Cancer Research Annual Meeting 2010 Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Cancer Research 67, 1910, March 1, 2007. doi: 10.1158/0008-5472.CAN-06-1476
© 2007 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liang, L.
Right arrow Articles by Tischfield, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liang, L.
Right arrow Articles by Tischfield, J. A.

Molecular Biology, Pathobiology, and Genetics

Reduced Apoptosis and Increased Deletion Mutations at Aprt Locus In vivo in Mice Exposed to Repeated Ionizing Radiation

Li Liang1, Marc S. Mendonca2, Li Deng1, Son C. Nguyen1, Changshun Shao1 and Jay A. Tischfield1

1 Department of Genetics, Rutgers University, Piscataway, New Jersey and 2 Department of Radiation Oncology, Indiana University School of Medicine, Indianapolis, Indiana

Requests for reprints: Changshun Shao, Department of Genetics, Rutgers University, 604 Allison Road, Piscataway, NJ 08854. Phone: 732-445-5406; Fax: 732-445-1147; E-mail: shao{at}biology.rutgers.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Exposure to ionizing radiation (IR) is a risk factor for carcinogenesis because it is a mutagen. However, a single 4-Gy whole body X-ray exposure only induced a modest increase of mutations at the Aprt reporter gene locus in mouse T cells. Intriguingly, when the same dose of IR was given in a fractionated protocol (1 Gy x 4 at weekly intervals), there was a strong induction of Aprt mutations in T cells. Many of these were mutations that arose via interstitial deletions inclusive of Aprt or by intragenic deletions. We hypothesized that the weekly fractionated X-ray exposures select for somatic cells with reduced p53 expression and/or reduced apoptosis, which, in turn, may have facilitated the accumulation of interstitial deletions, as in p53-deficient mice. We indeed found that splenocytes of mice with three previous exposures (1 Gy x 4 in total) were more resistant to X-ray–induced apoptosis than those of mice exposed to X-rays for the first time (1 Gy total). Thus, repeated X-ray radiation selects for reduced apoptosis in vivo. However, this reduced apoptosis is p53-independent, because p53 induction and the up-regulation of genes downstream of p53, such as Bax and p21, were similar between the 1-Gy and 1 Gy x 4 groups. Reduced apoptosis probably allows the generation of more mutations, particularly deletion mutations. Because both reduced apoptosis and increased somatic mutation are risk factors for carcinogenesis, they may contribute to the paradigm in which different radiation exposure schemes are varied in their efficiency in inducing lymphomagenesis. [Cancer Res 2007;67(5):1910–7]


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Studies on humans and animals have shown that ionizing radiation (IR) is a carcinogen (1) and that radiation-induced carcinogenesis can be modulated by a variety of factors, such as dose, dose rate, dose fractionation, radiation quality, and tissue and organ sensitivity (2). Although the mechanisms by which carcinogenesis is induced by IR are poorly understood, they are probably related to its mutagenic effects (3). IR can cause immediate genome damage in the targeted cells by the formation of base damage, single-strand breaks, and double-strand breaks. Repair or misrepair of such damage may lead to various types of genetic alteration, including translocation, mitotic recombination, gene conversion, large-scale interstitial deletion, small intragenic deletion and insertion, and point mutation (4). In addition, IR may induce a delayed genomic instability in the progeny of the irradiated cells many generations after the initial insult (1, 5, 6).

The cellular responses to DNA damage caused by IR include activation of cell cycle checkpoints, DNA repair, apoptosis, and induction of a permanent arrest (7, 8). It seems that whichever pathway a cell is committed to, cell cycle arrest/DNA repair or apoptosis, depends on the severity of DNA damage, the cell type involved, and the environmental stimuli of the cell (9). Apoptosis plays an important protective role by eliminating cells with severely damaged or grossly abnormal genomes. Compromise in apoptosis can be permissive for the survival and ongoing division of cells that have failed to repair DNA damage or cells that have acquired abnormal genomes (10). If mutations occur in oncogenes and tumor suppressor genes, they may lead to carcinogenesis.

It remains unclear how different radiation schemes have different oncogenic consequences. Do different radiation schemes have different oncogenic effects because they have different mutagenic effects? The present work compared the mutagenic effects of split doses (4 x 1 Gy) versus a single dose (4 Gy) of X-rays on normal splenic T lymphocytes in vivo in B6C3F1 Aprt+/– mice. The mutant cells, caused by point mutation or by loss of heterozygosity (LOH), are recoverable by the virtue of their resistance to adenine analogue 2,6-diaminopurine (DAP; refs. 11–13). The Aprt assay measures several pathways of LOH, including mitotic recombination, interstitial deletion, and chromosome loss. Although the majority of the spontaneous LOH events are derived from mitotic recombination, we found that interstitial chromosome deletions were remarkably induced by split doses of X-rays with weekly intervals, which is more efficient than of a single dose. We also found that the induction of apoptosis by IR is reduced in lymphocytes of mice that had been subjected to multiple exposures to X-rays. Reduction of apoptosis may facilitate the preferential accumulation of interstitial deletions spanning Aprt. We also presented evidence showing that the reduction of apoptosis is not mediated by p53.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice and radiation treatment. Aprt+/– mice as a model for study of LOH were described earlier (11–13). The B6C3F1 Aprt+/– mice used in this study were generated by crossing either female C57BL/6J Aprt+/– to male C3H/HeJ Aprt+/+ mice or female C57BL/6J Aprt+/+ to male C3H/HeJ Aprt+/– mice. At the age of 2 months, mice were subjected to whole-body X-irradiation with a single dose or fractionated doses. The radiation was delivered at the rate of 0.25 Gy/min using an aluminum filter at 90 kVp (Faxitron Cabinet X-ray System, Faxitron X-ray Corp., Wheeling, IL). The dosimeters were periodically monitored by Landauer (Glenwood, IL). In the single-dose exposure, the doses were 1, 2, or 4 Gy. In the fractionated exposure, a total of 4-Gy dose was split into four fractions, with 1 Gy each at daily or weekly intervals between exposures. We estimated the sample size for each treatment group with the assumption of mean at 30 x 10–6 and SD at 40 x 10–6 for the mutant frequency in control group (13). With the expectation of an increase of 2-fold to 3-fold in mutant frequency after X-irradiation and with the power set at 0.8, the sample sizes required are in the range of 9 to 29. The sample sizes actually used for various groups were n = 19 (0 Gy, control), n = 16 (1 Gy), n = 16 (2 Gy), n = 22 (4 Gy), n = 14 (4 x 1 Gy weekly), and n = 19 (4 x 1 Gy daily). About equal numbers of males and females were used in each group.

Isolation and characterization of somatic mutants. Mice were sacrificed for necropsy 2 months after the last irradiation. The isolation of DAP-resistant (DAPr) lymphocytes was as described (13). As a reference, the frequency of Hprt mutant T cells, which is recoverable by their resistance to 6-thioguanine, was also measured (13).

Molecular and cytogenetic characterizations of DAPr clones were done as described (12, 13). In brief, the DAPr T-cell colonies were divided into two classes based on the loss (class I) or retention (class II) of the Aprt+ allele as determined by allele-specific PCR (12). Clones of class I were further characterized by genotyping the microsatellite markers flanking Aprt, in the order from centromere to telomere, D8Mit287, D8Mit4, Aprt, D8Tur1, D8Mit14, and D8Mit280. Colonies with LOH that initiated proximal to Aprt and continue to the distal end of chromosome 8 and with two normal copies of chromosome 8 in diploid metaphases were assigned to the category of mitotic recombination.

