| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Priority Reports |
Departments of 1 Gene Regulation and Drug Discovery and 2 Clinical and Molecular Pharmacology, Beckman Research Institute, City of Hope National Medical Center, Duarte, California; 3 Fujian Medical University, Fuzhou, Fujian, China; and 4 Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas
Requests for reprints: Wendong Huang, Department of Gene Regulation and Drug Discovery, Beckman Research Institute, City of Hope National Medical Center, 1500 E. Duarte Road, Duarte, CA 91010. Phone: 626-256-4673, ext. 65203; Fax: 626-256-8704; E-mail: whuang{at}coh.org.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
At a young age, FXR/ mice display no general liver toxicity, although they show higher sensitivity to exogenously applied bile acidinduced liver damage (14). However, the long-term effects of the disruption of bile acid and other metabolic pathways in FXR/ mice have not been studied. Here, we report that both male and female FXR/ mice spontaneously developed liver tumors when they were 15 months of age. Before tumors emerged, liver damage and subsequent compensatory proliferation were observed in aging FXR/ mice but not in the wild-type controls. Genes involved in inflammation and cell cycle were up-regulated in the livers of aging FXR/ mice. We also provide evidence indicating that sustained high levels of bile acids may contribute to liver tumorigenesis in FXR/ mice.
| Materials and Methods |
|---|
|
|
|---|
Liver histology. When experiments terminated, livers were removed, and small pieces containing either normal or tumor regions were fixed in 4% formaldehyde-PBS solution, embedded in paraffin, sectioned at 5 µm, and stained with H&E. For immunohistochemical staining, the sections were first incubated with an anti-
-fetoprotein antibody and then followed by an anti-immunoglobulin G secondary antibody (Santa Cruz Biotechnology, Santa Cruz, CA) using standard immunohistochemistry procedures. For 5-bromo-2'-deoxy-uridine (BrdU) staining, mice were injected i.p. with the BrdU solution (10 mg/mg body weight) 2 h before being euthanized. Liver sections were prepared and stained using a BrdU staining kit (Roche, Indianapolis, IN) according to the manufacturer's instructions. The same sections were used for terminal nucleotidyl transferasemediated nick end labeling (TUNEL) staining by a TUNEL kit (Roche).
RNA preparation and reverse transcription-PCR. Total RNAs from the livers of wild-type and FXR/ mice were isolated using TRI reagents (Molecular Research Center, Cincinnati, OH) according to the manufacturer's instructions. First-strand cDNA was synthesized from 3 µg of RNA using Moloney murine leukemia virus reverse transcriptase (Invitrogen, San Diego, CA). mRNA was quantified by real-time quantitative PCR using Applied Biosystems 7300 Fast Real-Time PCR System (Applied Biosystems, Forest City, CA). The following specific forward (F) and reverse primers (R) were used: mINF
F, TCCTGCAGAGCCAGATTATCTC; mINF
R, TGGACCACTCGGATGAGCTCATTG; mTNF
F, TGTCTACTGAACTTCGGGGTGATC; mTNF
R, GGTTGTCTTTGAGATCCATGCCGT; mIL-6 F, TTCCTCTGGTCTTCTGGAGTA C; mIL-6 R, CCTTCTGTGACTCCAGCTTATC; Na+-taurocholic acid cotransporting polypeptide (NTCP) F, ATCTGACCAGCATTGAGGCTCT; NTCP R, CCGTCGTAGATTCCTTTGCTGT; cholesterol 7
-hydroxylase (CYP7a) F, CAAGAACCTGTACATGAGGGAC; CYP7a R, CACTTCTTCAGAGGCTGCTTTC; sterol 12
-hydroxylase (CYP8b) F, TAGCCCTGTTAGAGTGTGTGTGAC; CYP8b R, AGTCAGGATCTCTCCCTGAACTTG; and small heterodimer partner (SHP) F, GTCTTTCTGGAGCCTTGAGCTG; SHP R, GTAGAGGCCATGAGGAGGATTC. The quantity of mRNA was normalized by 18S rRNA. The primers of 18S RNA were from QuantumRNA 18S Internal Standard kit (Ambion, Austin, TX).
Bile acid and alanine aminotransferase analysis. Serum was isolated and total bile acids were measured using bile acid L3K assay kit according to the manufacturer's instructions (Diagnostic Chemicals Limited, CT). Total liver bile acids were measured according to the previous description (8). Serum alanine aminotransferase (ALT) was measured at the City of Hope Helford Research Hospital.
Statistical analyses. Statistical analyses results were carried out using two-tailed Student's t test.
| Results and Discussion |
|---|
|
|
|---|
-fetoprotein (Fig. 1D). The ratios of liver weight to body weight in aging FXR/ mice were significantly higher than those of wild-type controls, indicating a phenotype of hepatomegaly in aging FXR/ liver (Table 1
). This liver enlargement is not completely due to the tumor formation because we observed the same hepatomegaly even before tumors were observed.
|
|
To investigate the mechanism contributing to the formation of liver tumors in FXR/ mice, we first monitored the liver morphology of FXR/ mice at different ages. Starting at 9 months of age, some mice displayed preneoplasms, and at 12 months of age, small foci became obvious. Histologic analysis at these ages indicated clearly liver damage, including many vacuoles due to lipid deposits (Fig. 2A-a ), vacuolation due to cell damage (Fig. 2A-b), inflammation (Fig. 2A-c), and focal necrosis (Fig. 2A-d). None of these pathologic changes were found in wild-type mice or in young FXR/ mice. In addition, TUNEL staining of the same liver sections indicated that some hepatocytes go to apoptosis in liver as FXR/ mice age, whereas this was not observed in wild-type mice of the same age (Fig. 2B). Significant amounts of BrdU-positive cells were detected around the damaged regions in sections of liver from aging FXR/ mice, which suggests that a compensatory regenerative proliferation may be initiated (Fig. 2C).
|
|
Inflammation is known to stimulate cell death and increase cell turnover, thus promoting liver tumorigenesis (1517). Therefore, we checked the gene expression of several cytokines using the liver RNAs prepared from peritumor regions of livers of 15-month-old FXR/ mice. As expected, mRNA levels of proinflammation factors, interferon
, tumor necrosis factor-
, and interleukin-6, were significantly higher than those in wild-type controls (Fig. 3B). In contrast, the expression of cyclooxygenase-2 does not change (data not shown). The same pattern of gene expressions was observed in tumor regions from the same livers or livers from 9-month-old FXR/ mice (data not shown). The results suggest that the increased expression of proinflammatory genes as FXR/ mice age may eventually contribute to liver tumor formation in these mice.
Disruption of bile acid homeostasis is the major defect in FXR/ mice. Bile acids have been shown to promote liver tumor in a hepatitis B virus transgenic mouse model and are considered to induce inflammation and liver tumorigenesis in mdr-2 knock-out mice (18, 19). To test if bile acids contribute to the liver tumor formation in FXR/ mice, we fed wild-type mice with a 0.2% CA diet for 30 weeks with or without preinjection of a liver carcinogen, DEN. The results indicate that, although 0.2% CA diet by itself did not induce liver tumor at 30 weeks, it strongly promoted liver tumors in those mice that were pretreated with a single dose of DEN (Supplementary Table S1). CA diet also increased the expression of tumor necrosis factor-
and interleukin-6 genes (Supplementary Fig. S1), suggesting that increased levels of bile acids are sufficient to induce the expression of proinflammatory cytokines. We also fed the FXR/ mice with a diet containing 2% cholestyramine, a bile acidsequestering resin, for 3 months starting at 11 months of age when the mice had no tumor. Compared with the standard diet, cholestyramine feeding significantly reduced the number and size of liver malignant lesions in aging FXR/ mice (Supplementary Table S2). All these experiments suggest that chronically higher levels of bile acids in FXR/ mice may contribute to the liver tumor formation as these animals age. However, other metabolic defects in addition to higher levels of bile acids may also play important roles for the overall liver tumorigenesis in FXR/ mice.
Liver cancer is one of the most common forms of cancers worldwide, and both genetic and environmental factors contribute to hepatocarcinogenesis (20). Our findings indicate that metabolic defects such as chronically higher levels of bile acids can promote liver tumor formation, thus suggesting an intriguing link between metabolic regulation and hepatocarcinogenesis.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Dr. Barry Forman and his laboratory members for their help. We also thank Dr. Jun Zhang for her initial assistance in this project. We appreciate Dr. Kristine Justus for her help in editing and proofreading.
| Footnotes |
|---|
F. Yang and X. Huang contributed equally to this work.
Received 3/22/06. Revised 9/18/06. Accepted 10/ 5/06.
| References |
|---|
|
|
|---|
B functions as a tumor promoter in inflammation-associated cancer. Nature 2004;431:4616.[CrossRef][Medline]This article has been cited by other articles:
![]() |
R. Kaimal, X. Song, B. Yan, R. King, and R. Deng Differential Modulation of Farnesoid X Receptor Signaling Pathway by the Thiazolidinediones J. Pharmacol. Exp. Ther., July 1, 2009; 330(1): 125 - 134. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Servitja, M. Pignatelli, M. A. Maestro, C. Cardalda, S. F. Boj, J. Lozano, E. Blanco, A. Lafuente, M. I. McCarthy, L. Sumoy, et al. Hnf1{alpha} (MODY3) Controls Tissue-Specific Transcriptional Programs and Exerts Opposed Effects on Cell Growth in Pancreatic Islets and Liver Mol. Cell. Biol., June 1, 2009; 29(11): 2945 - 2959. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R.M. Maran, A. Thomas, M. Roth, Z. Sheng, N. Esterly, D. Pinson, X. Gao, Y. Zhang, V. Ganapathy, F. J. Gonzalez, et al. Farnesoid X Receptor Deficiency in Mice Leads to Increased Intestinal Epithelial Cell Proliferation and Tumor Development J. Pharmacol. Exp. Ther., February 1, 2009; 328(2): 469 - 477. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Li, Y. Chen, W. He, T. Yi, D. Zhao, C. Zhang, C.-L. Lin, I. Todorov, F. Kandeel, S. Forman, et al. Anti-CD3 preconditioning separates GVL from GVHD via modulating host dendritic cell and donor T-cell migration in recipients conditioned with TBI Blood, January 22, 2009; 113(4): 953 - 962. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lefebvre, B. Cariou, F. Lien, F. Kuipers, and B. Staels Role of Bile Acids and Bile Acid Receptors in Metabolic Regulation Physiol Rev, January 1, 2009; 89(1): 147 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Modica, S. Murzilli, L. Salvatore, D. R. Schmidt, and A. Moschetta Nuclear Bile Acid Receptor FXR Protects against Intestinal Tumorigenesis Cancer Res., December 1, 2008; 68(23): 9589 - 9594. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Eloranta and G. A. Kullak-Ublick The Role of FXR in Disorders of Bile Acid Homeostasis Physiology, October 1, 2008; 23(5): 286 - 295. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yi, D. Zhao, C.-L. Lin, C. Zhang, Y. Chen, I. Todorov, T. LeBon, F. Kandeel, S. Forman, and D. Zeng Absence of donor Th17 leads to augmented Th1 differentiation and exacerbated acute graft-versus-host disease Blood, September 1, 2008; 112(5): 2101 - 2110. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-D. Wang, F. Yang, W.-D. Chen, X. Huang, L. Lai, B. M. Forman, and W. Huang Farnesoid X Receptor Protects Liver Cells from Apoptosis Induced by Serum Deprivation in Vitro and Fasting in Vivo Mol. Endocrinol., July 1, 2008; 22(7): 1622 - 1632. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wang and Y.-J. Y. Wan Nuclear Receptors and Inflammatory Diseases Experimental Biology and Medicine, May 1, 2008; 233(5): 496 - 506. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Rogers, E. J. Theve, Y. Feng, R. C. Fry, K. Taghizadeh, K. M. Clapp, C. Boussahmain, K. S. Cormier, and J. G. Fox Hepatocellular Carcinoma Associated with Liver-Gender Disruption in Male Mice Cancer Res., December 15, 2007; 67(24): 11536 - 11546. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kim, S.-H. Ahn, T. Inagaki, M. Choi, S. Ito, G. L. Guo, S. A. Kliewer, and F. J. Gonzalez Differential regulation of bile acid homeostasis by the farnesoid X receptor in liver and intestine J. Lipid Res., December 1, 2007; 48(12): 2664 - 2672. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |