| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Priority Reports |
Divisions of 1 Epigenetics and 2 Molecular Genome Analysis, Deutsches Krebsforschungszentrum; 3 Sektion Translationale Forschung, Thoraxklinik am Universitätsklinikum Heidelberg, Heidelberg, Germany
Requests for reprints: Frank Lyko, Deutsches Krebsforschungszentrum, Im Neuenheimer Feld 580, 69120 Heidelberg, Germany. Phone: 49-6221-423800; Fax: 49-6221-423802; E-mail: f.lyko{at}dkfz.de.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Human tumorigenesis is characterized by specific changes in genomic DNA methylation patterns. Compared with nonmalignant cells, tumor cells show hypermethylation or hypomethylation in CpG islands of genes that are functionally important for tumor development (57). Hypermethylation-induced gene silencing can be reverted by DNA methyltransferase inhibitors, such as 5-aza-2'-deoxycytidine (DAC). Treatment of cancer cells with these compounds followed by expression profiling has been used to systematically unmask tumor suppressor genes that are hypermethylated in human cancer cells (8, 9). Recently, Saito et al. (10) have used a similar approach to identify miRNA genes that are affected by DNA hypermethylation: combinatorial treatment of T24 bladder cancer cells with DAC and a second epigenetic drug, the histone deacetylase inhibitor 4-phenylbutyrate, caused >3-fold up-regulation in 17 of 313 miRNA genes analyzed. The strongest effects (49-fold up-regulation) were observed for miR-127 and the corresponding gene was found to be embedded in a CpG island. Epigenetic activation of miR-127 resulted in a detectable down-regulation of the BCL6 proto-oncogene, which suggested a tumor suppressor function for this miRNA (10). However, the miR-127 gene was found to be methylated in many human tissues and no methylation changes could be detected in the three primary human tumor samples that were analyzed in this study.
We have analyzed the methylation of the human let-7a-3 gene that belongs to the archetypal family of let-7 miRNA genes. We found that let-7a-3 methylation is prevalent in normal human tissues but can be lost in lung cancers. The characterization of the mechanisms mediating let-7a-3 methylation and the function of let-7a-3 expression in a human lung adenoma cell line suggests that epigenetic activation of let-7a-3 might contribute to human lung tumorigenesis.
| Materials and Methods |
|---|
|
|
|---|
DNA methylation analysis. Genomic DNA was deaminated with sodium bisulfite using standard procedures and let-7a-3 was amplified using nested primers as follows: let7a_out_for (GTTAGAATTAGGGTTTTTGGGGAGG) and let7a_out_rev (ACCTATCAAACTTCTCAATATAAAC), 95°C for 3 min, followed by 34 cycles (95°C for 30 s, 54°C for 45 s, and 72°C for 1 min), and 72°C for 4 min. Primers and PCR conditions for the second amplification were let7a_in_for (GGGAGGGATGTTTGTTTGTTTAGTG) and let7a_in_rev (AACTACCCCCAAACCTAACCCTACC), 95°C for 3 min, followed by 34 cycles (95°C for 30 s, 64°C for 30 s, and 72°C for 45 s), and 72°C for 4 min. The PCR product (723 bp) was gel purified and digested with BstUI (New England Biolabs). Digested PCR products were separated on agarose gels and visualized by ethidium bromide staining. For bisulfite sequencing, PCR products were gel extracted and cloned using the TOPO TA cloning kit (Invitrogen) according to the manufacturer's instructions.
Let-7a-3 expression analysis. Total RNA was isolated from cells using Trizol (Invitrogen) and cDNA was synthesized using the ThermoScript reverse transcription-PCR (RT-PCR) system (Invitrogen). Twenty microliters of PCRs contained 2 µL cDNA template, 1x ReddyMix buffer (Abgene), 1 µmol/L of each primer, 1 mmol/L deoxynucleotide triphosphates (Stratagene), and 1.5 units of Thermoprime polymerase (Abgene). The primers and PCR conditions for let-7a-3 cDNA amplification were let7a_RT2_for (CTCTGGAAGCCACGGAGTC) and let7a_RT2_rev (GTTCCAGACGCTCTGTCCAC), 95°C for 3 min, followed by 34 cycles (95°C for 30 s, 62°C for 30 s, and 72°C for 30 s), and 72°C for 3 min. Primers and PCR conditions for tissue inhibitor of metalloproteinase-3 and ß-amyloid have been described elsewhere (12). PCR amplicons were separated on agarose gels and visualized by ethidium bromide staining.
Establishment of stably transfected let-7a-3 cell lines. The precursor sequence encoding let-7a-3 was PCR amplified from human genomic DNA. A product of 179 bp was subcloned into the expression vector pZeoSV2 (Invitrogen) by using EcoRI and KpnI restriction sites contained in the PCR primers and verified by DNA sequencing. The primers and PCR conditions for let-7a-3 amplification were let-7a_forcl (ATGAATTCCTCTGGAAGCCACGGAGTC) and let7a_revcl (ATGGTACCGTTCCAGACGCTCTGTCCAC), 95°C for 3 min, followed by 34 cycles (95°C for 30 s, 62°C for 30 s, and 72°C for 30 s), and 72°C for 3 min.
Constructs were transfected into A549 cells using Fugene 6 transfection agent (Roche), according to the manufacturer's protocol. Cells were grown for 3 days in transfection medium and then selected in cell culture medium containing 200 µg/mL zeocin (Invitrogen).
Colony formation assays. Cells (2 x 105) in 1.5 mL medium supplemented with 0.3% agarose were layered on a 3-mL base of 0.5% agarose with medium. Soft agar assays were done in 60-mm dishes and in triplicate. After colonies became visible, cells were stained with 200 µL p-iodonitrotetrazolium violet solution (5 mg/mL).
Microarray experiments. Hybridizations were done on genome-wide cDNA microarrays. Gene expression analysis comprised four microarray hybridizations: four let-7a-3transfected cell culture replicates and four parental cell culture replicates (controls). Each let-7a-3expressing replicate was hybridized against a control replicate of the same cell line, including a dye swap design. One-round linear amplification of 2 µg total RNA was done using the Low RNA Input Fluorescent Linear Amplification kit (Agilent Technologies) according to the manufacturer's instructions. Hybridization and washing were done as described previously (13). Hybridized arrays were scanned with the GenePix 4000B microarray scanner (Axon Instruments), and analyzed using GenePix Pro 4.1. Microarray raw data processing was done using software ArrayMagic (14) and the data set was deposited to National Center for Biotechnology Information Gene Expression Omnibus (GEO) database4 by GEO series accession number GSE6474. We considered only genes that fulfilled the cutoff criteria of a P value
0.05 and a linear fold change
1.5. Functional annotation of the differentially expressed genes was done using the Gene Ontology software GOstat.
| Results and Discussion |
|---|
|
|
|---|
|
|
|
|
0.05 and linear fold change
1.5 revealed that let-7a-3 expression caused deregulation of 197 genes (Fig. 4C; Supplementary Table S1). Gene ontology statistics revealed overrepresentation of genes involved in cell proliferation, adhesion, and differentiation (Supplementary Table S2). In agreement with a previous study showing a role of let-7 in the regulation of RAS (17), we found 19 RAS-responsive genes to be deregulated in L7-A549 cells (Fig. 4D). RAS mRNA levels were only weakly affected by let-7a-3 overexpression (data not shown), which is consistent with previous data, suggesting that let-7dependent RAS regulation occurs at the translational level (17). We also identified several potentially oncogenic genes that were up-regulated by let-7a-3 expression in A549 cells and that have been described previously to be associated with lung cancer progression. These genes include CDK6, PCNA, PRDX1, and CXCL5. In addition, down-regulation was observed for several genes that have been described to inhibit lung cancer cell proliferation, such as PPARG, TGFB2, and SFRP1. In addition, genes that are functionally related to cell adhesion processes, a gene ontology category, which is relevant for tumor progression and metastasis formation, were predominantly down-regulated in our experiments (Supplementary Table S2). The gene expression profiles are therefore in agreement with the increased anchorage-independent growth of let-7a-3expressing A549 cells and provide further confirmation for an oncogenic role of let-7a-3 in lung carcinogenesis. Various reports have linked let-7 miRNAs to human cancers (1518). These observations, combined with the fact that the human let-7a-3 gene was embedded in a well-defined CpG island, prompted us to analyze the methylation and the function of this gene in detail. It should be noted that the human let-7 family encompasses at least 12 genes with distinct and potentially diverse contributions to tumorigenesis and that only some of the previous studies have discriminated between individual human let-7 genes. This might explain why we have found a consistent oncogenic role of let-7a-3, whereas others have described tumor-suppressing activities for other let-7 miRNAs (1518). An oncogenic function of let-7a-3 is also supported by our gene expression profiling results that indicate increased oncogenic characteristics following expression of let-7a-3 in A549 cells. Our microarray data support a role of let-7a-3 in the regulation of RAS signaling, as described by others (1518). However, the observed effects were complex and not limited to down-regulation of RAS effector genes.
