted and quantified as previously described (13). To measure new protein synthesis, PC-3 cells were seeded in six-well plates. Orlistat (50 µmol/L) and thapsigargin (1 µmol/L) were added for the indicated times. After incubation with orlistat or thapsigargin, the cells were switched to methionine-deficient medium although maintaining the drug concentrations. Methionine-deficient medium supplemented with 100 µCi/mL of 35S-methionine was added to the cells for 30 min to label newly synthesized proteins. After the labeling period, cells were washed, lysed, and samples were resolved by electrophoresis through a 10% SDS-polyacrylamide gel. The gel was then stained with Coomassie, dried, and the relative protein synthesis of each sample was quantified after scanning with a Typhoon 9210 (Amersham) using ImageQuant software.
Clonogenic survival assays. Cells were plated in six-well plates at a low density depending on the individual cell type. PC-3 cells were plated at a density of 800 cells per well, except for the experiment combining C75 with thapsigargin, for which PC-3 cells were plated at 3,000 cells per well. HT-29 and MEF cells were plated at a density of 400 cells per well. Human tumor cells were plated 48 h prior to each experiment, whereas MEFs were plated 24 h prior to treatment. Fresh medium containing the indicated drugs was added at the indicated concentrations for 12 to 20 h as indicated. The medium was then removed, the wells were washed and fresh medium was added. Plates were incubated until macroscopic colonies formed. To visualize colonies, the wells were washed twice with ice-cold PBS and fixed for 10 min with a 10% methanol/10% acetic acid solution. Colonies were stained with a 0.4% crystal violet/20% methanol solution for 10 min. The crystal violet solution was removed, the wells were washed with water to remove excess dye, and dried at room temperature overnight. Colonies were quantified by counting and by solubilization in 33% acetic acid followed by spectrophotometric analysis at 540 nm. The survival of treated cells was normalized relative to vehicle-treated cells and statistical significance was determined by two-tailed Student's t tests.
Detection of X-box binding protein-1 splicing and ATF4, GRP78, CHOP, and GADD34 expression. Cells were exposed to the various drug treatments or transfected with siRNA for the indicated times. Total RNA was isolated from cells using TRIzol according to the manufacturer's directions. cDNA was generated from 2 µg of total RNA using Avian myeloblastosis virus–reverse transcriptase. X-box binding protein-1 (XBP-1) was amplified by PCR with Taq polymerase using the oligonucleotides AAACAGAGTAGCAGCTCAGACTGC (sense) and TCCTTCTGGGTAGACCTCTGGGAG (antisense). The XBP-1 products were resolved on 2% Tris acetate-EDTA agarose gels and imaged on the Typhoon 9210 at 610 nm. The expression of CHOP, ATF4, GRP78, and GADD34 was determined by semiquantitative PCR using RNA collected as described above. Multiple cycles were tested for each gene to determine the optimum cycles in the linear range. The oligonucleotide sequences used were: CHOP, CAGAACCAGCAGAGGTCACA and AGCTGTGCCACTTTCCTTTC; GRP78, CTGGGTACATTTGATCTGACTGG and GCATCCTGGTGGCTTTCCAGCCATTC; ATF4, CTTACGTTGCCATGATCCCT and CTTCTGGCGGTACCTAGTGG; and GADD34, GTGGAAGCAGTAAAAGGAGCAG and CAGCAACTCCCTCTTCCTCG. The CHOP, GRP78, and ATF4 products were resolved on 1% Tris acetate-EDTA agarose gels and imaged on the Typhoon 9210 at 610 nm.
Suppression of FAS expression with siRNA. A paired siRNA oligonucleotide against the FAS gene (FAS1 sense, GUAGGCCUUCCACUCCUAUU) and one siRNA against luciferase as a negative control (Luc sense, CUUACGUGAUACUUCGAUU) were designed and synthesized by Dharmacon. The individual siRNAs (30 nmol/L) were transfected into cells upon plating with siPORT NeoFX transfection reagent (Ambion, Austin, TX) according to the instructions of the manufacturer. Cells were collected at the indicated times after transfection and then harvested for RNA to perform reverse transcription-PCR (RT-PCR) or protein for immunoblot analysis.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in tumor cells. Several studies have shown that lipid composition is important for maintaining ER function (19–21, 24, 25). Other studies have shown that FAS drives phospholipid synthesis in tumor cells (22). Because of this fact, we hypothesized that FAS inhibitors might induce ER stress. One hallmark of ER stress is the PERK-dependent phosphorylation of the translation initiation factor eIF2. We first examined the phosphorylation status of eIF2 in cells treated with three different pharmacologic inhibitors of FAS (Fig. 1A
). PC-3 cells were treated with orlistat (12.5–50 µmol/L, left) or cerulenin (5 or 10 µg/mL, middle) for 16 h, or C75 (10 µg/mL) for 8 to 24 h (right). Each FAS inhibitor induced robust phosphorylation of eIF2 at each concentration after 16 h of treatment, as did thapsigargin (data not shown). Similarly, all three inhibitors induced eIF2 phosphorylation regardless of tumor cell type tested (data not shown). Likewise, fatty acid synthesis was inhibited to similar degrees by each treatment, as measured by 14C-acetate incorporation into total cellular lipids (Fig. 1B, left). Because the phosphorylation of eIF2 leads to the inhibition of protein synthesis, we did a 35S-methionine labeling experiment to measure the levels of newly synthesized proteins in cells treated with orlistat. PC-3 cells were treated with orlistat (50 µmol/L) for 12 and 24 h or thapsigargin (1 µmol/L) as a positive control for 1 h (Fig. 1B, right). Orlistat treatment reduced protein synthesis by 56% after 12 h and by 73% at 24 h, similar to treatment with thapsigargin. Therefore, orlistat treatment is sufficient to induce the phosphorylation of eIF2 and, subsequently, inhibit protein synthesis. To further confirm our findings, a genetic approach was also used to inhibit FAS expression. PC-3 cells were transfected with FAS-specific siRNA or siRNA against luciferase as a negative control. Immunoblot analysis showed a nearly 70% reduction of FAS protein in the samples 48 h after transfection, which continued through 72 h (Fig. 1C). Consistent with our findings using pharmacologic inhibitors, the reduction of FAS expression levels resulted in the detection of significant levels of phosphorylated eIF2 at 72 h (Fig. 1C). Conversely, treatment of normal human foreskin FS-4 fibroblasts with the FAS inhibitor orlistat did not result in the phosphorylation of eIF2a (Fig. 1D). Collectively, these data indicate that eIF2 phosphorylation induced by FAS inhibition is, indeed, specific to both FAS and tumor cells.
|
phosphorylation in response to orlistat treatment. There are four known eIF2 kinases: PERK, GCN2, PKR, and HRI; however, PERK is the kinase that phosphorylates eIF2 during the ER stress response (26, 27). To determine whether PERK is the kinase responsible for the phosphorylation eIF2 in response to FAS inhibition, wild-type and PERK–/– MEFs transformed with Ki-RasV12 were obtained and tested for their sensitivity to orlistat (27). The wild-type and PERK–/– MEFs were treated with orlistat (12.5 µmol/L) for 8, 16, and 24 h (Fig. 2A
) or treated with thapsigargin (1 µmol/L) for 1 h (data not shown). In the wild-type MEFs, orlistat induced the phosphorylation of eIF2 within 8 h (Fig. 2A), consistent with our findings in prostate tumor cell lines (Fig. 1A). On the other hand, no significant phosphorylation of eIF2 was evident during the same time course of orlistat treatment in the PERK-deficient cells (Fig. 2A). As expected, thapsigargin only induced phosphorylation of eIF2 in the wild-type and not the PERK–/– MEFs (data not shown). These data indicate that FAS inhibition results in PERK-dependent phosphorylation of eIF2.
|
To further support the results obtained in MEFs, we generated stable populations of HT-29 colon carcinoma cells transfected with a dominant negative PERK construct that lacks the kinase domain (C-PERK) or the corresponding empty vector (23). These cells were seeded at a low density and treated with C75 (9 µg/mL), orlistat (25 µmol/L), or thapsigargin (10 nmol/L) to assess clonogenic survival. As expected, the HT-29 C-PERK cells were hypersensitive to thapsigargin as shown by a nearly 3-fold reduction in clonogenic survival (Fig. 2C, P < 0.005). Similarly, the HT-29 C-PERK cells were also hypersensitive to both orlistat and C75 compared with the empty vector–transfected cells. Clonogenic survival was reduced >2-fold in C75-treated cells and nearly 4-fold in orlistat-treated cells (Fig. 2C, P < 0.005). These results confirm that PERK function is important for an adaptive response in tumor cells when FAS activity is inhibited.
