
Cancer Research 67, 1308, February 1, 2007. doi: 10.1158/0008-5472.CAN-06-1600
© 2007 American Association for Cancer Research
p53 Short Peptide (p53pep164) Regulates Lipopolysaccharide-Induced Tumor Necrosis Factor-
Factor/Cytokine Expression
Xiaoren Tang,
Manuel Molina and
Salomon Amar
Department of Periodontology and Oral Biology, School of Dental Medicine, Boston University, Boston, Massachusetts
Requests for reprints: Salomon Amar, Boston University Medical Center, 700 Albany Street, W201E, Boston, MA 02118. Phone: 617-638-4983; Fax: 617-638-8549; E-mail: samar{at}bu.edu.
 |
Abstract
|
|---|
The p53 protein is a sequence-specific DNA-binding factor that can induce apoptosis or activate genes whose dysregulation is involved in cancer. By using serial analysis of gene expression technique, p53-induced genes (PIGs) have been identified, one of which was lipopolysaccharide (LPS)induced tumor necrosis factor-
(TNF-
) factor (LITAF/PIG7). LITAF regulates the transcription of cytokines such as TNF-
. To further elucidate the role of p53 in LITAF expression, LITAF promoter activity was carefully dissected. In this study, we found that the element required for transcriptional activity is mainly located in the region from 990 to 500 of the LITAF promoter; the specific site required for p53 protein-DNA binding is located between 550 and 500. We also found that transient transfection of either a p53 short DNA sequence, called p53LFB12, or its corresponding 7-amino-acid synthetic peptide from amino acids 164 to 170 (K164Q165S166Q167H168M169T170), named p53pep164, significantly reduced LITAF promoter activity to 15% in p53-null H1299 cells. Transfection of p53pep164 into H1299 cells significantly down-regulated LPS-induced LITAF expression as well. Furthermore, transfection of p53pep164 into human monocytes resulted in down-regulation of nine proinflammatory cytokines, including TNF-
. We also found that the LPS-activated p53 is a short-lived protein, and that p53-orchestrated apoptosis occurs shortly after the initiation stage following LPS stimulation and lasts a short time. Once p53 levels return to baseline, the p53-mediated inhibition of LITAF is released, and LITAF-mediated cytokine production can proceed. The present finding proposes a novel link between p53 and the inflammatory processes and highlights potential interventional approaches to control p53-associated inflammatory processes. [Cancer Res 2007;67(3):130816]
 |
Introduction
|
|---|
The tumor suppressor p53 is known to function as a sequence-specific DNA-binding factor that can activate genes whose promoters contain a p53 response element (14). This p53 protein helps to maintain the genomic stability of cells, thereby reducing the probability that a cancer will develop. Lost or mutated p53 is frequently associated with a broad spectrum of human cancers (5, 6). By using the serial analysis of gene expression technique to evaluate the patterns of gene expression following p53 expression, a series of p53-induced genes (PIGs), including lipopolysaccharide (LPS)induced tumor necrosis factor-
(TNF-
) factor (LITAF/PIG7), have been identified and implicated as targets of p53 transcriptional activation (7). Indeed, p53 was found to suppress nuclear factor-
B (NF-
B)mediated inflammatory responses (8). Because our recently cloned transcription factor LITAF, which exhibits NF-
Blike activities, such as regulating the transcription of inflammatory cytokines (TNF-
), was later identified as PIG7, we were interested in investigating how p53 might control LITAF gene expression, thereby also contributing to the regulation of cytokines, including TNF-
.
We previously identified LITAF, which we have shown performs a similar function as NF-
B to regulate TNF-
transcription (9). Inhibition of LITAF mRNA expression in THP-1 cells results in a reduction of TNF-
transcripts. We found that high levels of LITAF mRNA are expressed predominantly in placenta, peripheral blood leukocytes, lymph nodes, and spleen. We also identified the DNA site within the TNF-
promoter that is essential for LITAF binding (10). More recently, we reported the discovery and characterization of a cofactor in this cytokine-regulatory process (signal transducer and activator of transcription 6B), which is LPS dependent as well and which binds to LITAF and up-regulates the transcription of cytokines (11).
The aim of the present study was to characterize the binding relationship between p53 protein and the LITAF DNA promoter and to further dissect the role of p53 in LITAF-mediated processes following LPS stimulation.
 |
Materials and Methods
|
|---|
Cell culture. All bacterial cloning constructs used Escherichia coli strain DH5
(Invitrogen, Carlsbad, CA). U2OS human osteosarcoma cells [p53 wild type (wt)] were grown in DMEM with 10% fetal bovine serum (FBS). THP-1 cells [TIB-202, American Type Culture Collection, Manassas, VA (ATCC)] were grown in RPMI 1640 supplemented with 10% FBS. Human H1299, a p53-null nonsmall cell lung cancer cell line (CRL-5803, ATCC), which contains a homozygous deletion of the p53 gene, was maintained in RPMI 1640 supplemented with 2 mmol/L L-glutamine and adjusted to contain 10 mmol/L HEPES, 1 mmol/L sodium pyruvate, 4.5 g/L glucose, 1.5 g/L sodium bicarbonate, and 10% FBS. Human monocytes, purchased from AB, Inc. (Columbia, MD), were grown in RPMI 1640 supplemented with 10% FBS. All human cell cultures were maintained in a 37°C humidified atmosphere containing 5% CO2.
