| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Immunology |
Departments of 1 Pathology, 2 Obstetrics and Gynecology, 3 Molecular Microbiology and Immunology, and 4 Oncology, and 5 Institute of Genetic Medicine, Johns Hopkins Medical Institutions, Baltimore, Maryland
Requests for reprints: T.-C. Wu, CRB II Room 309, Department of Pathology, Johns Hopkins Hospital, 1550 Orleans Street, Baltimore, MD 21231. Phone: 410-614-3899; Fax: 443-287-4295; E-mail: wutc{at}jhmi.edu.
| Abstract |
|---|
|
|
|---|
4ß1 integrin. Site-directed mutagenesis of VCAM-1 at amino acid residues required for interaction with
4ß1 integrin completely abolished the immune resistance conferred by VCAM-1 in vivo. Surface staining showed that most renal cell carcinomas (RCC) express VCAM-1, whereas an RCC that responded to vaccination was VCAM-1 negative. These data provide evidence that tumor expression of VCAM-1 represents a new mechanism of immune evasion and has important implications for the development of immunotherapy for human RCC. [Cancer Res 2007;67(4):183241] | Introduction |
|---|
|
|
|---|
Tumor escape from immune surveillance and attack has been studied for many years (4, 5). These studies have identified many distinct mechanisms. Loss of MHC and other components of the antigen presentation machinery has been found in many cancers (6, 7). Immunosuppressive factors such as transforming growth factor-ß, interleukin-10, and vascular endothelial growth factor have also been found in different cancers (810). Tumor-associated tolerance and abnormal expansion of regulatory T cells can also lead to immunosuppression (1114). In addition, the tumor microenvironment has been shown to be an impediment to antitumor immune responses (15). More recently, tumor expressions of B7-H1, indoleamine 2,3-dioxygenase enzyme, and galectin-1, as well as shedding of MIC-A and MIC-B, have been shown to affect proliferation, survival, or functioning of effector T cells (1619). Together, these studies have laid the foundation for understanding how tumors escape immune attack and how tumors interact with the immune system in general. They also show that tumor escape is a complex phenomenon involving multiple pathways.
In contrast to our growing understanding of tumor escape in natural, unmanipulated hosts, a related question, how immune resistance of tumors emerges in the face of immunotherapy, has not been systematically explored. To tackle this question, we generated a mouse model of tumor escape, consisting of a susceptible cancer cell line (P0) and a highly resistant variant (P3). We have used microarray analysis to identify the potential mechanism(s) used by the P3-resistant variant to escape immune control. These analyses revealed the ectopic expression of vascular cell adhesion molecule-1 (VCAM-1) as a novel mechanism of escape from T cellmediated antitumor immunity. Thus, this approach can help uncover additional tumor escape mechanisms and better our understanding of the complex interactions between tumors and the immune system.
| Materials and Methods |
|---|
|
|
|---|
4 antibody (clone R1-2) were also purchased from PharMingen. The staining of the various antibodies was done according to the vendor's manual. RNA sample preparation and microarray analysis. Total RNA was extracted from P0 and P3 cell lines cultured in 10-cm dishes using TRIzol (Invitrogen, Carlsbad, CA) and followed by a cleanup step using RNeasy Mini Kit (Qiagen, Valencia, CA). The RNA was processed at Johns Hopkins Microarray Core Facility for hybridization with Affymetrix GeneChip Mouse Genome 430 2.0 Array. The resulting data were normalized and analyzed, and the data were submitted to the Gene Expression Omnibus database of the National Center for Biotechnology Information (NCBI; accession number GSE2774).
Method of microarray data analysis. The RNA samples were analyzed with Affymetrix GeneChip Mouse Genome 430 2.0 arrays. To estimate the gene expression signals, image analysis was done for the CEL files of the chips using the statistical technique and package guanine-cytosine contentrobust multiarray analysis (20). The image processing includes a quantile normalization procedure to reduce the obscuring variations between gene chips, which might be introduced during the processes of sample preparation, manufacturing, fluorescence labeling, hybridization, or scanning (21). The normalized signal intensities were analyzed using parametric empirical Bayes method to estimate the posterior probabilities of differential expression of genes between P0 and P3 cell lines (22, 23). The criterion of the posterior probability, >0.5, which means the posterior probability is larger than random chance, was used to obtain a list of differentially expressed genes. Fold changes of the differentially expressed genes were calculated using geometric means of the signal intensities of P0 and P3 cell lines, which have been shown to perform better than the arithmetic means of the expression signals in terms of identifying differentially expressed genes.
Semiquantitative and quantitative real-time reverse transcription-PCR. Semiquantitative reverse transcription (RT)-PCR was done using Superscript One-Step RT-PCR system (Invitrogen). Primers for cloning mouse VCAM-1 were used (see below). The sequence for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers are GAPDH(F) (atggtgaaggtcggtgtgaacggatttggc) and GAPDH(R) (catcgaaggtggaagagtgggagttgctgt). For quantitative measurement of VCAM-1 transcript, real-time RT-PCR was done using TaqMan One-Step RT-PCR Master Mix Reagents Kit and an ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA). The primers are 5-VCAM-1(94) (gaatacaaaacgattgctcaaatcg); 3-VCAM-1(219) (cgtcctcaccttcgcgttta); and TaqMan probe (6FAM-ccatggccctcacttgcagcact-TAMRA; Applied Biosystems). All primers were designed using Primer Express 1.0 (Applied Biosystems). For endogenous control, eukaryotic 18S rRNA (VIC/TAMRA probe) was used (Applied Biosystems). The relative standard curve method was used to calculate the level of gene expression for VCAM-1 transcript.
Retroviral transfer. Full-length isoform of mouse VCAM-1 cDNA was amplified from total RNA of P3 cell line using Superscript One-Step RT-PCR system (Invitrogen) and 5Xho1-VCAM-1 primer (gaactcgagatgcctgtgaagatggtcgcg) and 3EcoR1-VCAM-1 primer (ggggaattcctacactttggatttctgtgc). The resulting fragment was cloned into a pMSCVpuro retroviral vector (Clontech, Mountain View, CA) and verified by sequencing. The construct was transfected into Phoenix packaging cell line, and the virion-containing supernatant was collected 48 h after transfection. The supernatant was immediately clarified using a 0.45-µm cellulose acetate syringe filter (Nalgene, Rochester, NY) and used to infect target cells (P0) in the presence of 8 µg/mL Polybrene (Sigma, St. Louis, MO). One day after retroviral transduction, the virus supernatant was replaced with normal culture medium, and when the cells reached 70% confluency, puromycin (7.5 µg/mL) was used to select for cells with integrated pMSCV-VCAM-1. Gene expression level of VCAM-1 was verified by staining the cells with anti-VCAM-1 antibody (PharMingen) and analyzing by flow cytometry.
Site-directed mutagenesis of VCAM-1. Substitution mutants of VCAM-1 were generated by amplifying VCAM-1 cDNA in two fragments, a 5' fragment and a 3' fragment, which share an overlapping region of 43 bp and include the aspartate residue to be substituted with alanine. For VCAM-1-D40A, the 5' fragment was amplified with 5Xho1-VCAM-1 primer (see above) and R-VCAM-1-D40A (accttcgcgtttagtgggctagctatctgggttctccatgaga), and the 3' fragment was amplified with 3EcoR1-VCAM-1 primer (see above) and F-VCAM-1-D40A (tctcatggagaa cccagatagctagcccactaaacgcgaaggt). The 5' and 3' fragments are mixed and used as the template for PCR and amplified again using 5Xho1-VCAM-1 primer and 3EcoR1-VCAM-1 primer. The resulting fragment was then cloned into pMSCVpuro. VCAM-1-D328A mutant cDNA was generated in the same way. To generate the 5' and 3' fragments, the following primers are used: F-VCAM-1-D328A (tttcttggagaacccagacagctagccccctcaatggggtggtaag) and R-VCAM-1-D328A (cttaccaccccattgagggggctagctgtctgggttctccaagaaa). The resulting mutant VCAM-1 cDNA was verified by sequencing.
In vivo tumor growth experiments. C57BL/6 mice (68 weeks old) were purchased from the National Cancer Institute (Federick, MD). For the mouse experiments, five C57BL/6 mice per group are used unless stated otherwise. To induce anti-E7specific immune response, mice are vaccinated with vaccinia virus Sig/E7/LAMP-1 at 1 x 107 plaque-forming unit (pfu) per mouse. One week after the vaccination, mice are s.c. challenged with 1 x l05 tumor cells per mouse in the right hind leg. Mice are monitored for tumor growth by palpation and inspection twice a week until they were sacrificed. Sizes of the tumors were determined by explanting the tumors from mice 28 to 30 days after tumor cell injection and measuring the weight using a scale. Immunodeficient RAG1 knock-out mice (B6.129S7-Rag1tm1Mom) were purchased from the Jackson Laboratory (Bar Harbor, ME).
Apoptotic assays. Terminal nucleotidyl transferasemediated nick end labeling (TUNEL) assay was done on frozen sections of P0-NoInsert and P0-VCAM-1 tumors using In Situ Cell Death Detection Kit, AP (Roche, Indianapolis, IN). Tumors were isolated from mice 10 days after inoculation and snap-frozen in Tissue-Tek O.C.T. compound immediately (Sakura Finetek, Torrence, CA). Tissue sectioning was done by the Reference Histology Laboratory of Johns Hopkins Medical Laboratories. The assay was done according to the manufacturer's instruction. DNA fragmentation was detected by the incorporation of fluorescein-linked nucleotide and subsequent binding with an anti-fluorescein antibody conjugated to alkaline phosphatase. TUNEL-positive cells were visualized by incubation of the substrate nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (Sigma), followed by counterstaining with Nuclear Fast Red (Vector Laboratories, Burlingame, CA).
Preparation of single cell suspensions from tumors for analysis of infiltrating CD8+, CD4+ T cells and natural killer cells. The P0-NoInsert, P0-VCAM-1, P0-VCAM-1/D40A, and P0-VCAM-1/D328A tumors were isolated from C57 BL/6 mice (five per group) between days 7 and 11, and single cell suspensions were prepared using one of the following two methods. In the first, more rapid method, single cell suspensions were prepared by first immersing the tumors in PBS buffer and mashing the tumors against cell strainers using syringe plungers. Cells that passed through the cell strainers were collected, washed with fluorescence-activated cell sorting (FACS) buffer and used for FACS staining. Alternatively, in the slower, more gentle method, tumors were isolated from mice and immersed in 1x HBSS containing collagenase I (0.05 mg/mL), collagenase IV (0.05 mg/mL), and hyaluronidase (0.025 mg/mL; Sigma). The tumors were minced into very small pieces with surgical blades and incubated with the enzymes in a 37°C incubator with 5% CO2 for 15 min. After 15 min, an additional 1x HBSS with the enzymes was added, and the tumors were minced and incubated again. After the second incubation, the single cell suspension was filtered through cell strainers, washed with FACS buffer, and used for FACS staining.
In vitro migration assay. A modified Boyden chamber assay was used to study the migration of freshly isolated tumor-infiltrating cluster of differentiation 8+ (CD8+) T cells as previously described. Transwell polycarbonate membranes with 3-µm pores (Costar, Corning, Acton, MA) were coated with recombinant VCAM-1-Fc or human immunoglobulin G1 (IgG1)-Fc (R&D Systems) in PBS overnight at 4°C, followed by blocking with PBS containing 2% bovine serum albumin for 30 min at room temperature. Isolated CD8+ T cells (5 x 104 cells per well) were resuspended in T cell medium and placed in the upper chamber, which is the same chamber coated with VCAM-1-Fc or human IgG1-Fc. About 600 µL of T cell medium containing 25 ng/mL SDF-1a (R&D Systems) was placed in the lower chamber. After 4 h of incubation, cells in the lower chamber were collected and counted using a flow cytometer.
Generation of luciferase-expressing E7-specific CD8+ T cells. An E7-specific CD8+ T cell line has been previously described (24). To generate a luciferase-expressing E7-specific CD8+ T cell line, we first created a retrovirus containing luciferase (pLuci-thy1.1 construct), which expressed both luciferase and thy1.1. Firefly luciferase was amplified by PCR from pGL3-basic (Promega, Madison, WI) using the 5' primer CGGAGATCTATGGAAGACGCCAAAAAC and the 3' primer CGGGTTAACTTACACGGCGATCTTTCC. The amplified luciferase cDNA was inserted into the BglII and HpaI sites of the bicistronic vector pMIG-thy1.1. Both luciferase and thy1.1 cDNA are under the control of a single promoter element and separated by an internal ribosomal entry site. The pLuci-thy1.1 was transfected into a Phoenix packaging cell line, and the virion-containing supernatant was collected 48 h after transfection. The E7-specific CD8+ T cells expressing luciferase were isolated using preparative flow cytometry of stained cells with Thy1.1 antibody (BD, Franklin Lakes, NJ).
In vivo bioluminescence imaging. Each C57BL/6 mouse (five per group) was s.c. challenged with P0-VCAM-1 tumor cells at a dose of 5 x 105 per mouse in the right hind leg and with either P0 tumor cells or P0-VCAM-1 D40A tumor cells at a dose of 5 x 105 per mouse in the left hind leg. Tumor growth was monitored by visual inspection and palpation for a week. One week later, tumor-bearing mice were injected with luciferase-expressing E7-specific CD8+ T cells (5 x 106 per mouse) by tail vein. The intensity of luminescence in the T cellchallenged mice was monitored on days 0, 1, 3, and 7 after transfer of the T cells. Tumor-bearing mice, which did not receive challenge with E7-specific CD8+ T cells, were used as a negative control. To monitor the intensity of luminescence, the mice were injected with 0.2 mL of 15 mg/mL beetle luciferin (potassium salt; Promega). After 10 min, the mice were imaged using the IVIS 200 system (Xenogen Corp., Alameda, CA). An integration time of 5 min was used for luminescence image acquisition.
Statistical analysis. All data expressed as means ± SE are representative of at least two different experiments. Data for intracellular cytokine staining with flow cytometry analysis and tumor treatment experiments were evaluated by ANOVA. Comparisons between individual data points were made using the Student's t test. In the in vivo tumor growth experiment, the principal outcome of interest was time to tumor development. The event time distributions for different mice were compared using the method of Kaplan and Meier and the log-rank statistic. P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
We took advantage of this observation and explanted an outgrowth tumor from an immunized mouse and expanded it in vitro. This escape variant cell line was designated P1 and injected into a new group of mice immunized with vaccinia Sig/E7/LAMP-1. Again, one of the outgrowth tumors from immunized mice was explanted and expanded in vitro. This cell line was designated P2. These repeated injections with tumor cell lines allowed us to carry out in vivo immune selection and resulted in increasingly aggressive immunization-resistant cell lines (Fig. 1A ). After three rounds of selection, we obtained P3, which was completely resistant to the vaccinia-induced immune response. We compared the growth kinetics of P0 and P3 in naïve mice and found that both cell lines grew with similar kinetics (Fig. 1B). However, when these cell lines were injected into mice immunized with vaccinia Sig/E7/LAMP-1, P3 was able to develop into a palpable mass in all of the mice within 7 days, whereas P0 only developed in two out of five mice after several weeks (Fig. 1C). P0 and P3 cell lines therefore represent a useful in vivo model for identifying genes that can contribute to tumor escape from immune attack.
|
(27). To look for additional mechanisms underlying the immune resistance in P3, we compared gene expression profiles of the P0 and P3 cell lines using Affymetrix GeneChip Mouse Genome 430 2.0 arrays (NCBI accession number GSE2774). Analysis of microarray data showed that one of the most highly up-regulated genes in P3 was VCAM-1 (see Fig. 1D). We confirmed the differential expression of VCAM-1 in P3 using semiquantitative and quantitative RT-PCR (Fig. 2A and B
). This differential expression was also seen at the protein level (Fig. 2C). Next, we cloned full-length mouse VCAM-1 cDNA into the pMSCVpuro retroviral vector, and the virus was used to generate the P0-VCAM-1 cell line. P0 tumor cells transfected with pMSCVpuro vector without insert (P0-NoInsert) were used as negative controls. The expression of VCAM-1 on P0-VCAM-1 was confirmed by surface staining (Fig. 2D). It should be noted that the expression level of VCAM-1 on P0-VCAM-1 is comparable to that of the P3 cell line. These lines provided the opportunity to assess the role of VCAM-1 in tumor immune evasion independent of any other genetic or epigenetic changes in P3.
|
|
|
VCAM-1 can promote migration of CD8+ T cells in vitro. Previous studies have shown that binding of VCAM-1 to
4ß1 integrin (VLA-4) can promote the migration of CD8+ T cells (for review, see ref. 32). We characterized the
4ß1 integrin expression in tumor infiltrating lymphocytes (TIL) and in splenocytes derived from P0 tumors. We found that CD8+ TILs exhibit higher expression of
4ß1 integrin as compared with CD8+ T cells in the spleen (see Supplementary Fig. S1). Thus, to test if the presence of VCAM-1 can influence the migration of infiltrating CD8+ T cells, we did in vitro transwell migration assays. CD8+ T cells isolated from the tumors were put in the upper chamber, which was coated with recombinant VCAM-1-Fc or human IgG-Fc. We found that the T cells put in the upper chamber coated with VCAM-1-Fc showed an increased ability to migrate toward SDF-1a compared with the T cells put in the upper chamber coated with IgG-Fc (Fig. 4D, left). In addition, we showed that this migration is dependent on
4 integrin because the addition of an
4 integrin-blocking antibody (PS/2) led to a significant inhibition of migration (Fig. 4D, right). Thus, these in vitro studies suggest that tumor expression of VCAM-1 may modulate the motility of infiltrating CD8 T cells.
Mutation of
4ß1 integrin-binding sites on VCAM-1 completely abolishes the immune resistance conferred by VCAM-1 in vivo. VCAM-1 has been shown to bind to its receptor VLA-4 (
4ß1 integrin) through two independent binding sites in immunoglobulin domains 1 and 4 of its extracellular portion (3335). To better understand how VCAM-1 promotes immune resistance through interaction with VLA-4 in vivo, we generated two VCAM-1 mutants by modifying the key binding sites in domain 1 or domain 4. Both domains 1 and 4 contain a highly conserved integrin-binding motif (IDSPL; ref. 34). We mutated the aspartate residue in each binding site to alanine, generating two constructs called VCAM-1/D40A and VCAM-1/D328A (Fig. 5A
). These constructs were used to transfect P0 tumor cells to generate two cell lines, P0-VCAM-1/D40A and P0-VCAM-1/D328A. The expression of these VCAM-1 mutants was verified by surface staining and was comparable to the expression level of P0-VCAM-1 (Fig. 5B). Next, we injected these cell lines into naïve and immunized mice. The growth behavior of P0-VCAM-1/D40A and P0-VCAM-1/D328A was indistinguishable from that of P0-NoInsert, demonstrating that either single mutation can completely abolish the resistance conferred by VCAM-1 in vivo (Fig. 5C). These in vivo experiments showed that the immune resistance provided by VCAM-1 requires its interaction with its receptor,
4ß1 integrin.
|
4ß1 integrin can significantly influence the number of infiltrating CD8+ T cells in tumors.
|
4ß1 integrin, are crucial in reducing the number of E7-specific CD8+ T cells within the tumor. Down-regulation of VCAM-1 in P3 tumors leads to reduced tumor immune evasion. To determine whether the down-regulation of VCAM-1 in the P3 tumors leads to reduced tumor immune evasion, we generated lentivirus encoding small interfering RNA (siRNA) targeting VCAM-1. To confirm that the P3 tumor transduced with the lentivirus leads to down-regulation of VCAM-1, we did flow cytometry analysis using VCAM-1specific antibody. We found that P3 tumors transduced with lentivirus encoding siRNA targeting VCAM-1(P3-VCAM-1 RNAi) resulted in almost undetectable levels of VCAM-1, similar to the level of VCAM-1 in P0 tumors. In comparison, P3 tumors transduced with the empty vector (P3-empty vector) did not lead to a decrease of VCAM-1 levels (similar to the parental P3 tumors; see Supplementary Fig. S2A). To determine the influence of down-regulation of VCAM-1 on tumor immune evasion of the P3 tumors, we characterized the tumor growth of the P3-VCAM RNAi, P3-empty vector, P3, and P0 tumors in mice vaccinated with 1 x 107 pfu/mouse of Sig/E7/LAMP-1 vaccinia and measured the tumor volume over time. We found that there was a significant decrease in tumor volume in the P3-VCAM-1 RNAi compared with P3-empty vector tumors 2 weeks after tumor challenge (see Supplementary Fig. S2B). However, the down-regulation of VCAM-1 did not completely abolish the tumor immune evasion phenotype of P3 tumors (see Supplementary Fig. S2B). Thus, our data suggest that VCAM-1 is an important factor involved in tumor immune evasion, but other factors may also contribute to the tumor immune evasion in the P3 tumor.
Human renal cell carcinoma cell lines express VCAM-1. We also found that many human renal cell carcinoma (RCC) cell lines express VCAM-1. We searched for human cancers with overexpression of VCAM-1 using the Oncomine 2.0 Cancer Microarray Database (36, 37). Analysis of this database showed that most human cancers do not up-regulate VCAM-1. However, human RCC was highly positive for VCAM-1 expression in comparison with other cancers or normal renal tissues. Surface staining of several human RCC cell lines showed that most indeed stained positive for VCAM-1 (see Supplementary Fig. S3). Interestingly, we found that the only cell line (RCC1.24 B7) that stained negative for VCAM-1 was derived from the only patient from a previous clinical trial (38) who responded to an irradiated granulocyte macrophage colony-stimulating factor (GM-CSF)secreting RCC tumor vaccine. These findings suggest that at least a subset of human RCC express VCAM-1, and that the expression of VCAM-1 may serve as an indicator for the outcome of immunotherapy.
| Discussion |
|---|
|
|
|---|
VCAM-1 is known be to expressed by many different cell types, including activated endothelial cells, bone marrow stromal cells, spleen stromal cells, thymic epithelial cells, and some dendritic cells in the spleen (3943). Among these cells, VCAM-1 is well recognized for its up-regulated expression in activated endothelium, where it facilitates the trafficking of leukocytes through the endothelium and into inflamed, infected tissues (32). In this context, our findings are unexpected because they show that a proinflammatory integrin ligand such as VCAM-1 can dramatically impair antitumor immune responses when it is expressed by tumor cells.
Although VCAM-1 expression by human RCC have been reported previously, our finding was particularly intriguing because the only RCC cell line (RCC1.24 B7) that stained negative for VCAM-1 turned out to be derived from the only patient who responded to a GM-CSF vaccine from our clinical trial (44). Because the RCC cell lines came from a pilot clinical trial, additional large-scale studies are required to confirm that VCAM-1 expression by human RCC can adversely affect an antitumor immune response.
One likely explanation for VCAM-1mediated immune resistance is that VCAM-1 can promote T cell migration, thereby minimizing the contact between T cells and the tumor cells. The ability of VCAM-1 to promote the migration of CD8+ T cells is well documented (4548). Several studies have shown that
4 integrin possesses the unique property of opposing cellular spreading and focal adhesion formation while promoting cells for migration (4850). More specifically, it has been shown that binding of VCAM-1 to
4 integrin leads to the specific association of the cytoplasmic tail of
4 integrin to paxillin, a signaling adaptor protein. This association leads to phosphorylation of paxillin, which can then phosphorylate and activate focal adhesion kinase (FAK; ref. 49). In turn, FAK can interact with Src kinases and regulate the disassembly of focal adhesions and integrin-dependent cell migration. In addition, binding of
4ß1 integrin to VCAM-1 can also stimulate T cell migration mediated by LFA-1 (
Lß2 integrin; ref. 45).
Consistent with these previous reports, our data showed that there is a significant decrease in the number of CD8+ T cells in P0-VCAM-1 tumors compared with P0-NoInsert tumors. Furthermore, our in vitro transwell studies showed that VCAM-1 can promote the migration of freshly isolated tumor-infiltrating CD8+ T cells, and that this VCAM-1mediated migration is diminished in the presence of an
4 integrin blocking antibody. To eliminate the concern that tumor cells also express VLA-4, which may influence the interpretation of the data, we characterized the expression of VLA-4 in the P0, P3, P0-NoInsert, and P0-VCAM-1 tumors. We found no detectable expression of VLA-4 in the tumors (data not shown). Because all the tumor cells do not express VLA-4, we do not expect significant difference in cell-cell adhesion among the different tumor cells. Nevertheless, we examined the cell-cell adhesion using the three-dimensional collagen cell culture system (Chemicon-Millipore, Billerica, MA) with Madin-Darby canine kidney cells as the positive control. We observed no significant difference in cell adhesion between the P0-NoInsert and P0-VCAM-1 tumor cells (data not shown).
Furthermore, to avoid the concern that tumor cells are able to express chemotactic factors such as SDF-1, which could potentially influence the number of CD8+ T cells in the tumor, we examined the chemokine profile between P0 and P3 tumors. We found similar expression of SDF1 in P0 and P3 tumors (data not shown). Furthermore, to ensure that the observed results are not due to migration defects of CD8+ T cells derived from the P0-VCAM-1 tumors or the P0-NoInsert tumors, we compared the migration of CD8+ T cells isolated from P0-VCAM-1 and P0-NoInsert tumors using in vitro transwell experiments with SDF-1a. We observed no significant difference in the chemotaxis of the CD8+ T cells derived from the tumors (data not shown). Taken together, these findings suggest that tumor expression of VCAM-1 might promote T cell migration away from tumors, resulting in decreased accumulation of T cells inside the tumors. The decreased accumulation of T cells around tumor cells might contribute to the ability of P0-VCAM-1 tumor cells to escape immune attack.
The mouse experiments using site-specific VCAM-1 mutants provided additional evidence that integrin receptors play a role in the immune resistance provided by VCAM-1. The specific aspartate residues, D40 and D328, have been shown to be required for VCAM-1 interaction with its integrin receptors
4ß1 (34). Our data showed that substitution of either aspartate residue with alanine completely abolished the immune resistance conferred by VCAM-1 in vivo. These findings strongly suggest that the immune resistance mediated by VCAM-1 requires its interaction with its integrin receptors, such as
4ß1.
This work represents the first report demonstrating that dysregulation of a cell adhesion molecule by tumor cells can interfere with immune functions. Because a wide variety of cell adhesion molecules are known to be dysregulated in cancers, this study raises the question of whether dysregulation of other cell adhesion molecules can also play a role in tumor escape from immune attack (51). Lastly, this study shows the usefulness of using in vivo immune selection to study tumor escape. Similar approaches can be taken to generate highly resistant variants from other murine cancer cell lines. Characterization of these resistant variants may lead to identification of additional tumor escape mechanisms.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Steve Desiderio, Mark Soloski, and Paula Pitha-Rowe for helpful discussions.
| Footnotes |
|---|
K. Lin is a recipient of the Howard Hughes Predoctoral Fellowship.
Received 8/14/06. Revised 12/14/06. Accepted 12/19/06.
| References |
|---|
|
|
|---|
are important for control of tumor with downregulated MHC class I expression by DNA vaccination. Gene Ther 2003;10:131120.[CrossRef][Medline]
4 ß1 defines a unique stage of human thymocyte development. J Exp Med 1994;179:157384.
4ß1. J Cell Biol 1994;125:1395406.
-irradiated mice. Blood 1996;87:7382.
4ß1 (VLA4) integrin in T-cell development. Blood 1997;89:246171.
4 integrin subunit stimulates LFA-1 (integrin
Lß2)-dependent T cell migration by augmenting the activation of focal adhesion kinase/proline-rich tyrosine kinase-2. J Immunol 2003;170:59128.
4 ß1-dependent T cell migration requires both phosphorylation and dephosphorylation of the
4 cytoplasmic domain to regulate the reversible binding of paxillin. J Biol Chem 2003;278:3484553.
(4)ß(1) governs lymphocyte migration. J Immunol 2001;167:282430.
4 integrins and the immune response. Immunol Rev 2002;186:11824.[CrossRef][Medline]
4 integrins modifies integrin-dependent biological responses. Nature 1999;402:67681.[CrossRef][Medline]
4 cytoplasmic domain. Mol Biol Cell 1995;6:66174.[Abstract]This article has been cited by other articles:
![]() |
R. Riesenberg, C. Weiler, O. Spring, M. Eder, A. Buchner, T. Popp, M. Castro, R. Kammerer, O. Takikawa, R. A. Hatz, et al. Expression of Indoleamine 2,3-Dioxygenase in Tumor Endothelial Cells Correlates with Long-term Survival of Patients with Renal Cell Carcinoma Clin. Cancer Res., December 1, 2007; 13(23): 6993 - 7002. [Abstract] [Full Text] [PDF] |
||||
![]() |
T-C. Wu The Role of Vascular Cell Adhesion Molecule-1 in Tumor Immune Evasion Cancer Res., July 1, 2007; 67(13): 6003 - 6006. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||