Treatment with orlistat induces processing of XBP-1. In addition to the PERK-regulated arm, the ER stress response can also be mediated by IRE1, a kinase with endonuclease activity that facilitates the splicing of XBP-1 mRNA to yield the splice variant XBP-1(s) during ER stress (29). To determine whether pharmacologic inhibition of FAS also activates the IRE1 pathway, the status of XBP-1 mRNA was assessed by RT-PCR using oligonucleotides which flank the splice site in the XBP-1 mRNA. Total RNA was collected from PC-3 cells treated with orlistat (50 µmol/L) for 8 to 24 h (Fig. 3A ) or with cerulenin (5 or 10 µg/mL) for 16 h (Fig. 3B). Thapsigargin treatment resulted in a loss of the 473 bp product associated with unspliced XBP-1 and the appearance of the processed 447 bp form associated with XBP-1(s) that is produced only in response to ER stress (Fig. 3A). Similarly, orlistat treatment resulted in the appearance of the 447 bp XBP-1(s) product in as few as 8 h with maximum processing by 16 h (Fig. 3A). Cerulenin also induced the processing of XBP-1 (Fig. 3B). To further confirm the role of FAS inhibition in the processing of XBP-1 to XBP-1(s), HeLa cells were transfected with FAS-specific siRNA or siRNA against luciferase as a negative control and collected for RT-PCR (Fig. 3C). The 447 bp fragment that corresponds to the ER stress–specific XBP-1(s) product was detected at 72 h in the FAS-specific siRNA samples. Although PC-3 cells exhibit XBP-1 splicing after both orlistat and thapsigargin treatment, FS-4 cells exhibited only minor induction of XBP-1 and no splicing in response to orlistat (Fig. 3D). These results suggest that the IRE1 pathway of the ER stress response is activated in parallel to the PERK pathway when FAS is inhibited in tumor cells.
|
phosphorylation, was also induced by orlistat treatment (Fig. 4C). Collectively, the data in Figs. 1–4 show that FAS inhibitors induce the ER stress response.
|
and subsequent indications of the ER stress response events coincide or precede cell death induced by FAS inhibition, we analyzed the temporal phosphorylation of eIF2 and markers of caspase activity and cell death. In PC-3 cells treated with orlistat, phosphorylation of eIF2 was evident at 16 h of treatment, whereas significant cleavage of caspase 3 and PARP are not detectable until 24 and 48 h, respectively, consistent with previous reports (13). These data indicate that the ER stress response is induced prior to caspase 3 activation and PARP cleavage. These data are further supported by the timeline of XBP-1 processing following orlistat treatment (Fig. 3A). Previous studies have shown that inhibition of protein translation with cycloheximide can ameliorate the effects of ER stress, likely by decreasing protein burden on the ER (28). Clonogenic survival assays and immunoblot analysis were done in PC-3 cells treated with vehicle control, cycloheximide (1 µg/mL), orlistat (25 µmol/L), or orlistat with cycloheximide (Fig. 5B and C
). Cycloheximide treatment rescued clonogenic survival of PC-3 cells treated with orlistat (Fig. 5B), and also inhibited orlistat-induced phosphorylation of eIF2 (Fig. 5C). These data are consistent with previous reports on the protective effect of cycloheximide on cells under ER stress and suggest that reduced protein burden on the ER or reduced expression of a specific proapoptotic factor could be responsible.
|
separately, the level of phosphorylated eIF2 was significantly reduced in cells treated with the two agents combined, with no change in total eIF2 levels (Fig. 6A, top right). This data suggests that the combined agents facilitated a more rapid progression of the ER stress response and induction of the GADD34 feedback loop (33). In support of this, mRNA expression of GADD34 was increased in PC-3 cells treated with both agents, as compared with either agent alone (Fig. 6A, bottom right). Confirming that the effects of this combination of drugs are not cell type–specific, clonogenic survival was assessed in HT-29 cells treated with one of two combinations: either (a) orlistat (25 µmol/L), thapsigargin (25 nmol/L), or the combination of both for 12 h (Fig. 6B, left); or (b) C75 (9 µg/mL), thapsigargin (25 nmol/L), or the combination of both for 12 h (Fig. 6B, right). Although clonogenic survival only indicates an additive interaction, these data, importantly, show that ER stress does not inhibit the actions of FAS inhibitors and may actually enhance their efficacy.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Because FAS inhibitors are being developed as antitumor agents, it is important to understand the effects these drugs have on both normal and tumor cells. The evidence here shows that FAS inhibitors induce the ER stress response in a variety of tumor cells, but not in normal cells. A model summarizing these data is presented in Fig. 6C. Our results suggest that in a proliferating tumor cell, FAS activity drives phospholipid synthesis, which facilitates ER homeostasis and function. When FAS activity is inhibited in tumor cells, the result is PERK-dependent phosphorylation of eIF2, a concomitant attenuation of protein synthesis and the IRE1-mediated processing of XBP-1. Interestingly, phosphorylation of eIF2 persists for as long as 48 h with no attenuation (Fig. 5A), suggesting that protein phosphatase 1 activity is not activated or that GADD34 is not induced as is evidenced by the lack of expression in Fig. 6A. Downstream of PERK and IRE1 activation, inhibiting FAS activity also induces mRNA expression of canonical markers of the ER stress response pathway including CHOP, GRP78, and ATF4. The precise role of these players has not been determined in cells that have been treated with FAS inhibitors. However, it has previously been shown that ATF4 acts to protect cells from ER-generated reactive oxygen species (40). Another report showed that siRNA-mediated knockdown of FAS or acetyl CoA carboxylase in breast cancer cells results in cell death that is mediated by reactive oxygen species and is attenuated by supplementation with the antioxidant vitamin E, which suggests that the ER stress response in general, and ATF4 expression specifically, may be a response to changes in the redox status of FAS inhibitor–treated cells (18). These data are consistent with the hypothesis that the ER stress response initially acts to protect cells from FAS inhibitors, but do not rule out that ER stress could also facilitate cell death after prolonged stress.
It is interesting to note that several indicators of ER stress, including phosphorylation of eIF2, inhibition of protein synthesis, and XBP-1 processing are detected well before the canonical hallmarks of apoptosis, cleaved caspase 3 and cleaved PARP. This indicates that the ER may be an early sensor of fatty acid and phospholipid levels in tumor cells. When the ER stress response is unable to fully restore ER function perturbed by FAS inhibition, it is possible that this could lead to the initiation of a cell death program. Consistent with this notion, cycloheximide is able to inhibit the orlistat-induced cell death and phosphorylation of eIF2. These data do not conflict with previous reports demonstrating that FAS inhibitors activate the intrinsic cell death pathway and that ceramide accumulation contributes to FAS inhibitor–induced cell death (34, 41). In fact, a previous study showed that ceramide accumulation was also associated with thapsigargin-induced ER stress and apoptosis (36). It is possible that FAS inhibitor–induced ER stress may result in ceramide accumulation which is important for cell death; however, the relationship between FAS inhibition, ER stress, and subsequent downstream events remain to be determined. Given the importance of phospholipid synthesis during S phase of the cell cycle, showing that FAS inhibitors induce ER stress in tumor cells also compliments a previous study which established that FAS inhibitors induce apoptosis during S phase (42, 43). Collectively, the data presented herein fill a critical gap in our understanding of how endogenous fatty acid synthesis is required to maintain proper ER integrity and function.
We have shown that inhibiting FAS activity in tumor cells induces an ER stress response. Based on these findings, we propose that one teleologic explanation for high FAS levels in tumors is to provide support for a dynamic ER in rapidly proliferating cells. Furthermore, we hypothesize that the ER acts as a sensor of FAS activity and resulting phospholipid levels. In addition, we show that orlistat and C75 cooperate with the ER stressing agent thapsigargin to enhance cell death in vitro. Although thapsigargin is highly toxic and not a likely candidate for tumor therapy, these data imply that tumor microenvironment–induced ER stress will not hinder the efficacy of FAS inhibitors (44). The data also suggests that FAS inhibitors might be combined with PERK inhibitors to enhance tumor cell cytotoxicity. In summary, these data provide the first evidence that FAS inhibitors induce ER stress, which may explain some antitumor effects of FAS inhibitors, and they also establish an important mechanistic link between FAS and ER function in tumor cells.
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
Footnotes |
|---|
Current address for C. Koumenis: Department of Radiation Oncology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania.
Received 5/17/06. Revised 10/ 2/06. Accepted 11/21/06.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
gene induces growth inhibition and apoptosis of prostate cancer cells. Cancer Res 2005;65:6719–25.} is essential to breast cancer cell survival. Cancer Res 2006;66:5287–94.} protein levels and decreasing sensitivity to topoisomerase targeted drugs. Mol Pharmacol 2005;68:1699–707./ATF4 module of the UPR in hypoxia resistance and tumor growth. Cancer Biol Ther 2006;5:723–8.[CrossRef][Medline]This article has been cited by other articles:
|
|
 |
|
  P. Fagone, C. Gunter, C. R. Sage, K. E. Gunn, J. W. Brewer, and S. Jackowski CTP:Phosphocholine Cytidylyltransferase {alpha} Is Required for B-cell Proliferation and Class Switch Recombination J. Biol. Chem., March 13, 2009; 284(11): 6847 - 6854. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Besnard, S. E. Wert, M. T. Stahlman, A. D. Postle, Y. Xu, M. Ikegami, and J. A. Whitsett Deletion of Scap in Alveolar Type II Cells Influences Lung Lipid Homeostasis and Identifies a Compensatory Role for Pulmonary Lipofibroblasts J. Biol. Chem., February 6, 2009; 284(6): 4018 - 4030. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ogino, K. Nosho, J. A. Meyerhardt, G. J. Kirkner, A. T. Chan, T. Kawasaki, E. L. Giovannucci, M. Loda, and C. S. Fuchs Cohort Study of Fatty Acid Synthase Expression and Patient Survival in Colon Cancer J. Clin. Oncol., December 10, 2008; 26(35): 5713 - 5720. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Little, F. B. Wheeler, C. Koumenis, and S. J. Kridel Disruption of crosstalk between the fatty acid synthesis and proteasome pathways enhances unfolded protein response signaling and cell death Mol. Cancer Ther., December 1, 2008; 7(12): 3816 - 3824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Knowles, C. Yang, A. Osterman, and J. W. Smith Inhibition of Fatty-acid Synthase Induces Caspase-8-mediated Tumor Cell Apoptosis by Up-regulating DDIT4 J. Biol. Chem., November 14, 2008; 283(46): 31378 - 31384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. D. Bruno, T. D. Gover, A. M. Burger, A. M. Brodie, and V. C.O. Njar 17{alpha}-Hydroxylase/17,20 lyase inhibitor VN/124-1 inhibits growth of androgen-independent prostate cancer cells via induction of the endoplasmic reticulum stress response Mol. Cancer Ther., September 1, 2008; 7(9): 2828 - 2836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Ross, A. M. Najjar, M. Sankaranarayanapillai, W. P. Tong, K. Kaluarachchi, and S. M. Ronen Fatty acid synthase inhibition results in a magnetic resonance-detectable drop in phosphocholine Mol. Cancer Ther., August 1, 2008; 7(8): 2556 - 2565. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. T. Flowers, M. P. Keller, Y. Choi, H. Lan, C. Kendziorski, J. M. Ntambi, and A. D. Attie Liver gene expression analysis reveals endoplasmic reticulum stress and metabolic dysfunction in SCD1-deficient mice fed a very low-fat diet Physiol Genomics, May 1, 2008; 33(3): 361 - 372. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Orita, J. Coulter, E. Tully, F. P. Kuhajda, and E. Gabrielson Inhibiting Fatty Acid Synthase for Chemoprevention of Chemically Induced Lung Tumors Clin. Cancer Res., April 15, 2008; 14(8): 2458 - 2464. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Xiao, Y. Su, R. C. M. Simmen, and F. A. Simmen Dietary soy protein inhibits DNA damage and cell survival of colon epithelial cells through attenuated expression of fatty acid synthase Am J Physiol Gastrointest Liver Physiol, April 1, 2008; 294(4): G868 - G876. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. L. Vavere, S. J. Kridel, F. B. Wheeler, and J. S. Lewis 1-11C-Acetate as a PET Radiopharmaceutical for Imaging Fatty Acid Synthase Expression in Prostate Cancer J. Nucl. Med., February 1, 2008; 49(2): 327 - 334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Orita, J. Coulter, C. Lemmon, E. Tully, A. Vadlamudi, S. M. Medghalchi, F. P. Kuhajda, and E. Gabrielson Selective Inhibition of Fatty Acid Synthase for Lung Cancer Treatment Clin. Cancer Res., December 1, 2007; 13(23): 7139 - 7145. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