Plasmid constructs. (I) The clone p53-1, which contains a full-length human p53 gene and expresses wt p53 protein in mammalian cells, was kindly provided by Dr. Bert Vogelstein (The Johns Hopkins Oncology Center, Baltimore, MD). A series of human p53 deletions were constructed, and the major clones were named A12, B1, C6, D10, or p53LFB12, as follows. (a) A12 contained the amino acids of p53 (1-393
101-169). The first mutant DNA fragment was generated by PCR with the primer pair 5'-ATGGAGGAGCCGCAGTCAGAT-3' and 5'-CCGTCATGTGCTGGGAAGGGACAGAAGATG-3'. The second DNA fragment was generated by PCR with the primer pair 5'-CACATGACGGAGGTTGTGAG-3' and 5'-TCAGTCTGAGTCAGGCCCT-3'. Both the first and second PCR-generated DNA fragments were purified and diluted as template to 1 ng per reaction and amplified by PCR with the primer pair 5'-ATGGAGGAGCCGCAGTCAGAT-3' and 5'-TCAGTCTGAGTCAGGCCCT-3'. Finally, the p53 site mutant DNA fragment was inserted into the pcDNA3.1/V5-His TOPO vector. (b) B1 contained coordinating amino acids of p53 (1-393
167-234). The first mutant DNA fragment was generated by PCR with the primer pair 5'-ATGGAGGAGCCGCAGTCAGAT-3' and 5'-ACATGTAGTTCTGTGACTGCTTGTAGATGG-3'. The second DNA fragment was generated by PCR with the primer pair 5'-AACTACATGTGTAACAGTTCC-3' and 5'-TCAGTCTGAGTCAGGCCCT-3'. Both the first and second PCR-generated DNA fragments were purified and diluted as template to 1 ng per reaction and amplified by PCR with the primer pair 5'-ATGGAGGAGCCGCAGTCAGAT-3' and 5'-TCAGTCTGAGTCAGGCCCT-3'. Finally, the p53 site mutant DNA fragment was inserted into the pcDNA3.1/V5-His TOPO vector. (c) C6 contained coordinating amino acids of p53 (1-393
235-300). The first mutant DNA fragment was generated by PCR with the primer pair 5'-ATGGAGGAGCCGCAGTCAGAT-3' and 5'-TGCTCCCTGGGTAGTGGATGGTGGTACAGT-3'. The second DNA fragment was generated by PCR with the primer pair 5'-CCAGGGAGCACTAAGCGAGCA-3' and 5'-TCAGTCTGAGTCAGGCCCT-3'. Both the first and second PCR-generated DNA fragments were purified and diluted as template to 1 ng per reaction and amplified by PCR with the primer pair 5'-ATGGAGGAGCCGCAGTCAGAT-3' and 5'-TCAGTCTGAGTCAGGCCCT-3'. Finally, the p53 site mutant DNA fragment was inserted into the pcDNA3.1/V5-His TOPO vector. (d) D10 contained coordinating amino acids of p53 (1-393
156-178). The first mutant DNA fragment was generated by PCR with the primer pair 5'-ATGGAGGAGCCGCAGTCAGAT-3' and 5'-GGTGCCGGGCGGGGGTGTGGA-3'. The second DNA fragment was generated by PCR with the primer pair 5'-CATGAGCGCTGCTCA-3' and 5'-TCAGTCTGAGTCAGGCCCT-3'. Both the first and second PCR-generated DNA fragments were purified and diluted as template to 1 ng per reaction and amplified by PCR with the primer pair 5'-ATGGAGGAGCCGCAGTCAGAT-3' and 5'-TCAGTCTGAGTCAGGCCCT-3'. Finally, the p53 site mutant DNA fragment was inserted into the pcDNA3.1/V5-His TOPO vector. (e) p53LFB12 contained coordinating amino acids of p53 from 164 to 170 but added one methionine (M) for initiation. The DNA fragment with the primer pair 5'-ATGAAGCAGTCACAGCACATGACGA-3' and 5'-CGTCATGTGCTGTGACTGCTTCATA-3' was annealed by heating for 2 min at 65°C and then cooling slowly to <35°C over 15 to 30 min. The annealed DNA fragment was inserted into the pcDNA3.1/V5-His TOPO vector. (f) 12REV contained the coordinating reverse amino acids of p53LFB12 above from 170 to 164 as a control, but added one methionine (M) for initiation. The DNA fragment with the primer pair 5'-ATGGCAGTACACGACACTGACGAAA-3' and 5'-TTCGTCAGTGTCGTGTACTGCCATA-3' was annealed by heating for 2 min at 65°C and then cooling slowly to <35°C over 15 to 30 min. The annealed DNA fragment was directly inserted into the pcDNA3.1/V5-His TOPO vector. (II) Human genomic DNA from THP-1 cells was prepared as described (12). Subsequently, the full-length LITAF promoter DNA was generated from human genomic DNA by PCR with the primer pair 5'-CCAGAGGGCCGGGAGCGCCCCA-3' and 5'-TTTACCCAGCACCGGCGGTGGA-3' and was subcloned into a vector, pGL3-basic (Promega, Madison, WI). This recombinant vector, containing a full-length LITAF 5' untranslated region (UTR), was named pGLP990. Deletions of LITAF promoter DNA were generated by PCR using pGLP990 as the template, using the following primer pairs: (a) 5'-CGGGGAACCGGCGATGGTCTC-3' and 5'-TTTACCCAGCACCGGCGGTGGA-3' for the region 700 to +100 of the LITAF promoter; (b) 5'-GCCCCCGCCCCCGTCCCCGCC-3' and 5'-TTTACCCAGCACCGGCGGTGGA-3' for the region 600 to +100 of the LITAF promoter; (c) 5'-GGCCAGCTCAGACCTCCCGGC-3' and 5'-TTTACCCAGCACCGGCGGTGGA-3 for the region 550 to +100'; (d) 5'-CGGCGCGGGGACGCCGGGGCG-3' and 5'-TTTACCCAGCACCGGCGGTGGA-3' for the region 500 to +100; (e) 5'-GGTGGCGCCAGCACCTGCTGG-3' and 5'-TTTACCCAGCACCGGCGGTGGA-3' for the region 450 to +100; (f) 5'-GCCTCCTGGGATGCCAGGGGG-3' and 5'-TTTACCCAGCACCGGCGGTGGA-3' for the region 400 to +100. These deletion DNA fragments were subcloned into the pGL3-basic vector and named pGLP700, pGLP600, pGLP550, pGLP500, pGLP450, or pGLP400, respectively.