In agreement with an oncogenic function of let-7a-3 in a lung cancer model, we found let-7a-3 to be substantially hypomethylated in some lung cancer samples. To our knowledge, this finding represents the first example for an epigenetic mutation affecting a miRNA gene. Global hypomethylation of genomic DNA has been the first epigenetic change described in human cancers, and several oncogenes, including BCL-2 (19) and R-RAS (20), are hypomethylated in primary human tumors. More extensive studies will be required to comprehensively address the significance of aberrant miRNA gene methylation for human tumorigenesis.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Andreas Buness and Markus Ruschhaupt for their help in the statistical analysis of microarray experiments; Bert Vogelstein for DNMT knockout cells; Heike Allgayer, Petra Boukamp, Amir Eden, and Thomas Muley for DNA samples; and the tissue bank of the Thoraxklinik Heidelberg for the lung tumor tissue.
| Footnotes |
|---|
4 http://www.ncbi.nlm.nih.gov/projects/geo/ ![]()
Received 11/ 3/06. Revised 12/15/06. Accepted 12/29/06.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S.P. Barros and S. Offenbacher Epigenetics: Connecting Environment and Genotype to Phenotype and Disease Journal of Dental Research, May 1, 2009; 88(5): 400 - 408. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Roman-Gomez, X. Agirre, A. Jimenez-Velasco, V. Arqueros, A. Vilas-Zornoza, P. Rodriguez-Otero, I. Martin-Subero, L. Garate, L. Cordeu, E. San Jose-Eneriz, et al. Epigenetic Regulation of MicroRNAs in Acute Lymphoblastic Leukemia J. Clin. Oncol., March 10, 2009; 27(8): 1316 - 1322. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Watanabe, Y. Ueda, S.-i. Akaboshi, Y. Hino, Y. Sekita, and M. Nakao HMGA2 Maintains Oncogenic RAS-Induced Epithelial-Mesenchymal Transition in Human Pancreatic Cancer Cells Am. J. Pathol., March 1, 2009; 174(3): 854 - 868. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Jiang, Y. Wang, Y. Hao, L. Juan, M. Teng, X. Zhang, M. Li, G. Wang, and Y. Liu miR2Disease: a manually curated database for microRNA deregulation in human disease Nucleic Acids Res., January 1, 2009; 37(suppl_1): D98 - D104. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Yang, S. Kaur, S. Volinia, J. Greshock, H. Lassus, K. Hasegawa, S. Liang, A. Leminen, S. Deng, L. Smith, et al. MicroRNA Microarray Identifies Let-7i as a Novel Biomarker and Therapeutic Target in Human Epithelial Ovarian Cancer Cancer Res., December 15, 2008; 68(24): 10307 - 10314. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Agirre, A. Jimenez-Velasco, E. San Jose-Eneriz, L. Garate, E. Bandres, L. Cordeu, O. Aparicio, B. Saez, G. Navarro, A. Vilas-Zornoza, et al. Down-Regulation of hsa-miR-10a in Chronic Myeloid Leukemia CD34+ Cells Increases USF2-Mediated Cell Growth Mol. Cancer Res., December 1, 2008; 6(12): 1830 - 1840. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Bearfoot, D. Y.H. Choong, K. L. Gorringe, and I. G. Campbell Genetic Analysis of Cancer-Implicated MicroRNA in Ovarian Cancer Clin. Cancer Res., November 15, 2008; 14(22): 7246 - 7250. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tokumaru, M. Suzuki, H. Yamada, M. Nagino, and T. Takahashi let-7 regulates Dicer expression and constitutes a negative feedback loop Carcinogenesis, November 1, 2008; 29(11): 2073 - 2077. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mudhasani, Z. Zhu, G. Hutvagner, C. M. Eischen, S. Lyle, L. L. Hall, J. B. Lawrence, A. N. Imbalzano, and S. N. Jones Loss of miRNA biogenesis induces p19Arf-p53 signaling and senescence in primary cells J. Cell Biol., October 22, 2008; 181(7): 1055 - 1063. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wu, N. Jolicoeur, Z. Li, L. Zhang, Y. Fortin, D. L'Abbe, Z. Yu, and S.-H. Shen Genetic variations of microRNAs in human cancer and their effects on the expression of miRNAs Carcinogenesis, September 1, 2008; 29(9): 1710 - 1716. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fazi and C. Nervi MicroRNA: basic mechanisms and transcriptional regulatory networks for cell fate determination Cardiovasc Res, September 1, 2008; 79(4): 553 - 561. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Datta, H. Kutay, M. W. Nasser, G. J. Nuovo, B. Wang, S. Majumder, C.-G. Liu, S. Volinia, C. M. Croce, T. D. Schmittgen, et al. Methylation Mediated Silencing of MicroRNA-1 Gene and Its Role in Hepatocellular Carcinogenesis Cancer Res., July 1, 2008; 68(13): 5049 - 5058. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nie, M. Gomez, P. Landgraf, J.-F. Garcia, Y. Liu, L. H.C. Tan, A. Chadburn, T. Tuschl, D. M. Knowles, and W. Tam MicroRNA-Mediated Down-Regulation of PRDM1/Blimp-1 in Hodgkin/Reed-Sternberg Cells: A Potential Pathogenetic Lesion in Hodgkin Lymphomas Am. J. Pathol., July 1, 2008; 173(1): 242 - 252. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Toyota, H. Suzuki, Y. Sasaki, R. Maruyama, K. Imai, Y. Shinomura, and T. Tokino Epigenetic Silencing of MicroRNA-34b/c and B-Cell Translocation Gene 4 Is Associated with CpG Island Methylation in Colorectal Cancer Cancer Res., June 1, 2008; 68(11): 4123 - 4132. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jongen-Lavrencic, S. M. Sun, M. K. Dijkstra, P. J. M. Valk, and B. Lowenberg MicroRNA expression profiling in relation to the genetic heterogeneity of acute myeloid leukemia Blood, May 15, 2008; 111(10): 5078 - 5085. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Hackanson, K. L. Bennett, R. M. Brena, J. Jiang, R. Claus, S.-S. Chen, N. Blagitko-Dorfs, K. Maharry, S. P. Whitman, T. D. Schmittgen, et al. Epigenetic Modification of CCAAT/Enhancer Binding Protein {alpha} Expression in Acute Myeloid Leukemia Cancer Res., May 1, 2008; 68(9): 3142 - 3151. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Esteller Epigenetics in Cancer N. Engl. J. Med., March 13, 2008; 358(11): 1148 - 1159. [Full Text] [PDF] |
||||
![]() |
I. Lee, S. S. Ajay, H. Chen, A. Maruyama, N. Wang, M. G. McInnis, and B. D. Athey Discriminating single-base difference miRNA expressions using microarray Probe Design Guru (ProDeG) Nucleic Acids Res., March 1, 2008; 36(5): e27 - e27. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lu, D. Katsaros, I. A. Rigault de la Longrais, O. Sochirca, and H. Yu Hypermethylation of let-7a-3 in Epithelial Ovarian Cancer Is Associated with Low Insulin-like Growth Factor-II Expression and Favorable Prognosis Cancer Res., November 1, 2007; 67(21): 10117 - 10122. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Iorio, R. Visone, G. Di Leva, V. Donati, F. Petrocca, P. Casalini, C. Taccioli, S. Volinia, C.-G. Liu, H. Alder, et al. MicroRNA Signatures in Human Ovarian Cancer Cancer Res., September 15, 2007; 67(18): 8699 - 8707. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Johnson, A. Esquela-Kerscher, G. Stefani, M. Byrom, K. Kelnar, D. Ovcharenko, M. Wilson, X. Wang, J. Shelton, J. Shingara, et al. The let-7 MicroRNA Represses Cell Proliferation Pathways in Human Cells Cancer Res., August 15, 2007; 67(16): 7713 - 7722. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Blenkiron and E. A. Miska miRNAs in cancer: approaches, aetiology, diagnostics and therapy Hum. Mol. Genet., April 15, 2007; 16(R1): R106 - R113. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |