Cancer Research SABCS Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Cancer Research 67, 1419, February 15, 2007. doi: 10.1158/0008-5472.CAN-06-4074
© 2007 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brueckner, B.
Right arrow Articles by Lyko, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brueckner, B.
Right arrow Articles by Lyko, F.

Priority Reports

The Human let-7a-3 Locus Contains an Epigenetically Regulated MicroRNA Gene with Oncogenic Function

Bodo Brueckner1, Carlo Stresemann1, Ruprecht Kuner2, Cora Mund1, Tanja Musch1, Michael Meister3, Holger Sültmann2 and Frank Lyko1

Divisions of 1 Epigenetics and 2 Molecular Genome Analysis, Deutsches Krebsforschungszentrum; 3 Sektion Translationale Forschung, Thoraxklinik am Universitätsklinikum Heidelberg, Heidelberg, Germany

Requests for reprints: Frank Lyko, Deutsches Krebsforschungszentrum, Im Neuenheimer Feld 580, 69120 Heidelberg, Germany. Phone: 49-6221-423800; Fax: 49-6221-423802; E-mail: f.lyko{at}dkfz.de.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 References
 
MicroRNAs (miRNAs) are small noncoding RNAs that repress their target mRNAs by complementary base pairing and induction of the RNA interference pathway. It has been shown that miRNA expression can be regulated by DNA methylation and it has been suggested that altered miRNA gene methylation might contribute to human tumorigenesis. In this study, we show that the human let-7a-3 gene on chromosome 22q13.31 is associated with a CpG island. Let-7a-3 belongs to the archetypal let-7 miRNA gene family and was found to be methylated by the DNA methyltransferases DNMT1 and DNMT3B. The gene was heavily methylated in normal human tissues but hypomethylated in some lung adenocarcinomas. Let-7a-3 hypomethylation facilitated epigenetic reactivation of the gene and elevated expression of let-7a-3 in a human lung cancer cell line resulted in enhanced tumor phenotypes and oncogenic changes in transcription profiles. Our results thus identify let-7a-3 as an epigenetically regulated miRNA gene with oncogenic function and suggest that aberrant miRNA gene methylation might contribute to the human cancer epigenome. [Cancer Res 2007;67(4):1419–23]


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 References
 
MicroRNAs (miRNAs) are small noncoding RNAs that repress their target mRNAs by complementary base pairing and induction of the RNA interference pathway (1). Several miRNAs have been shown to play specific roles in development and differentiation and, correspondingly, their expression patterns seem to be highly regulated. miRNA expression profiling has provided indications for aberrant expression patterns in human cancer cell lines and in primary cancers, which suggested that aberrant miRNA expression might contribute to tumorigenesis (2–4). Consistent with this notion, the expression pattern of 200 human miRNA genes can be of greater prognostic value than the expression pattern of 13,000 protein-encoding genes (3).

Human tumorigenesis is characterized by specific changes in genomic DNA methylation patterns. Compared with nonmalignant cells, tumor cells show hypermethylation or hypomethylation in CpG islands of genes that are functionally important for tumor development (5–7). Hypermethylation-induced gene silencing can be reverted by DNA methyltransferase inhibitors, such as 5-aza-2'-deoxycytidine (DAC). Treatment of cancer cells with these compounds followed by expression profiling has been used to systematically unmask tumor suppressor genes that are hypermethylated in human cancer cells (8, 9). Recently, Saito et al. (10) have used a similar approach to identify miRNA genes that are affected by DNA hypermethylation: combinatorial treatment of T24 bladder cancer cells with DAC and a second epigenetic drug, the histone deacetylase inhibitor 4-phenylbutyrate, caused >3-fold up-regulation in 17 of 313 miRNA genes analyzed. The strongest effects (49-fold up-regulation) were observed for miR-127 and the corresponding gene was found to be embedded in a CpG island. Epigenetic activation of miR-127 resulted in a detectable down-regulation of the BCL6 proto-oncogene, which suggested a tumor suppressor function for this miRNA (10). However, the miR-127 gene was found to be methylated in many human tissues and no methylation changes could be detected in the three primary human tumor samples that were analyzed in this study.

We have analyzed the methylation of the human let-7a-3 gene that belongs to the archetypal family of let-7 miRNA genes. We found that let-7a-3 methylation is prevalent in normal human tissues but can be lost in lung cancers. The characterization of the mechanisms mediating let-7a-3 methylation and the function of let-7a-3 expression in a human lung adenoma cell line suggests that epigenetic activation of let-7a-3 might contribute to human lung tumorigenesis.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 References
 
Cell culture and patient samples. HCT116 and HCT116 knockout cells (11) were cultured in McCoy's 5A medium supplemented with 10% FCS. A549 cells were cultured in DMEM supplemented with 10% FCS. For inhibitor treatment, cells were incubated for 72 h with 500 nmol/L 5-aza-2'-deoxycytidine (DAC; Calbiochem), and/or 1 mmol/L valproic acid (VPA; Merck). Patient DNA was prepared from fresh-frozen tissues after institutional review board approval. For all experiments, genomic DNA was prepared using the DNeasy kit (Qiagen).

DNA methylation analysis. Genomic DNA was deaminated with sodium bisulfite using standard procedures and let-7a-3 was amplified using nested primers as follows: let7a_out_for (GTTAGAATTAGGGTTTTTGGGGAGG) and let7a_out_rev (ACCTATCAAACTTCTCAATATAAAC), 95°C for 3 min, followed by 34 cycles (95°C for 30 s, 54°C for 45 s, and 72°C for 1 min), and 72°C for 4 min. Primers and PCR conditions for the second amplification were let7a_in_for (GGGAGGGATGTTTGTTTGTTTAGTG) and let7a_in_rev (AACTACCCCCAAACCTAACCCTACC), 95°C for 3 min, followed by 34 cycles (95°C for 30 s, 64°C for 30 s, and 72°C for 45 s), and 72°C for 4 min. The PCR product (723 bp) was gel purified and digested with BstUI (New England Biolabs). Digested PCR products were separated on agarose gels and visualized by ethidium bromide staining. For bisulfite sequencing, PCR products were gel extracted and cloned using the TOPO TA cloning kit (Invitrogen) according to the manufacturer's instructions.

Let-7a-3 expression analysis. Total RNA was isolated from cells using Trizol (Invitrogen) and cDNA was synthesized using the ThermoScript reverse transcription-PCR (RT-PCR) system (Invitrogen). Twenty microliters of PCRs contained 2 µL cDNA template, 1x ReddyMix buffer (Abgene), 1 µmol/L of each primer, 1 mmol/L deoxynucleotide triphosphates (Stratagene), and 1.5 units of Thermoprime polymerase (Abgene). The primers and PCR conditions for let-7a-3 cDNA amplification were let7a_RT2_for (CTCTGGAAGCCACGGAGTC) and let7a_RT2_rev (GTTCCAGACGCTCTGTCCAC), 95°C for 3 min, followed by 34 cycles (95°C for 30 s, 62°C for 30 s, and 72°C for 30 s), and 72°C for 3 min. Primers and PCR conditions for tissue inhibitor of metalloproteinase-3 and ß-amyloid have been described elsewhere (12). PCR amplicons were separated on agarose gels and visualized by ethidium bromide staining.

Establishment of stably transfected let-7a-3 cell lines. The precursor sequence encoding let-7a-3 was PCR amplified from human genomic DNA. A product of 179 bp was subcloned into the expression vector pZeoSV2– (Invitrogen) by using EcoRI and KpnI restriction sites contained in the PCR primers and verified by DNA sequencing. The primers and PCR conditions for let-7a-3 amplification were let-7a_forcl (ATGAATTCCTCTGGAAGCCACGGAGTC) and let7a_revcl (ATGGTACCGTTCCAGACGCTCTGTCCAC), 95°C for 3 min, followed by 34 cycles (95°C for 30 s, 62°C for 30 s, and 72°C for 30 s), and 72°C for 3 min.