DNA probes. DNA without mutations was amplified from pGLP990 DNA as the template by PCR using the primer pair 5'-GCCCCCGCCCCCGTCCCCGCC-3' and 5'-CCCCAGCCAAGGGCTCAGTGC-3' for the region 600 to 400 of LITAF promoter. The primer pair 5'-GCCCCCGCCCCCGTCCCCGCC-3' and 5'-CTGGCGCCACCGGCCCCCCGC-3' was used for 600 to 440, and the primer pair 5'-GCGCCCGAGAGGCCAGCTCAGA-3' and 5'-CCCCAGCCAAGGGCTCAGTGC-3' was used for 560 to 400. DNA containing deletions was generated as follows. The double-stranded oligonucleotide (ds-oligo) was annealed by heating for 2 min at 65°C and then cooled slowly to <35°C over 15 to 30 min with the follow primer pairs: (a) 5'-GCCCCCGCCCCCGTCCCCGCCGCCCGGCCCTTTTCTCGGGGCGCCCGAGAGGCCAGCTCAGACCTCCCGGCTCGACAGGCGGCGCGGGCGGCGGTGAGTG-3' and 5'-CCCCAGCCAAGGGCTCAGTGCCCGGGGCCCCCAGCAGGTCCCCGGCGTCCCCGCGCCGCACTCACCGCCGCCCGCGCC-3' for 600 to 400
480 to 440; (b) 5'-GCCCCCGCCCCCGTCCCCGCCGCCCGGCCCTTTTCTCGGGGCGCCCGAGAGGCCAGCTCAGACCTCCCGGCTCGACAGGCCGGGGACCAG-3' and 5'-CCCCAGCCAAGGGCTCAGTGCCCGGGGCCCCCAGCAGGTGCTGGCGCCACCGGCCCCCCGCTGTCTCCCGCTGGTCCCCGGCCTGTCGAG-3' for 600 to 400
-520 to 480; (c) 5'-GCCCCCGCCCCCGTCCCCGCCGCCCGGCCCTTTTCTCGGGGCGCGGGCGGCGGTGAGTGCGGCGCGGGGACGCCGGGGCGCGGGGACCAG-3' and 5'-CCCAGCCAAGGGCTCAGTGCCCGGGGCCCCCAGCAGGTGCTGGCGCCACCGGCCCCCCGCTGTCTCCCGCTGGTCCCCGCGCCCCGGCG-3' for 600 to 400
-560 to 520. After annealing, each 0.01 µg annealed ds-oligo was amplified without additional primers or template by PCR. Finally, the DNAs were purified using a gel extraction kit (Qiagen, Valencia, CA), and each DNA species was labeled with [
32P]ATP using T4 polynucleotide kinase (Promega) following the manufacturer's instructions. Labeled double-stranded DNA oligos were purified using G-25 Sephadex columns (Boehringer, Ingelheim, Germany) and precipitated with ethanol. After centrifugation, the DNA pellets were suspended in 10 µL water, and aliquots of each oligonucleotide were measured for cpm/µL and used as probes for electrophoretic mobility shift assay (EMSA), as described below.
IP-p53 or IP-actin. Cultures of U2OS cells (5 x 106) were transfected with p53-1 or pcDNA3 as control using LipofectAMINE 2000 (Invitrogen) for 3 h, washed with PBS, and incubated overnight in RPMI 1640 with 10% FBS at 37°C and 5% CO2. The proteins from the treated cells or untreated control cells were extracted with lysis buffer (Promega) plus a cocktail of protein inhibitors (Sigma, St. Louis, MO) following the manufacturer's instructions. The immunoprecipitation of p53 (IP-p53) or actin (IP-actin) as control was done using a goat IgG (sc-2028, Santa Cruz Biotechnology, Santa Cruz, CA), a Protein A/G Plus-Agarose (sc-2003, Santa Cruz Biotechnology), or an antibody to p53 (sc-6243-G, Santa Cruz Biotechnology) or actin (sc-1615, Santa Cruz Biotechnology) following the manufacturer's instructions. The protein levels of IP-p53 and IP-actin were confirmed by Western blot with their corresponding antibodies.
Bio-Plex cytokine assay. Human monocytes (1 x 106) were stimulated with 0.1 µg/mL E. coli LPS for 3 h, washed with PBS, then further transfected with p53-1 or pcDNA3 as control using LipofectAMINE 2000 (Invitrogen) or treated with peptides by a Chariot kit (Active Motif, Carlsbad, CA). Cells were then incubated overnight in RPMI 1640 supplemented with 10% FBS at 37°C and 5% CO2. Culture supernatants were harvested and centrifuged at 1,500 x g to remove cell debris, then concentrations of cytokines, including human TNF-
, in the supernatant of each treated or untreated control cell condition were measured. The immunoreactivity was quantified by Bio-Plex 200 System (Bio-Rad, Hercules, CA) and then graphed.
Peptides. Synthetic peptides were supplied by Biosynthesis, Inc. (Lewisville, TX). p53pep164 consisted of the p53 sequence KQSQHMT located in the region from amino acids 164 to 170; pepSC served as a negative control peptide and consisted of the randomly scrambled sequence SKMQQTH (Medusa Random Sample Generator Software, Randombots.com). Both peptides were solubilized in DMSO and delivered into p53-null H1299 or human monocytes by Chariot kit (Active Motif). They were detected by reporter assays and Western blots following the manufacturer's instructions.
EMSA. A commercial kit, Gel Shift Assay System (Promega), was used. A reaction mixture contained 2 µL of HeLa nuclear extract, 1 x 105 cpm/µL radiolabeled double-stranded oligo DNA probe, 1 µg of IP-p53 protein (omitted from control), 2 µL of 5 x buffer, and nuclease-free water to achieve a final volume of 10 µL. Mixtures were incubated at room temperature for 20 min, followed by electrophoresis on nondenaturing 6% polyacrylamide gels in Tris-borate-EDTA buffer [90 mmol/L Tris-borate/2 mmol/L EDTA HEPES (pH 8)].
Western blot analysis. Cultures of p53 wt U2OS cells (5 x 106), p53-null human H1299 nonsmall cell lung cancer cells (5 x 106), or p53 wt human monocytes (1 x 106) were transfected with DNAs using LipofectAMINE 2000 (Invitrogen) for 3 h; washed with PBS; and further transfected with synthetic p53 peptides using a Chariot kit (Active Motif) as required. Cells were then incubated overnight in RPMI 1640 with 10% FBS at 37°C in a humidified atmosphere containing 5% CO2. The proteins from the treated cells or untreated controls were extracted with lysis buffer (Promega) plus a cocktail of protein inhibitors (Sigma) following the manufacturer's instructions and suspended in SDS sample buffer, heated at 95°C for 5 min, then applied to SDS-polyacrylamide gels and detected by Western blotting. Antibodies were purchased from the following vendors: LITAF (611615, BD Biosciences, San Jose, CA), actin (C-11, Santa Cruz Biotechnology), p53 (FL-393-G, Santa Cruz Biotechnology), or luciferase (NB 600-307, Novus Bio, Inc., Littleton, CO).
Luciferase assay. Cultures of U2OS (5 x 106), p53-null human H1299 nonsmall cell lung cancer cells (5 x 106), or p53 wt human monocytes (1 x 106) were cotransfected with DNAs using LipofectAMINE 2000 (Invitrogen) for 3 h; washed with PBS; then further treated with peptides by Chariot kit (Active Motif) as required. The ß-galactosidase gene was included in all transfections. Cells were then incubated overnight in appropriate media (DMEM or RPMI 1640) + 10% FBS at 37°C, in a humidified atmosphere containing 5% CO2. Cells were harvested, and the luciferase activity of each lysate was measured (Turner Designs luminometer model TD-20/20) using a commercial kit (luciferase reporter assay system, Promega) according to the protocol provided by the manufacturer. Finally, the data were normalized to ß-galactosidase expression.
ssDNA apoptosis ELISA. Apoptosis results in remodeled chromatin that renders DNA more fragile. The apoptosis detection protocol used takes advantage of the sensitivity to formamide denaturation observed only in apoptotic cells, not in necrotic cells or in cells with DNA breaks in the absence of apoptosis. The procedure relies upon detection of formamide-denatured ssDNA by a monoclonal antibody in an ELISA format. Human monocytes (1 x 104 per well) cultured in 96-well plates were transiently transfected with DNA (p53-1 or pcDNA3 as control) using LipofectAMINE 2000 (Invitrogen), or else, the cells were stimulated with 0.1 µg/mL E. coli LPS. Treated cells were then incubated in RPMI 1640 supplemented with 10% FBS at 37°C and 5% CO2. Cell supernatants were discarded, and cells were fixed at various times (0, 2, 4, 8, 10, 12, 14, or 16 h) with 200 µL of fixative solution (80% methanol in PBS) and incubated at 37°C for 30 min. Triplicate samples of fixed cells from each condition were subjected to the ssDNA Apoptosis ELISA following the manufacturer's protocol (Chemicon International, Inc., Temecula, CA). Finally, the p53-induced apoptotic rate in cells was quantified on a model 680 Microplate Reader (Bio-Rad) and then graphed. To confirm the effects of p53 and other related gene expression on apoptosis, the cell lysates from human monocytes (1 x 106 per well) cultured in six-well plates under the same conditions were also assayed. The protein levels of these cells were detected by Western blot with antibodies against p53, LITAF, p21, caspase-3, or actin as control.
 |
Results
|
|---|
Apoptosis assay. To investigate the effect of LPS-induced p53 on apoptosis in cells, human monocytes were transfected with p53-1 or pcDNA3 as control or stimulated with LPS, then collected at various times and assessed by ssDNA apoptosis ELISA. As shown in Fig. 1A
, the relative extent of p53-induced apoptosis was gradually increased with the increase of p53 transient expression (Fig. 1A). However, when combined with LPS stimulation, the extent of apoptosis was significantly increased (132% by 4 h of LPS treatment) compared with the controls (8% for untreated, 11% for 0 h treated). After 8 h, the effect had increased slightly but then leveled off (148% after 8 h, 152% at 10 h, 151% at 12 h, 154% at 14 h, and 158% at 16 h; Fig. 1B). Additionally, the accumulation of p53, caspase-3, or p21 was clearly observed at the 4-h time point, but these quickly returned back to baseline protein levels 8 h after treatment. In contrast, no increase of LITAF protein was found before 4 h, but it was gradually increased after 8 h of treatment (Fig. 1B).

View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 1. Effects of p53 on apoptosis in human monocytes and promoter activity of LITAF promoter constructs. A, cells were transiently transfected with DNA (p53-1 or pcDNA3 as control) using LipofectAMINE 2000 (Invitrogen) and fixed at various times (0, 2, 4, 8, 10, 12, 14, or 16 h) and subjected to ssDNA Apoptosis ELISA. The protein extracts (30 µg) from each culture of treated cells were analyzed by Western blot with antibody against p53, LITAF, or against actin as control. B, LPS-induced apoptosis in human monocytes. Cells were stimulated with 0.1 µg/mL E. coli LPS and fixed at various times (0, 2, 4, 8, 10, 12, 14, or 16 h) and subjected to ssDNA Apoptosis ELISA. The protein extracts (30 µg) from each set of treated cells were analyzed by Western blot with antibody against p53, caspase-3, p21, LITAF, or actin. C, the derived nucleotide sequence of the LITAF promoter. The transcription start site is indicated by a +1 as described by Myokai et al. (9). The first amino acid of the open reading frame is indicated by a rectangle. Underlines represent GC boxes. The putative site for p53 binding, from 550 to 500, is surrounded with a box. D, different lengths of the LITAF promoter DNA were fused to a promoterless luciferase reporter vector pGL3-basic. Open box, LITAF promoter; filled box, luciferase reporter gene (Luc). The full-length construct containing a sequence from the region 990 to +100 bp of LITAF promoter yielded the highest luciferase activity, which was set at 100% for comparison with deletion constructs. Triplicate assays were done. Values were normalized to ß-galactosidase expression.
|
|
Identification of LITAF promoter constructs. The full-length LITAF promoter DNA (pGLP990) and its derived deletions were subcloned into pGL3-basic, a plasmid lacking a promoter sequence. Sequence analysis of our clone showed that it was almost identical to human LITAF promoter (Genbank accession no. AB074031) but with a few differences: one base was shifted from g to a in position 899; one base "t" was added at 14; and an additional sequence with 26 bases "aaacaaaaccaaaacaaacaaaaaaa" was present in the region (83 to 58) of the 5' UTR. Finally, no TATA box was recognized, although three GC boxes were identified (Fig. 1C).
Functional analysis of the LITAF promoter by 5' upstream deletions. To examine whether the LITAF promoter contains self-transactivation activity, and to further determine which region might respond to this activity, we generated deletion promoter constructs containing the 1,090-bp promoter vector (990 to +100) and a series of 5' upstream sequence deletions. Each of these constructs, the full-length luciferase reporter construct pGLP990 and deletion constructs pGLP700, pGLP600, pGLP550, pGLP500, pGLP450, and pGLP400 (Fig. 1D), was individually transfected into U2OS cells. The protein extract from the pGLP990-transfected cells was assigned the maximal promoter activity value of 100%. The relative activity that could be detected decreased gradually: pGLP700 (98%), pGLP600 (96%), pGLP550 (83%), pGLP500 (34%), pGLP450 (3.5%), and pGLP400 (2.8%). Thus, the results showed that the element required for self-transactivation activity is mainly located in the region upstream to 500 (Fig. 1D, open columns).
p53-dependent inhibition of LITAF promoter activity. To examine whether LITAF promoter activity could be regulated by p53, H1299 cells (p53/) were cotransfected with pGLP700 and p53-1, and then protein extracts were analyzed by Western blot. The results show that the transient transfection of increasing concentrations of p53-1 from 0.1 to 0.5 µg caused a concomitant decrease in LITAF promoter-activated luciferase gene expression (Fig. 2A
). To further characterize the effect of p53 on the responsive region of the LITAF promoter, H1299 cells were cotransfected with 0.5 µg pGLP700, pGLP600, pGLP550, pGLP500, pGLP450, or pGLP400 plus 0.5 µg p53-1. As shown in Fig. 2B (lane 2, 4, or 6), luciferase gene expression induced by the LITAF promoter in the responsive region from 550 to 500 was completely blocked by cotransfection of 0.5 µg p53-1. Direct measurement of luciferase production also showed the inhibition of gene expression when functional p53 was present (Fig. 2C).

View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 2. The effects of p53 on LITAF promoter activity in H1299 cells. A, dose-response assay. Cells were transiently transfected overnight with 0.5 µg pGLP700 (each lane), plus 0 µg (lane 1), 0.1 µg (lane 2), 0.2 µg (lane 3), 0.3 µg (lane 4), 0.4 µg (lane 5), or 0.5 µg (lane 6) p53-1 DNA and quantities of pCDNA3 plasmid DNA to equalize the total amount of transfected DNA for each condition (1 µg). Cells were incubated overnight at 37°C. Extracts were analyzed by Western blot for the presence of p53, luciferase, or actin. Triplicate experiments were done. A single representative experiment. B, Western blot analysis. Western analysis was done on extracted aliquots from the cells described above (A) containing pGLP600 (lanes 1 and 2), pGLP550 (lanes 3 and 4), pGLP500 (lanes 5 and 6), or pGLP450 (lanes 7 and 8), plus 0.5 µg p53-1 (lanes 2, 4, 6, and 8) or 1 µg pcDNA3 (lanes 1, 3, 5, and 7). A total of 60 µg of protein extracts was loaded per lane. Blots were probed with the following antibodies: p53 (FL-393-G, Santa Cruz Biotechnology), luciferase (NB 600-307, Novus Bio), or actin (C-11, Santa Cruz Biotechnology) as control. C, luciferase expression was measured in H1299 cells lacking p53 that had been cotransfected with 1 µg DNAs, including luciferase reporter constructs plus p53-1. The cells were cultured for 16 h after DNA transfection and then were harvested, and their proteins were purified. The concentration of luciferase from each test was individually measured by a luciferase reporter system (Promega). Triplicate assays were done. Values were normalized to ß-galactosidase production and graphed. Filled columns, transfection of p53-1; open columns, none transfection.
|
|
p53 binding activity. To analyze the direct binding of p53 to the LITAF promoter, p53 protein was immunoprecipitated (IP-p53) and confirmed by Western blot. As shown in Fig. 3A
, the IP-p53 protein sample contains both endogenous and exogenous p53 but is devoid of any actin contamination (lane 5 and 7), suggesting that our IP-p53 protein was highly purified. Subsequently, EMSA was done in the appropriate reaction buffer with 1 µg IP-p53 and 32P-labeled DNA probe (600 to 400, 600 to 440, 560 to 400, 600 to 400
-480 to 440, 600 to 400
-520 to 480, or 600 to 400
-560 to 520) in separate lanes. Lane 2 contained a 100-fold excess of unlabeled competitor. Clearly, the LITAF promoter DNA from 600 to 400 lacking a sequence from 480 to 440 (lane 5) did not significantly affect the p53 binding. However, the deletions ranging from 520 to 480 (lane 6), 560 to 520 (lane 7), or from 600 to 560 (lane 8) completely blocked the binding (Fig. 3B). These results suggest that p53 directly binds within the region from 600 to 480 of the LITAF promoter.

View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 3. Effects of p53 binding activity. A, purification of p53 protein by immunoprecipitation. Extracts from cells that had been transiently transfected with no DNA (lane 1), 0.5 µg pcDNA3 (lane 2), or 0.5 µg of p53-1 (lane 3). The p53-transfected cell extracts were further purified by immunoprecipitation with antibody directed against either p53 or actin. After immunoprecipitation, 0.5 µg (lane 5) or 1 µg (lane 7) of p53 protein (IP-p53) and 0.5 µg (lane 4) or 1 µg (lane 6) of actin protein (IP-actin) were detected by Western blot with antibody against p53 or actin. B, EMSA of the protein-DNA interaction. The DNA amplified from a different region of the LITAF promoter was labeled with [32P]ATP (10) and used as a probe (1 x 105 cpm/µL) in each lane. Lanes 1 to 3, 600 to 400; lane 4, 600 to 440; lane 5, 600 to 400 -480 to 440; lane 6, 600 to 400 -520 to 480; lane 7, 600 to 400 -560 to 520; lane 8, 560 to 400. No p53 (lanes 1 and 2) or 1 µg p53 protein (IP-p53, lanes 38) was added to the appropriate reaction buffer with the DNA probe noted above each lane. In lane 2, a 100-fold excess of unlabeled competitor was also added. Arrows, shifted DNA bands.
|
|
To determine which p53 binding domain inhibits LITAF promoter activity, a series of human p53 constructs were created. Several of the major constructs, p53-1, A12, B1, C6, D10, and p53LFB12, are shown in Fig. 4A
. The proteins extracted from the p53-null H1299 cells transiently transfected with the p53 construct noted above plus pGLP700 were assessed for luciferase assay. The promoter activity of pGLP700 alone was assigned the maximal value of 100%. As shown in Fig. 4B, the LITAF promoter activity was strongly reduced to 9% of control after the transient transfection of wt p53 (p53-1). Partial LITAF promoter activity (73% or 61%) was still maintained by the overexpression of either A12 or B1, which lacked amino acids 101 to 167 or amino acids 167 to 234, respectively. Construct C6, containing amino acid 167 and its flanking sequences, which lacked amino acids 235 to 300, reduced LITAF promoter activity to 22% of control. This suggested that the specific residues playing an important role in inhibition of LITAF promoter activity were located in the region around amino acid 167. Thus, the DNA clones D10 and p53LFB12, which either possessed (D10) or lacked (p53LFB12) amino acid 167 and its flanking sequences, were constructed. Construct D10, lacking amino acids 156 to 178, completely lost the ability to inhibit LITAF promoter activity. In contrast, p53LFB12, which possessed only a short 7-amino-acid peptide representing amino acids 164 to 170 (K164Q165S166Q167H168M169T170), significantly reduced LITAF promoter activity to 31% of control (Fig. 4B, condition 7). Furthermore, we were interested in whether transfection of this sequence would also affect the regulation of the endogenous LITAF gene expression. Thus, the DNAs of p53-1, D10, or p53LFB12, as test samples and non-DNA or pGLP700 alone as negative controls were, respectively, transfected into p53-null H1299 cells. The protein extracts from these transfected cells were analyzed by Western blot with antibodies against LITAF or actin as control. As shown in Fig. 4C, the protein level of the endogenous LITAF gene expression was not changed by the transient transfection of D10 (lane 4) or of pGLP700 (lane 2) but was greatly reduced by transient transfection of p53-1 (lane 3) or p53LFB12 (lane 5) compared with the untreated control (lane 1). These results suggest that the production of LITAF is specifically down-regulated by a p53 short peptide (amino acid KQSQHMT) interacting with LITAF promoter.

View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 4. Diagram of major p53 constructs and the analysis of their effects on LITAF promoter activity. A, different lengths of p53 DNA were truncated and inserted into the pcDNA3.1/V5-His TOPO vector. Gray box, region representing amino acids 100 to 300, covering the p53-specific DNA binding sequence. Deletions ( ) correspond to amino acids 101 to 167 in construct A12, amino acids 167 to 234 in B1, amino acids 235 to 300 in C6, and amino acids 156 to 178 in D10. Construct p53LFB12 contained only 7 amino acids (KQSQHMT) from the region (amino acids 164170). B, proteins extracted from each transfection of construct plus pGLP700 compared with the transfection of pGLP700 alone in p53-null H1299 cells were measured by luciferase assay. Triplicate assays were done. C, extracts from each treatment were analyzed by Western blot with antibodies against LITAF, p53, or actin.
|
|
Consequently, a short peptide (p53pep164) that contained seven residues (amino acids 164170; K164Q165S166Q167H168M169T170) corresponding to p53LFB12 and another peptide (pepSC) with the reverse sequence of p53pep164 as a negative control were synthesized and analyzed using the luciferase assay. As shown in Fig. 5A
, treatment with varying amounts of p53pep164 (Fig. 5A, 810; 1, 10, or 100 µg/mL) plus pGLP700 caused a gradual but significant decrease (66% for no. 8, 40% for no. 9, or 15% for no. 10) in LITAF promoter activity compared with the controls transfected with pGLP700 alone (100% for no. 2) or pGLP700 plus 100 µg/mL pepSC (95% for no. 7). Treatment with peptide alone without pGLP700 did not affect the assay (1.5% for no. 5 or 2.3% for no. 6). To determine which region of the LITAF promoter is the specific site for p53 binding, we introduced p53pep164 (100 µg/mL) plus pGLP700 (no. 12) or pGLP550 (no. 14); these significantly reduced LITAF promoter activity to 15% or 23% of control. However, the same treatment with p53pep164 plus pGLP500 did not affect LITAF promoter activity (no. 16) compared with the control (no. 15). This p53pep164-dependent inhibition of LITAF was evaluated by Western blot. As shown in Fig. 5B, transfection of either DNA (p53-1) or peptide (p53pep164) into primary human monocytes inhibited LPS-induced LITAF production (lane 3 or 5) compared with controls (lane 1, 2, or 4). These findings suggest that the site from 550 to 500 in the LITAF promoter is specific for p53 binding activity.

View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 5. Effects of p53pep164 on LITAF promoter activity and endogenous LITAF gene expression. A, luciferase assay using p53pep164. Cultures of p53-null H1299 cells (5 x 106) were transfected with pGLP700 (24, 712), pGLP550 (13 and 14), or pGLP500 (15 and 16) plus p53LFB12 (4) or plus 12REV (3) as control using LipofectAMINE 2000 (Invitrogen) for 3 h; washed with PBS; and further treated with peptide: 100 µg/mL pepSC (7), p53pep164 at 1 µg/mL (8), 10 µg/mL (9), or 100 µg/mL (10, 12, 14, and 16), after which cells were incubated in appropriate medium at 37°C overnight. Luciferase activities of the lysates from each culture of treated cells were measured. The extracts from untreated (1), pepSC alone (5), p53pep164 alone (6), pGLP700 alone (2 and 11), pGLP550 alone (13), or pGLP500 alone (15) were used as controls. Triplicate assays were done. B, human monocytes (1 x 106) were transfected with p53-1 DNA or p53pep164 or pepSC as negative control before treatment with 0.1 µg/mL E. coli LPS. Cell extracts from each treatment were analyzed by Western blot with antibodies against LITAF or actin as control.
|
|
Analysis of p53pep164-mediated cytokine gene expression in response to LPS stimulation. To further examine the effects of p53pep164 on LPS-induced cytokine production, human monocytes (1 x 106) were stimulated with 0.1 µg/mL E. coli LPS plus p53pep164 or plus pepSC as negative control (Fig. 6A
). Production of 27 cytokines in treated or untreated control cell cultures were measured by the Bio-Plex 200 System. As a positive control, the cytokines induced by cells treated solely with LPS were assigned the maximal value of 100%. As shown in Fig. 6B (no. 10), nine LPS-induced cytokines were significantly reduced by p53pep164 administration: 33% for platelet-derived growth factor (PDGF), 49% for interleukin-1ß (IL-1ß), 77% for IL-15, 35% for IFN-
, 24% for IP-10, 60% for IL-6, 74% for RANTES, 19% for TNF-
, and 58% for IL-1ra, relative to the positive control. Similarly, the significant reduction of these cytokines mediated by p53pep164 (Fig. 6B, no. 10) could also be observed if cells were transiently transfected with p53-1 (wt) DNA (no. 4). In addition, no effect of pepSC on LPS-induced cytokine production could be observed (no. 7), suggesting that p53pep164 as a short peptide substitute for p53 not only down-regulates LITAF gene expression but also significantly decreases the production of nine cytokines.

View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 6. Bio-Plex cytokine assay. A, table showing sample treatments. B, concentration of cytokines, including human TNF- , in the supernatant of each treated or untreated control cell condition was measured, and the immunoreactivity was quantified by Bio-Plex 200 System (Bio-Rad).
|
|
 |
Discussion
|
|---|
We have previously investigated the regulation of LPS-induced inflammatory cytokine expression (911). In the process, we identified a transcription factor (LITAF) that contributes to the regulation of proinflammatory cytokines such as TNF-
. A report from the Vogelstein group unexpectedly linked LITAF/PIG7 and p53 (7). In the present article, we have further characterized the interaction between LITAF and p53. We have engineered LITAF promoter DNA/luciferase constructs, which allowed us to probe their p53-mediated promoter activity. We have found that the element required for p53-directed transcriptional activity is mainly located in the region from 990 to 500 of the LITAF promoter, and that the specific site required for p53 protein-DNA binding seems to be located between 550 and 500. Surprisingly, p53 did not up-regulate LITAF promoter activity as anticipated (7). To the contrary, we have found that the transient transfection of either p53LFB12 DNA or its corresponding synthetic peptide, called p53pep164, that contains seven amino acids of p53 in the region from 164 to 170 (K164Q165S166Q167H168M169T170) significantly reduced LITAF promoter activity to 15% of that typically observed in p53-null H1299 cells (Fig. 5).
Recent studies showed that p53 can suppress the activation of some transcription factors (1316), leading to apoptosis via cytokine activation. However, the signaling pathway whereby p53 activates cytokine-related apoptosis in response to LPS stimulation remains unclear. Consistent with these data, the present study shows that transfection of p53 (wt) or introduction of exogenous p53pep164 into normal human monocytes significantly reduced LPS-induced production of several cytokines: PDGF, IFN-
, RANTES, IP-10, IL-1ß, IL-1r
, IL-6, IL-15, and TNF-
; this down-regulation seems to be LITAF dependent. Our data are also supported by recent studies showing that LPS induces apoptosis in endothelial cells, leading to microvascular injury in numerous tissues in lung, gut, or liver, during sepsis (17, 18). Furthermore, upon LPS treatment, some apoptotic genes, such as p21, Bax, caspase-1, or caspase-3, are found to be induced (19, 20). Under these conditions, stabilization of p53 is clearly observed (21). Further support is provided by recent studies showing that the overexpression of p53 within 24 h in human and rabbit synovial cells can significantly reduce the leukocytic infiltrate, suggesting that p53 production is able to induce synovial apoptosis and to reduce inflammation (22). Finally, p53 wt DNA delivered into human rhabdomyosarcoma cells is found to down-regulate proinflammatory genes, such as IL-15 (23).
Previous studies have indicated that LPS activates both LITAF and p53 gene expression (21, 24). Here, we found that p53 down-regulated LITAF gene expression and prompted us to investigate how p53 could affect LITAF-dependent cytokine production, including TNF-
in response to LPS stimulation. To further understand this process, we hypothesized that the time course for p53 gene expression and the consequent effects might differ from that regulating the LITAF response to LPS. Our data show that in p53-transfected cells, apoptosis is increased regardless of LITAF down-regulation. Furthermore, we observed that LPS stimulation significantly induced apoptosis and the accumulation of p53 and p53 target gene caspase-3 or p21 within 4 h after LPS treatment. However, the extent of apoptosis was relatively constant
8 h after LPS treatment following an initial burst (4 h). As the protein levels of p53, p21, and caspase-3 also quickly returned to baseline levels by about 8 h, we conclude that LPS-activated p53 is a short-lived phenomenon. This suggests that apoptosis mediated by p53 and/or p53-activated p21 or caspase-3 only happens during a brief window at the initiation stage of LPS stimulation. During this time, transcription factors including LITAF will be inhibited by p53 in cells that are not destined for apoptosis. This could explain why cytokine production mediated by LPS via LITAF or other factors was not observed. However, after p53 levels returned to baseline (
8 h), LPS-induced LITAF activation and LITAF-mediated cytokine production could commence (Fig. 1A and B).
Additionally, it is well known that p53 binds to a consensus DNA binding sequence, consisting of two repeats of the 10-bp motif 5'-GGGC(A/T)(T/A)GCCC-3'. Furthermore, several reports have claimed that a sequence with "GGGCTTGCTT" or "AGACAAGCCT" could function as a p53 binding site, and that deletion of these sequences could lead to an unbinding of p53 (2528). However, the site ranging from 600 to 500 of LITAF promoter that was specifically identified in this study as a p53-binding site differed from the p53 motif reported. Thus, it is proposed that p53 peptide p53pep164 regulates cytokines by binding to a novel consensus p53-binding motif in the promoter of the target transcription factors. Therefore, further investigations of the p53 motif at the site of the LITAF promoter, by footprinting and point mutagenesis, may be warranted.
Because p53pep164 substitutes for p53 in binding activity, we were interested to know whether this short peptide also mediates LPS-induced LITAF enhancement of TNF-
production. The present data show that p53pep164 treatment of human monocytes down-regulated LPS-induced LITAF and TNF-
production, advocating for p53 as a key molecular node regulating gene expression in an inflammatory response (27). Furthermore, LITAF/PIG7 has been found to be involved in the carcinogenesis of extramammary Paget's disease (29); therefore, further investigation is warranted to determine whether this short 7-amino-acid p53 peptide (KQSQHMT) plays an important role in p53-regulated LITAF-mediated processes. Taken together, our findings highlight the influence of a 7-amino-acid p53 peptide that binds specifically and with high affinity to the LITAF promoter. Our results pave the way into the elucidation of the role of such peptides in p53-induced target genes.
 |
Acknowledgments
|
|---|
Grant support: NIH/National Institute of Dental and Craniofacial Research grant DE14079 (S. Amar).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 5/ 2/06.
Revised 10/10/06.
Accepted 11/16/06.
 |
References
|
|---|
- Kern SE, Kinzler KW, Bruskin A, et al. Identification of p53 as a sequence-specific DNA-binding protein. Science 1991;252:170811.[Abstract/Free Full Text]
- Ceskova P, Chichger H, Wallace M, et al. On the mechanism of sequence-specific DNA-dependent acetylation of p53: the acetylation motif is exposed upon DNA binding. J Mol Biol 2006;357:44256.[CrossRef][Medline]
- Lee KC, Crowe AJ, Barton MC. p53-mediated repression of alpha-fetoprotein gene expression by specific DNA binding. Mol Cell Biol 1999;19:127988.[Abstract/Free Full Text]
- Brazda V, Jagelska EB, Fojta M, Palecek E. Searching for target sequences by p53 protein is influenced by DNA length. Biochem Biophys Res Commun 2006;341:4707.[CrossRef][Medline]
- Hollstein M, Hergenhahn M, Yang Q, et al. New approaches to understanding p53 gene tumor mutation spectra. Mutat Res 1999;431:199209.[Medline]
- Cohen CJ, Zheng Z, Bray R, et al. Recognition of fresh human tumor by human peripheral blood lymphocytes transduced with a bicistronic retroviral vector encoding a murine anti-p53 TCR. J Immunol 2005;175:5799808.[Abstract/Free Full Text]
- Polyak K, Xia Y, Zweier JL, et al. A model for p53-induced apoptosis. Nature 1997;389:3005.[CrossRef][Medline]
- Komarova EA, Krivokrysenko V, Wang K, et al. p53 is a suppressor of inflammatory response in mice. FASEB J 2005;19:10302.[Abstract/Free Full Text]
- Myokai F, Takashiba S, Lebo R, Amar S. A novel lipopolysaccharide-induced transcription factor regulating tumor necrosis factor alpha gene expression: molecular cloning, sequencing, characterization, and chromosomal assignment. Proc Natl Acad Sci U S A 1999;96:451823.[Abstract/Free Full Text]
- Tang X, Fenton MJ, Amar S. Identification and functional characterization of a novel binding site on TNF-alpha promoter. Proc Natl Acad Sci U S A 2003;100:4096101.[Abstract/Free Full Text]
- Tang X, Marciano DL, Leeman SE, Amar S. LPS induces the interaction of a transcription factor, LPS-induced TNF-alpha factor, and STAT6(B) with effects on multiple cytokines. Proc Natl Acad Sci U S A 2005;102:51327.[Abstract/Free Full Text]
- Yoo YC, Watanabe R, Koike Y, et al. Apoptosis in human leukemic cells induced by lactoferricin, a bovine milk protein-derived peptide: involvement of reactive oxygen species. Biochem Biophys Res Commun 1997;237:6248.[CrossRef][Medline]
- Henderson C, Mizzau M, Paroni G, et al. Role of caspases, Bid, and p53 in the apoptotic response triggered by histone deacetylase inhibitors trichostatin-A (TSA) and suberoylanilide hydroxamic acid (SAHA). J Biol Chem 2003;278:1257989.[Abstract/Free Full Text]
- Kataoka H, Bonnefin P, Vieyra D, et al. ING1 represses transcription by direct DNA binding and through effects on p53. Cancer Res 2003;63:578592.[Abstract/Free Full Text]
- Nahor I, Abramovitch S, Engeland K, Werner H. The p53-family members p63 and p73 inhibit insulin-like growth factor-I receptor gene expression in colon cancer cells. Growth Horm IGF Res 2005;15:38896.[CrossRef][Medline]
- Wu GS. The functional interactions between the p53 and MAPK signaling pathways. Cancer Biol Ther 2004;3:15661.[Medline]
- Vernooy JH, Dentener MA, van Suylen RJ, et al. Intratracheal instillation of lipopolysaccharide in mice induces apoptosis in bronchial epithelial cells: no role for tumor necrosis factor-alpha and infiltrating neutrophils. Am J Respir Cell Mol Biol 2001;24:56976.[Abstract/Free Full Text]
- Hiramatsu M, Hotchkiss RS, Karl IE, Buchman TG. Cecal ligation and puncture (CLP) induces apoptosis in thymus, spleen, lung, and gut by an endotoxin and TNF-independent pathway. Shock 1997;7:24753.[Medline]
- David MD, Cochrane CL, Duncan SK, Schrader JW. Pure lipopolysaccharide or synthetic lipid A induces activation of p21Ras in primary macrophages through a pathway dependent on Src family kinases and PI3K. J Immunol 2005;175:823641.[Abstract/Free Full Text]
- Arimoto T, Choi DY, Lu X, et al. Interleukin-10 protects against inflammation-mediated degeneration of dopaminergic neurons in substantia nigra. Neurobiol Aging. 2006 Jun 10. [Epub ahead of print].
- Munshi N, Fernandis AZ, Cherla RP, et al. Lipopolysaccharide-induced apoptosis of endothelial cells and its inhibition by vascular endothelial growth factor. J Immunol 2002;168:58606.[Abstract/Free Full Text]
- Yao Q, Wang S, Glorioso JC, et al. Gene transfer of p53 to arthritic joints stimulates synovial apoptosis and inhibits inflammation. Mol Ther 2001;3:90110.[CrossRef][Medline]
- De Giovanni C, Nanni P, Sacchi A, et al. Wild-type p53-mediated down-modulation of interleukin 15 and interleukin 15 receptors in human rhabdomyosarcoma cells. Br J Cancer 1998;78:15416.[Medline]
- Tang X, Metzger D, Leeman S, Amar S. LPS-induced TNF-
factor (LITAF)-deficient mice express reduced LPS-induced cytokine: evidence for LITAF-dependent LPS signaling pathways. Proc Natl Acad Sci U S A 2006;103:1377782.[Abstract/Free Full Text] - el-Deiry WS, Kern SE, Pietenpol JA, et al. Definition of a consensus binding site for p53. Nat Genet 1992;1:459.[CrossRef][Medline]
- Bian J, Jacobs C, Wang Y, Sun Y. Characterization of a putative p53 binding site in the promoter of the mouse tissue inhibitor of metalloproteinases-3 (TIMP-3) gene: TIMP-3 is not a p53 target gene. Carcinogenesis 1996;17:255962.[Abstract/Free Full Text]
- Staib F, Robles AI, Varticovski L, et al. The p53 tumor suppressor network is a key responder to microenvironmental components of chronic inflammatory stress. Cancer Res 2005;65:1025564.[Abstract/Free Full Text]
- Miyashita T, Reed JC. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 1995;80:2939.[CrossRef][Medline]
- Matsumura Y, Matsumura Y, Nishigori C, et al. Y. PIG7/LITAF gene mutation and overexpression of its gene product in extramammary Paget's disease. Int J Cancer 2004;111:21823.[CrossRef][Medline]