Constructs were transfected into A549 cells using Fugene 6 transfection agent (Roche), according to the manufacturer's protocol. Cells were grown for 3 days in transfection medium and then selected in cell culture medium containing 200 µg/mL zeocin (Invitrogen).

Colony formation assays. Cells (2 x 105) in 1.5 mL medium supplemented with 0.3% agarose were layered on a 3-mL base of 0.5% agarose with medium. Soft agar assays were done in 60-mm dishes and in triplicate. After colonies became visible, cells were stained with 200 µL p-iodonitrotetrazolium violet solution (5 mg/mL).

Microarray experiments. Hybridizations were done on genome-wide cDNA microarrays. Gene expression analysis comprised four microarray hybridizations: four let-7a-3–transfected cell culture replicates and four parental cell culture replicates (controls). Each let-7a-3–expressing replicate was hybridized against a control replicate of the same cell line, including a dye swap design. One-round linear amplification of 2 µg total RNA was done using the Low RNA Input Fluorescent Linear Amplification kit (Agilent Technologies) according to the manufacturer's instructions. Hybridization and washing were done as described previously (13). Hybridized arrays were scanned with the GenePix 4000B microarray scanner (Axon Instruments), and analyzed using GenePix Pro 4.1. Microarray raw data processing was done using software ArrayMagic (14) and the data set was deposited to National Center for Biotechnology Information Gene Expression Omnibus (GEO) database4 by GEO series accession number GSE6474. We considered only genes that fulfilled the cutoff criteria of a P value ≤0.05 and a linear fold change ≥1.5. Functional annotation of the differentially expressed genes was done using the Gene Ontology software GOstat.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
Recently, 17 of 313 human miRNA genes were found to be up-regulated in T24 human bladder cancer cells that had been treated with the DNA methyltransferase inhibitor DAC and the histone deacetylase inhibitor 4-phenylbutyric acid (10). The observation that gene reactivation required a DNA methyltransferase inhibitor raised the possibility that a larger proportion of miRNA genes might be methylated in human cells. We noticed that the let-7a-3 gene on chromosome 22q13.31 is associated with a well-defined CpG island (200 bp length, 55% CG content, 0.65 observed/expected CG ratio; Fig. 1A ). We used bisulfite sequencing to analyze the methylation status of 33 CpG dinucleotides of the let-7a-3 CpG island in HCT116 cells and the results showed that the gene was densely (90%) methylated (Fig. 1B). The analysis of genomic DNA from isogenic DNA methyltransferase knockout cell lines (11) showed that methylation seemed unchanged in DNMT3B knockout cells (Fig. 1B, 3BKO). Let-7a-3 methylation seemed somewhat lower in DNMT1 knockout cells (Fig. 1B, 1KO) and the gene was almost completely demethylated in DNMT1;DNMT3B double knockout cells (Fig. 1B, DKO). This showed that let-7a-3 methylation is cooperatively maintained by the DNA methyltransferases DNMT1 and DNMT3B and suggests that miRNA genes are methylated by the same mechanisms that govern methylation of other genomic regions (11).


Figure 1
View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. Methylation of let-7a-3 is cooperatively maintained by DNMT1 and DNMT3B. A, let-7a-3 is embedded in a CpG island. The percentage of G+C over a 100-bp window. Vertical bars, position of individual CpG dinucleotides; black box, position of the let-7a-3 pri-miRNA; arrowheads, bisulfite PCR primers. B, bisulfite sequencing analysis of let-7a-3 methylation with genomic DNA from HCT116 cells and isogenic DNA methyltransferase knockout cell lines. {circ}, unmethylated CpG dinucleotides; bullet, methylated CpG dinucleotides. Percentages indicate the fraction of methylated CpG dinucleotides.

 
We then sought to further characterize the methylation pattern of let-7a-3 in human tissues by combined bisulfite restriction analysis (COBRA). COBRA detects DNA methylation by probing restriction enzyme sites in PCR amplicons from bisulfite-deaminated DNA. Methylated genes generate small restriction fragments, whereas unmethylated genes generate PCR fragments that cannot be cut by restriction enzymes. Let-7a-3 COBRA analysis of genomic DNA from normal placenta, brain, bone marrow, blood, colon, and skin samples revealed strong methylation of let-7a-3 in all tissues analyzed (Fig. 2A ). Because let-7 miRNAs have been linked to lung tumorigenesis (15–18), we also analyzed let-7a-3 methylation in a set of eight lung adenocarcinomas and eight matched nonneoplastic lung tissue samples from the same patients. The results indicated that let-7a-3 was methylated in all normal lung samples, with a methylation pattern similar to other human tissues (Fig. 2B). Patients A and D showed a clear difference between tumor and control tissue and the restriction pattern indicated strong hypomethylation in the tumor (Fig. 2B). This observation was confirmed by bisulfite sequencing of multiple independent clones, which showed almost complete let-7a-3 demethylation (2%) in a lung adenoma sample from patient D, whereas the locus was substantially methylated (55%) in normal lung tissue from the same patient (Fig. 2C). We therefore concluded that let-7a-3 is strongly methylated in normal human tissues and that the gene can be hypomethylated in lung tumors.


Figure 2
View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Let-7a-3 is methylated in normal human tissues and can be hypomethylated in lung cancer. A, COBRA analysis of let-7a-3 methylation in normal human tissues. B, COBRA analysis of let-7a-3 methylation in eight sample pairs from lung adenoma patients. N, samples from normal lung tissue; T, samples from tumors. C, bisulfite sequencing analysis of let-7a-3 in patient D. Percentages indicate the fraction of methylated CpG dinucleotides.

 
To analyze the role of DNA hypomethylation in the regulation of let-7a-3, we treated A549 lung adenocarcinoma and HCT116 cells with the DNA methyltransferase inhibitor DAC. COBRA analysis of let-7a-3 showed that drug treatment caused effective gene demethylation (Fig. 3A ). Bisulfite sequencing of multiple independent let-7a-3 clones also showed a decrease from 92% methylation in untreated control cells to 42% in DAC-treated cells (Fig. 3B). Combinatorial treatment with DAC and the histone deacetylase inhibitor VPA caused a significant up-regulation of let-7a-3 expression, whereas treatment with either DAC or VPA alone had little effect (Fig. 3C). These results agree with the observations made for the human miR-127 gene (10) and suggest that hypomethylation facilitates epigenetic reactivation of let-7a-3 expression.


Figure 3
View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Hypomethylation of let-7a-3 facilitates epigenetic reactivation. A, COBRA analysis of let-7a-3 methylation in A549 and HCT116 cells indicates effective demethylation following DAC treatment. B, bisulfite sequencing analysis of let-7a-3 methylation with genomic DNA from untreated and DAC-treated cells, respectively. {circ}, unmethylated CpG dinucleotides; bullet, methylated CpG dinucleotides. Percentages indicate the fraction of methylated CpG dinucleotides. C, epigenetic reactivation of let-7a-3 expression by combinatorial treatment with DAC and VPA. The results were derived from three independent experiments, and all values were normalized to the expression level of ß-amyloid in untreated HCT116 cells. Columns, relative let-7a-3 expression; bars, SD.

 
Having shown that let-7a-3 can be hypomethylated in human lung cancer and that hypomethylation can lead to epigenetic activation of the gene, we then sought to determine the consequences of let-7a-3 expression in a human lung cancer model. Let-7a-3 is strongly methylated and transcriptionally silenced in the A549 adenocarcinoma cell line (Fig. 4A ). To restore let-7a-3 expression, we stably transfected A549 cells with a construct that drives let-7a-3 pri-miRNA expression from a cytomegalovirus promoter (L7-A549). For controls, we also transfected A549 cells with the empty vector (Co-A549). Let-7a-3 expression was analyzed by semiquantitative RT-PCR in all transgenic cell lines and was found to be clearly increased in let-7a-3–transfected cells (Fig. 4A). To explore the functional consequences of let-7a-3 expression, we analyzed the anchorage-independent cell growth in soft agar assays. Staining and counting of colonies from several independent experiments showed an 11-fold increase in colony numbers for let-7a-3–expressing cells when compared with controls (Fig. 4B). These data provide a strong indication that let-7a-3 can have oncogenic functions in lung cancer cells.


Figure 4
View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. Increased let-7a-3 expression causes oncogenic changes in human cancer cells. A, semiquantitative RT-PCR analysis of let-7a-3 pri-miRNA expression in let-7a-3–transfected (L7) and empty vector-transfected (Co) A549 cells. B, colony numbers of control and let-7a-3–overexpressing (L7) A549 cells in soft agar assays. The results were derived from three independent experiments. Columns, colonies > 100 µm; bars, SD. C, gene expression profiling of L7-A549 and Co-A549 cells using cDNA microarrays. Hierarchical clustering of 197 differentially expressed genes in four replicates. D, let-7a-3–dependent deregulation in the expression of RAS-responsive genes. fc, fold changes in transcript levels in L7-A549 versus Co-A549 cells.

 
To further substantiate this observation, we obtained gene expression profiles from L7-A549 and Co-A549 cells. Hybridization of total RNA from both cell lines to cDNA microarrays revealed a substantial let-7a-3–associated transcriptional deregulation. Linear modeling of microarray data with cutoff values at P ≤ 0.05 and linear fold change ≥1.5 revealed that let-7a-3 expression caused deregulation of 197 genes (Fig. 4C; Supplementary Table S1). Gene ontology statistics revealed overrepresentation of genes involved in cell proliferation, adhesion, and differentiation (Supplementary Table S2). In agreement with a previous study showing a role of let-7 in the regulation of RAS (17), we found 19 RAS-responsive genes to be deregulated in L7-A549 cells (Fig. 4D). RAS mRNA levels were only weakly affected by let-7a-3 overexpression (data not shown), which is consistent with previous data, suggesting that let-7–dependent RAS regulation occurs at the translational level (17). We also identified several potentially oncogenic genes that were up-regulated by let-7a-3 expression in A549 cells and that have been described previously to be associated with lung cancer progression. These genes include CDK6, PCNA, PRDX1, and CXCL5. In addition, down-regulation was observed for several genes that have been described to inhibit lung cancer cell proliferation, such as PPARG, TGFB2, and SFRP1. In addition, genes that are functionally related to cell adhesion processes, a gene ontology category, which is relevant for tumor progression and metastasis formation, were predominantly down-regulated in our experiments (Supplementary Table S2). The gene expression profiles are therefore in agreement with the increased anchorage-independent growth of let-7a-3–expressing A549 cells and provide further confirmation for an oncogenic role of let-7a-3 in lung carcinogenesis.

Various reports have linked let-7 miRNAs to human cancers (15–18). These observations, combined with the fact that the human let-7a-3 gene was embedded in a well-defined CpG island, prompted us to analyze the methylation and the function of this gene in detail. It should be noted that the human let-7 family encompasses at least 12 genes with distinct and potentially diverse contributions to tumorigenesis and that only some of the previous studies have discriminated between individual human let-7 genes. This might explain why we have found a consistent oncogenic role of let-7a-3, whereas others have described tumor-suppressing activities for other let-7 miRNAs (15–18). An oncogenic function of let-7a-3 is also supported by our gene expression profiling results that indicate increased oncogenic characteristics following expression of let-7a-3 in A549 cells. Our microarray data support a role of let-7a-3 in the regulation of RAS signaling, as described by others (15–18). However, the observed effects were complex and not limited to down-regulation of RAS effector genes.

In agreement with an oncogenic function of let-7a-3 in a lung cancer model, we found let-7a-3 to be substantially hypomethylated in some lung cancer samples. To our knowledge, this finding represents the first example for an epigenetic mutation affecting a miRNA gene. Global hypomethylation of genomic DNA has been the first epigenetic change described in human cancers, and several oncogenes, including BCL-2 (19) and R-RAS (20), are hypomethylated in primary human tumors. More extensive studies will be required to comprehensively address the significance of aberrant miRNA gene methylation for human tumorigenesis.


   Acknowledgments
 
Grant support: German National Genome Research Network grant NGFN-2 (F. Lyko).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Andreas Buness and Markus Ruschhaupt for their help in the statistical analysis of microarray experiments; Bert Vogelstein for DNMT knockout cells; Heike Allgayer, Petra Boukamp, Amir Eden, and Thomas Muley for DNA samples; and the tissue bank of the Thoraxklinik Heidelberg for the lung tumor tissue.


   Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

4 http://www.ncbi.nlm.nih.gov/projects/geo/ Back

Received 11/ 3/06. Revised 12/15/06. Accepted 12/29/06.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Esquela-Kerscher A, Slack FJ. Oncomirs—microRNAs with a role in cancer. Nat Rev Cancer 2006;6:259–69.[CrossRef][Medline]
  2. Calin GA, Ferracin M, Cimmino A, et al. A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. N Engl J Med 2005;353:1793–801.[Abstract/Free Full Text]
  3. Lu J, Getz G, Miska EA, et al. MicroRNA expression profiles classify human cancers. Nature 2005;435:834–8.[CrossRef][Medline]
  4. Volinia S, Calin GA, Liu CG, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 2006;103:2257–61.[Abstract/Free Full Text]
  5. Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet 2002;3:415–28.[Medline]
  6. Ehrlich M. DNA methylation in cancer: too much, but also too little. Oncogene 2002;21:5400–13.[CrossRef][Medline]
  7. Esteller M. Relevance of DNA methylation in the management of cancer. Lancet Oncol 2003;4:351–8.[CrossRef][Medline]
  8. Yamashita K, Upadhyay S, Osada M, et al. Pharmacologic unmasking of epigenetically silenced tumor suppressor genes in esophageal squamous cell carcinoma. Cancer Cell 2002;2:485–95.[CrossRef][Medline]
  9. Suzuki H, Gabrielson E, Chen W, et al. A genomic screen for genes upregulated by demethylation and histone deacetylase inhibition in human colorectal cancer. Nat Genet 2002;31:141–9.[CrossRef][Medline]
  10. Saito Y, Liang G, Egger G, et al. Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. Cancer Cell 2006;9:435–43.[CrossRef][Medline]
  11. Rhee I, Bachman KE, Park BH, et al. DNMT1 and DNMT3b cooperate to silence genes in human cancer cells. Nature 2002;416:552–6.[CrossRef][Medline]
  12. Brueckner B, Boy RG, Siedlecki P, et al. Epigenetic reactivation of tumor suppressor genes by a novel small-molecule inhibitor of human DNA methyltransferases. Cancer Res 2005;65:6305–11.[Abstract/Free Full Text]
  13. Schneider J, Buness A, Huber W, et al. Systematic analysis of T7 RNA polymerase based in vitro linear RNA amplification for use in microarray experiments. BMC Genomics 2004;5:29.[CrossRef][Medline]
  14. Buness A, Huber W, Steiner K, Sultmann H, Poustka A. ArrayMagic: two-colour cDNA microarray quality control and preprocessing. Bioinformatics 2005;21:554–6.[Abstract/Free Full Text]
  15. Calin GA, Sevignani C, Dumitru CD, et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci U S A 2004;101:2999–3004.[Abstract/Free Full Text]
  16. Takamizawa J, Konishi H, Yanagisawa K, et al. Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res 2004;64:3753–6.[Abstract/Free Full Text]
  17. Johnson SM, Grosshans H, Shingara J, et al. RAS is regulated by the let-7 microRNA family. Cell 2005;120:635–47.[CrossRef][Medline]
  18. Yanaihara N, Caplen N, Bowman E, et al. Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 2006;9:189–98.[CrossRef][Medline]
  19. Hanada M, Delia D, Aiello A, Stadtmauer E, Reed JC. bcl-2 gene hypomethylation and high-level expression in B-cell chronic lymphocytic leukemia. Blood 1993;82:1820–8.[Abstract/Free Full Text]
  20. Nishigaki M, Aoyagi K, Danjoh I, et al. Discovery of aberrant expression of R-RAS by cancer-linked DNA hypomethylation in gastric cancer using microarrays. Cancer Res 2005;65:2115–24.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 RNAHome page
G. Sotiropoulou, G. Pampalakis, E. Lianidou, and Z. Mourelatos
Emerging roles of microRNAs as molecular switches in the integrated circuit of the cancer cell
RNA, August 1, 2009; 15(8): 1443 - 1461.
[Abstract] [Full Text] [PDF]

Home page
 JDRHome page
S.P. Barros and S. Offenbacher
Epigenetics: Connecting Environment and Genotype to Phenotype and Disease
Journal of Dental Research, May 1, 2009; 88(5): 400 - 408.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
J. Roman-Gomez, X. Agirre, A. Jimenez-Velasco, V. Arqueros, A. Vilas-Zornoza, P. Rodriguez-Otero, I. Martin-Subero, L. Garate, L. Cordeu, E. San Jose-Eneriz, et al.
Epigenetic Regulation of MicroRNAs in Acute Lymphoblastic Leukemia
J. Clin. Oncol., March 10, 2009; 27(8): 1316 - 1322.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
S. Watanabe, Y. Ueda, S.-i. Akaboshi, Y. Hino, Y. Sekita, and M. Nakao
HMGA2 Maintains Oncogenic RAS-Induced Epithelial-Mesenchymal Transition in Human Pancreatic Cancer Cells
Am. J. Pathol., March 1, 2009; 174(3): 854 - 868.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
Q. Jiang, Y. Wang, Y. Hao, L. Juan, M. Teng, X. Zhang, M. Li, G. Wang, and Y. Liu
miR2Disease: a manually curated database for microRNA deregulation in human disease
Nucleic Acids Res., January 1, 2009; 37(suppl_1): D98 - D104.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
N. Yang, S. Kaur, S. Volinia, J. Greshock, H. Lassus, K. Hasegawa, S. Liang, A. Leminen, S. Deng, L. Smith, et al.
MicroRNA Microarray Identifies Let-7i as a Novel Biomarker and Therapeutic Target in Human Epithelial Ovarian Cancer
Cancer Res., December 15, 2008; 68(24): 10307 - 10314.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
X. Agirre, A. Jimenez-Velasco, E. San Jose-Eneriz, L. Garate, E. Bandres, L. Cordeu, O. Aparicio, B. Saez, G. Navarro, A. Vilas-Zornoza, et al.
Down-Regulation of hsa-miR-10a in Chronic Myeloid Leukemia CD34+ Cells Increases USF2-Mediated Cell Growth
Mol. Cancer Res., December 1, 2008; 6(12): 1830 - 1840.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
J. L. Bearfoot, D. Y.H. Choong, K. L. Gorringe, and I. G. Campbell
Genetic Analysis of Cancer-Implicated MicroRNA in Ovarian Cancer
Clin. Cancer Res., November 15, 2008; 14(22): 7246 - 7250.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
S. Tokumaru, M. Suzuki, H. Yamada, M. Nagino, and T. Takahashi
let-7 regulates Dicer expression and constitutes a negative feedback loop
Carcinogenesis, November 1, 2008; 29(11): 2073 - 2077.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
R. Mudhasani, Z. Zhu, G. Hutvagner, C. M. Eischen, S. Lyle, L. L. Hall, J. B. Lawrence, A. N. Imbalzano, and S. N. Jones
Loss of miRNA biogenesis induces p19Arf-p53 signaling and senescence in primary cells
J. Cell Biol., October 22, 2008; 181(7): 1055 - 1063.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
M. Wu, N. Jolicoeur, Z. Li, L. Zhang, Y. Fortin, D. L'Abbe, Z. Yu, and S.-H. Shen
Genetic variations of microRNAs in human cancer and their effects on the expression of miRNAs
Carcinogenesis, September 1, 2008; 29(9): 1710 - 1716.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
F. Fazi and C. Nervi
MicroRNA: basic mechanisms and transcriptional regulatory networks for cell fate determination
Cardiovasc Res, September 1, 2008; 79(4): 553 - 561.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. Datta, H. Kutay, M. W. Nasser, G. J. Nuovo, B. Wang, S. Majumder, C.-G. Liu, S. Volinia, C. M. Croce, T. D. Schmittgen, et al.
Methylation Mediated Silencing of MicroRNA-1 Gene and Its Role in Hepatocellular Carcinogenesis
Cancer Res., July 1, 2008; 68(13): 5049 - 5058.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
K. Nie, M. Gomez, P. Landgraf, J.-F. Garcia, Y. Liu, L. H.C. Tan, A. Chadburn, T. Tuschl, D. M. Knowles, and W. Tam
MicroRNA-Mediated Down-Regulation of PRDM1/Blimp-1 in Hodgkin/Reed-Sternberg Cells: A Potential Pathogenetic Lesion in Hodgkin Lymphomas
Am. J. Pathol., July 1, 2008; 173(1): 242 - 252.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. Toyota, H. Suzuki, Y. Sasaki, R. Maruyama, K. Imai, Y. Shinomura, and T. Tokino
Epigenetic Silencing of MicroRNA-34b/c and B-Cell Translocation Gene 4 Is Associated with CpG Island Methylation in Colorectal Cancer
Cancer Res., June 1, 2008; 68(11): 4123 - 4132.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
M. Jongen-Lavrencic, S. M. Sun, M. K. Dijkstra, P. J. M. Valk, and B. Lowenberg
MicroRNA expression profiling in relation to the genetic heterogeneity of acute myeloid leukemia
Blood, May 15, 2008; 111(10): 5078 - 5085.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
B. Hackanson, K. L. Bennett, R. M. Brena, J. Jiang, R. Claus, S.-S. Chen, N. Blagitko-Dorfs, K. Maharry, S. P. Whitman, T. D. Schmittgen, et al.
Epigenetic Modification of CCAAT/Enhancer Binding Protein {alpha} Expression in Acute Myeloid Leukemia
Cancer Res., May 1, 2008; 68(9): 3142 - 3151.
[Abstract] [Full Text] [PDF]

Home page
 NEJMHome page
M. Esteller
Epigenetics in Cancer
N. Engl. J. Med., March 13, 2008; 358(11): 1148 - 1159.
[Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
I. Lee, S. S. Ajay, H. Chen, A. Maruyama, N. Wang, M. G. McInnis, and B. D. Athey
Discriminating single-base difference miRNA expressions using microarray Probe Design Guru (ProDeG)
Nucleic Acids Res., March 1, 2008; 36(5): e27 - e27.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
L. Lu, D. Katsaros, I. A. Rigault de la Longrais, O. Sochirca, and H. Yu
Hypermethylation of let-7a-3 in Epithelial Ovarian Cancer Is Associated with Low Insulin-like Growth Factor-II Expression and Favorable Prognosis
Cancer Res., November 1, 2007; 67(21): 10117 - 10122.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. V. Iorio, R. Visone, G. Di Leva, V. Donati, F. Petrocca, P. Casalini, C. Taccioli, S. Volinia, C.-G. Liu, H. Alder, et al.
MicroRNA Signatures in Human Ovarian Cancer
Cancer Res., September 15, 2007; 67(18): 8699 - 8707.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
C. D. Johnson, A. Esquela-Kerscher, G. Stefani, M. Byrom, K. Kelnar, D. Ovcharenko, M. Wilson, X. Wang, J. Shelton, J. Shingara, et al.
The let-7 MicroRNA Represses Cell Proliferation Pathways in Human Cells
Cancer Res., August 15, 2007; 67(16): 7713 - 7722.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
C. Blenkiron and E. A. Miska
miRNAs in cancer: approaches, aetiology, diagnostics and therapy
Hum. Mol. Genet., April 15, 2007; 16(R1): R106 - R113.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brueckner, B.
Right arrow Articles by Lyko, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brueckner, B.
Right arrow Articles by Lyko, F.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online