Class I colonies that remained heterozygous at loci flanking Aprt were presumably the result of interstitial deletion spanning the Aprt+ allele (only one Aprt allele containing the neo insert remains) or gene conversion or recombination with double crossover (two Aprt– alleles, each containing a copy of neo). To determine the copy number of the neo insertion and infer the likelihood of interstitial deletion or gene conversion or recombination with double crossover, these colonies were characterized with quantitative real-time PCR as described (14).

Spleen cell isolation and nuclear extract preparation. Individual spleens were crushed in RPMI 1640, and cell suspension was passed through a 70-µm cell strainer and washed with ice-cold PBS. Nuclear protein extracts were prepared from spleen cells as described (15, 16). Protein concentration was determined by the Bradford assay (17).

Western blotting. Equal amounts of nuclear extract from spleen cells were separated with SDS-PAGE gels and transferred onto polyvinylidene difluoride membranes. Membranes were blocked at room temperature for 30 min in blocking buffer (3% nonfat dry milk in PBS containing 0.1% Tween 20) and incubated at 4°C overnight with primary antibody diluted in blocking buffer. After five washes with PBS containing 0.1% Tween 20, membranes were incubated at room temperature for 1 h with secondary antibody diluted in blocking buffer. Immunoblots were visualized by enhanced chemiluminescence. Primary antibodies used in this study were rabbit anti-phosphorylated p53 at serine 15 (Cell Signaling Technology, Danvers, MA) and rabbit anti–ß-actin (Abcam, Cambridge, MA).

Enumeration of circulating leukocytes. Three microliters of blood sample were collected from mouse tail veins before and 24 h after a 1-Gy X-ray. The blood samples were immediately resuspended and stained in a 57-µL solution containing 0.01% crystal violet and 1.5% acetic acid and counted with light microscopy on a modified Neubauer hemocytometer. The survival of circulating leukocytes was calculated by dividing the leukocyte count obtained 24 h after X-ray exposure with that obtained before the exposure.

Measurement of apoptosis of splenic lymphocytes. Apoptosis of splenic lymphocytes was examined with a kit that measures apoptosis based on terminal deoxyribonucleic transferase-mediated dUTP nick end labeling (TUNEL) technology (Roche Applied Science, Indianapolis, IN). Mice were sacrificed at different time points after X-irradiation. Spleens were obtained and placed in ice-cold RPMI 1640. Splenic lymphocytes were isolated as described (13) and were fixed in 2% paraformaldehyde (in 1 x PBS) for 1 h at room temperature. Cells were washed thrice with PBS, resuspended in permeabilization solution (0.1% triton X-100, 0.1% sodium citrate, freshly made), and incubated on ice for 2 min. Cells were washed twice with PBS, resuspended in TUNEL reaction mixture, and incubated at 37°C for 1 h. Samples were washed twice with PBS and analyzed under a fluorescence microscope.

Real-time PCR for quantification of gene expression. Total RNA from isolated splenic lymphocytes was purified using the RNeasy kit (Qiagen, Valencia, CA) and reverse transcribed using the TaqMan reverse transcription reagent kit (Applied Biosystems, Foster City, CA). The expression of selected genes was quantified as previously reported (18). Expression levels were calculated as a ratio of the mRNA level for a given gene relative to the mRNA level for glyceraldehyde-3-phosphate dehydrogenase in the same cDNA.

The primer sequences are as follows:

mMdm2-forward: CAGAGACGCCCTCGCATC
mMdm2-reverse: CTGAATCCTGATCCAGGCAATC
mp21-forward: CCGTTGTCTCTTCGGTCCC
mp21-reverse: CATGAGCGCATCGCAATC
mBax-forward: GCCTCCTCTCCTACTTCGGG
mBax-reverse: TGAGGACTCCAGCCACAAAGA
mp53-forward: CTCTCCCCCGCAAAAGAAA
mp53-reverse: CGGAACATCTCGAAGCGTTT
mGapdh-forward: AATGGTGAAGGTCGGTGTGAAC
mGapdh-reverse: AGGTCAATGAAGGGGTCGTTG

Statistics. Because of the great variation in mutant frequencies in each group, the frequencies of DAPr and 6-TGr variants in irradiated and unirradiated mice were compared using the Mann-Whitney U test. Comparisons of the relative fraction of class I and class II variants and the mutational spectra of class I and class II variants in mice treated with different exposure doses or fractionations were done with contingency tables. Significance levels were determined with {chi}2 test using MINITAB software (Minitab, Inc., State College, PA).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Differential induction of Aprt mutations by different X-irradiation schemes. X-ray–induced Hprt mutant frequencies in T cells were found to peak 56 days after exposure and remained constant for up to 3 months postiradiation (19). We also observed a similar time course for radiation-induced Aprt mutant frequencies.3 We therefore determined the frequencies of DAPr and 6-TGr T-cell variants 2 months after the last exposure. As expected, a significant dose-dependent increase in the frequency of 6-TGr variants was observed after a single dose of X-irradiation (all P values <0.01; Fig. 1A ). Although fractionated doses at weekly or daily intervals also produced a significant increase in the frequency of 6-TGr variants compared with controls (Fig. 1A), fractionation at daily intervals seemed to be more efficient for this mutational induction than fractionation at weekly intervals (median, 67 x 10–6 versus 31 x 10–6; P < 0.03). This finding is consistent with the report that, given the same dose, acute exposure was more effective in inducing Hprt mutations in mouse T cells (20) although the underlying mechanisms remain unknown.


Figure 1
View larger version (10K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. Prevalence of somatic mutations in mice exposed to X-rays. A, frequency of 6-TGr T-cell variants in mice exposed to a single dose or fractionated doses of X-rays. The frequency was determined 2 mo after exposure. Each point represents one spleen. Horizontal lines, median value. X-irradiation at all tested doses produced a significant increase in the frequency of 6-TGr variants compared with controls (all P values <0.01, Mann-Whitney U test). Control (0 Gy), n = 8, median 3.3 x 10–6; 1 Gy, n = 6, median 11 x 10–6; 2 Gy, n = 7, median 21 x 10–6; 4 Gy, n = 9, median 54 x 10–6; 4 x 1 Gy weekly, n = 11, median 31 x 10–6; 4 x 1 Gy daily, n = 8, median 67 x 10–6. About equal numbers of males and females were used in each group. B, frequency of DAPr T cell variants in mice exposed to a single dose or fractionated doses of X-rays. The frequency was determined 2 mo after exposure. Each point represents one spleen. Horizontal lines, median values. The median frequencies of DAPr T-cell variants, starting from left, are 24 x 10–6 (n = 19), 27 x 10–6 (n = 16), 36 x 10–6 (n = 16), 52 x 10–6 (n = 22), 74 x 10–6 (n = 14), and 41 x 10–6 (n = 19). About equal numbers of males and females were used in each group. The data for a single 4-Gy exposure were as published in Liang et al. (14). Only 4 Gy fractionated doses of X-irradiation at weekly intervals produced a significant increase in the frequency of DAPr variants (P < 0.001, Mann-Whitney U test).

 
In contrast to the remarkable increase in the IR-induced mutant frequency at the Hprt locus, there was only a modest increase in the IR-induced mutant frequency as a function of dose at the Aprt locus. As shown in Fig. 1B, no significant increase in the frequency of DAPr variants was observed with single-dose exposure (1 Gy, median 27 x 106) compared with controls (0 Gy, median 24 x 10–6) although the sample sizes were much larger than those for Hprt mutation assay. Although a single exposure of 2 and 4 Gy resulted in 1.5-fold and 2.2-fold increases in the median frequency of DAPr variants, respectively, such inductions were again not statistically significant (both P values >0.1 compared with controls; Fig. 1B). These findings were consistent with previous reports that Aprt locus seems resistant to mutation induction by IR in mouse splenocytes (14, 21).

We then tested whether the induction of Aprt mutation would be affected when the radiation was to be fractionated. When a total dose of 4 Gy was split into four daily 1-Gy fractions, it produced a 1.7-fold increase in the median frequency of DAPr variants over the unirradiated controls. Again such increase was not statistically significant (P > 0.1; Fig. 1B). In contrast, when the total dose of 4 Gy was split into four 1-Gy weekly fractions, the frequency of DAPr variants was elevated by ~3-fold (P < 0.001; Fig. 1B). These findings suggest that the mutagenic consequences induced by IR were dependent on the radiation scheme and the tested target (or reporter) genes. Although IR delivered within a narrow time window was very efficient in inducing mutations at the Hprt locus, it was less efficient in inducing mutations that span the Aprt locus.

Preferential induction of chromosomal deletions at the Aprt locus after fractionated exposures at weekly intervals. To determine the mechanisms of mutagenesis that contribute to the increase in the frequency of the DAPr variants in mice exposed to IR, we first divided these variants into two classes, class I and class II, by allele-specific PCR, as described in Materials and Methods. Class I variants can be caused by chromosome loss, mitotic recombination, interstitial deletion, and gene conversion. Class II variants are usually the results of intragenic point mutation and probably epigenetic inactivation. As shown in Table 1 , both class I and class II variants were increased in mice exposed to 4 Gy of IR. Molecular and cytogenetic characterization of class I DAPr variants indicated that a single dose of 4 Gy significantly induced interstitial deletion/gene conversion events compared with controls (P = 0.003; Table 2 ). Although the category of interstitial deletion/gene conversion accounted for 4% of class I variants in unirradiated mice, it accounted for 22% in mice with a single 4-Gy exposure (Table 2). Taking into consideration the increase in overall frequency of DAPr variants, the frequency of T-cell variants derived by interstitial deletion/gene conversion in mice with a single 4-Gy dose was 7.9 x 10–6, which is ~10-fold higher than that of control mice (0.8 x 10–6). It should be noted that the frequency of class I variants caused by mitotic recombination was nearly 2-fold higher in mice receiving a single 4-Gy exposure. The increase, however, was less distinct when compared with that of interstitial deletion/gene conversion (Table 2).


View this table:
[in this window]
[in a new window]

  		Table 1. Classification of DAPr colonies by allele-specific PCR

 

View this table:
[in this window]
[in a new window]

  		Table 2. Classification of class I colonies by simple sequence repeat genotyping

 
As shown in Table 2, the fraction of interstitial deletion/gene conversion was further increased in mice exposed to 4 x 1 Gy at weekly intervals. It accounted for 38% of the total class I clones (P < 0.001; Table 2). Quantitative real-time PCR showed that six of eight analyzed DAPr variants were caused by interstitial deletion. Taking into consideration the 3-fold increase in overall frequency of the DAPr variants, the frequency of variants derived from interstitial deletion (and gene conversion) was calculated to be ~22-fold higher than that of controls (17.4 x 10–6 versus 0.8 x 10–6). The sizes of the deletions were determined by genotyping markers D8Tur1 and D8Mit14 that are distal to Aprt. Six of eight clones in the group of 4 x 1 Gy at weekly intervals exhibited LOH at D8Tur1. Similarly, six of seven clones in the 4-Gy group also had LOH at D8Tur1.

The exposure scheme of 4 x 1 Gy at daily intervals had a similar effect as the single 4-Gy dose in its induction of interstitial deletion/gene conversion (Table 2). Thus, although the exposure scheme of 4 x 1 Gy at weekly intervals was the least efficient in inducing mutations at the X-linked Hprt locus (Fig. 1A), it was the most efficient in inducing chromosomal deletions spanning or within Aprt on chromosome 8.

Sequencing analysis of Aprt showed that small deletions/insertions accounted for many of class II variants (Table 3 ). The elevation of such genetic alterations seemed to be the highest in the group of 4 x 1 Gy at weekly intervals (12.9 x 10–6). Both intragenic deletions/insertions in class II variants and the interstitial deletions in class I variants were probably caused by errors during nonhomologous end joining of DNA double-strand breaks. When 4 Gy of X-rays were split into 4 x 1 Gy at weekly intervals, it becomes more efficient in inducing deletions that are derived from erroneous repair of double-strand breaks mediated by nonhomologous end joining.


View this table:
[in this window]
[in a new window]

  		Table 3. Classification of class II colonies by DNA sequencing

 
Induction of apoptosis in splenic cells are reduced after repeated exposure to IR. We previously showed that LOH, especially interstitial deletions, was significantly induced by a single 4-Gy X-ray in T cells of p53 null mice (14). It is also well established that cells of lymphoid origin in p53 null mice are compromised in their capacity to undergo apoptosis upon DNA damage (22–25). Thus, it was tempting to assume that double-strand breaks introduced by X-rays are more likely to be converted into deletion mutations when apoptosis was compromised. To test whether or not the induction of apoptosis is altered in the replenished lymphoid tissues of the mice that had received three 1-Gy exposures at weekly intervals, we compared the levels of apoptosis in splenic cells by TUNEL assay at six time points after those mice were exposed to an additional 1-Gy X-ray to that in those mice that were exposed to X-ray for the first time. We observed that the frequency of apoptotic cells peaked at two time points, one at 6 h and another at 24 h, after X-ray exposure (Fig. 2A ). They probably represent early and delayed apoptosis, respectively. Interestingly, the delayed apoptosis, wherein peak is at 24 h, was significantly lower in the 4 x 1 Gy group than that in the 1-Gy group (Student's t test, P = 0.02; Fig. 2A), suggesting that the induction of apoptosis is reduced in the replenished spleens in the mice that received repeated X-ray exposure.


Figure 2
View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Apoptosis and survival of leukocytes after their exposure to X-rays in vivo. A, reduced apoptosis in mice receiving repeated exposures to X-rays. Splenic lymphocytes were isolated at different time points after X-irradiation (single 1-Gy dose or the last 1-Gy dose of 4 x 1 Gy weekly fractionated X-rays). Apoptosis of splenic lymphocytes was estimated with TUNEL assay. Frequency of apoptotic cells was determined by scoring 2,000 to 5,000 cells per mouse. Points, mean frequency of apoptotic cells (n = 3–8); bars, SD. B, adaptation of circulating leukocytes to IR. Leukocyte counts were obtained from three mice before and 24 h after exposure to 1 Gy of X-rays at weekly intervals. Although the cell count was reduced remarkably after the first exposure to ~40% of the level before exposure, such reduction was less pronounced with the subsequent exposures to ~70% of the level on the previous day. Points, mean of the percentages of surviving cells (n = 3); bars, SD. The inset shows the increased survival of leukocytes in mice lacking p53 after the first exposure to 1 Gy of X-rays. Columns, means of the percentages of surviving cells (n = 3); bars, SD.

 
Because TUNEL assay only measures the proportion of apoptotic cells at a particular time point and does not reflect the cumulative reduction of cell numbers over a period of time, we resorted to a peripheral leukocyte count in the mouse tail veins to estimate the cumulative killing effect X-rays had on mice under different radiation schemes. Peripheral leukocytes, which contain both granulocytes and lymphocytes, are also sensitive to IR-induced apoptosis (24, 26). We measured the changes in the counts of circulating leukocytes 24 h after exposure to X-rays. As shown in Fig. 2B, although the first 1 Gy reduced leukocyte count to ~40% of the level before exposure, the subsequent exposures were less effective, reducing it to ~70% of the level the day before exposure, suggesting that surviving cells became more resistant to subsequent X-ray exposures.

Interestingly, compared with a 60% reduction in leukocyte numbers at 24 h after the first exposure in wild-type mice, the reduction was only 30% in p53–/– mice (Fig. 2B, inset), suggesting that diminished leukocyte numbers after X-irradiation are partly mediated by p53.

Taken together, repeated X-ray exposures select for reduced apoptosis in lymphoid cells and peripheral leukocytes. When apoptosis is compromised, cells with certain types of residual DNA damage may survive and proliferate, leading to a higher mutational load. This is apparently the case for mutations involving the Aprt locus in irradiated mouse T cells.

Reduced apoptosis after repeated IR is p53 independent. It has been well recognized that p53 is the key regulator of apoptosis in cells of lymphoid origin. Apoptosis in lymphoid cells induced by IR is usually greatly reduced in p53 null mice (22–25). Also, the preferential induction of interstitial deletions in the 4 x 1 Gy mice highly resembles the mutational spectrum of DAPr T cells of p53–/– mice irradiated with a single 4-Gy X-ray exposure, as we reported previously (14). Whereas chromosomal deletions accounted for only 9% of the class I T-cell variants in untreated p53–/– mice, they were increased to 46% in irradiated p53–/– mice, representing a 40-fold increase in mutant frequency (14). Collectively, these findings suggest that down-regulation of p53 may be responsible for the reduction of apoptosis selected by the repeated exposures to IR. To test this hypothesis, we measured, by Western blot, the level of phosphorylated p53 at serine 15, an indicator of p53 activation in response to IR (27, 28), in splenic cells at different time points after their exposure to IR. However, contrary to our prediction, we observed no differences in the levels of p53 activation for all time points tested whether or not the mice had received three exposures to X-rays previously. It was evident that p53 activation started within 1 h of exposure to X-rays, peaked at 3 h and then subsided. It became undetectable at 24 h. The same pattern was observed for both groups (Fig. 3A ).


Figure 3
View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Reduction in apoptosis of splenic lymphocytes is independent of p53. A, Western blot analysis of the levels of phosporylated p53 (Phos-p53) at serine 15. Nuclear extracts were prepared from splenic lymphocytes at different time points after X-irradiation (single 1-Gy dose or the last 1-Gy dose of 4 x 1 Gy weekly fractionated X-rays). B, quantitative real-time PCR analysis for expression of p53 and its target genes. Splenic cells were isolated 1 h after the single 1-Gy dose or after the last 1-Gy dose of 4 x 1 Gy weekly fractionated X-rays. The 0 h controls were from unirradiated mice for the 1-Gy group and from mice that received 3 x 1 Gy for the 4 x 1 Gy group, respectively. Total RNA of splenic cells was purified and reverse transcribed. The expression level of selected genes was quantified using quantitative real-time PCR as described in Materials and Methods. Columns, mean fold change (n = 3–4) in expression level of given genes after the irradiation over that before the irradiation; bars, SD.

 
Consistent with the similar activation of p53 between the 1-Gy and 4 x 1 Gy groups, the up-regulation of genes downstream of p53 was about the same 1 h after exposure to X-rays. As shown in Fig. 3B, the fold increases for p53-regulated genes were similar between the 1-Gy and 4 x 1 Gy groups. Particularly, there was no less induction of proapoptotic gene Bax.

Thus, although the induction of apoptosis by IR is reduced in mice irradiated weekly, this reduction is not mediated by p53. Supporting this notion is the observation that p53 activation and its function were induced similarly in splenocytes regardless of their previous exposure to X-rays. Also, only the delayed apoptosis, but not the early apoptosis, was reduced in the 4 x 1 Gy group when compared with the 1-Gy group. At the time point when the delayed apoptosis peaks, p53 induction was undetectable. Consistent with our findings, a delayed wave of apoptosis, 20 h after exposure to IR, was observed in T cells of both p53 wild-type and p53 null mice (29).

p53 also functions in suppressing spontaneous and IR-induced mitotic recombination (14, 30). Although mitotic recombination mutants were increased 7-fold in T cells of p53–/– mice exposed to a single 4-Gy exposure to X-rays (14), they were increased only 2-fold in those of 4 x 1 Gy mice, providing additional evidence that p53 function is retained in 4 x 1 Gy mice.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The mutagenic effects of IR on inducing LOH in vivo in Aprt heterozygous mice have been evaluated in several previous reports (14, 21, 30). In contrast to a significant and dose-dependent induction of mutations at Hprt locus in T cells, the mutagenic effects of a single dose of IR were less dramatic when Aprt was used as the reporter (14, 21), although Aprt mutations were found to be significantly induced in skin fibroblasts and kidney cells of Aprt+/– mice by a single exposure of {gamma} radiation (31). In this study, we evaluated whether different radiation schemes would have different mutagenic effects on T cells. We found that split doses of X-rays given at weekly intervals were more efficient in inducing Aprt mutations in T cells than a single dose or split doses with daily intervals. In particular, interstitial deletions were preferentially observed. Although 4 Gy of X-rays given in a single exposure generated a 10-fold increase in the frequency of interstitial deletions, the same dose, if fractionated at weekly intervals but not at daily intervals, led to a 22-fold increase (Table 2). Thus, the induction of deletion mutations at Aprt locus is dependent on radiation exposure schemes.

Interestingly, the same radiation schemes had opposite effects on Hprt and Aprt locus. Although a single dose or split doses with daily intervals were more potent than split doses with weekly intervals at the X-linked Hprt locus, the opposite was true for the induction of mutations at the autosomal Aprt locus in splenocytes; we don't know if this finding applies to other autosomal and X-linked loci. In one study (32), a fractionated radiation scheme led to a greater induction of lymphomas, which suggests that, perhaps, deletions involving other autosomal loci might be more common after fractionated irradiation. It is probable that deletions spanning Hprt on X chromosome are induced differently from those on autosomes, especially if illegitimate recombination and/or cross-talk between homologues are involved in the generation of deletion mutations. In addition, chromosomal location and the size of the deletion, as well as the genes involved, may all affect the in vivo proliferation status of a deletion mutant. Thus, the presence or absence of genes that are cis-linked to a reporter gene, Aprt or Hprt, may affect the survival and proliferation of the deletion mutants. Cdt1, which is located only 1.5 kb from the 3' end of Aprt, is essential for replication initiation (33). Cells with deletions that extend into Cdt1 region will presumably have a disadvantage in proliferation. The proliferation and consequently the recovery of such deletion mutants may become possible only if apoptosis is reduced. Indeed, deletions that extended beyond Cdt1 and spanned several megabases on chromosome 8 were rarely observed in cells recovered from p53+/+ mice but were frequently detected in those from p53–/– and p53+/– mice (30). In this study, almost all the deletion mutations extended beyond D8MitTur1, 1 kb from the 5' end of Aprt, although it is unknown whether or not the deletions extended to the Cdt1 region on the 3' end.

We observed previously that the frequency of Hprt mutant T cells were similarly induced by a single dose of X-rays regardless of p53 status (14) and p21 status.4 However, the induction of Aprt mutant frequency in T cells by the same dose was greatly affected by the status of p53. Although a single dose of X-rays only had a modest effect on the induction of Aprt mutants in p53 wild-type mice, such mutations were induced 8-fold by the same treatment in p53–/– mice (14), indicating that this locus-specific induction of somatic mutations is determined by p53 status. Because somatic cells in vivo vary in the level of p53 expression (34), it is expected that every time these cells are exposed to IR, those with higher levels of p53 would be preferentially selected against as a consequence of their higher capacity to undergo apoptosis. However, although we indeed found that the induction of apoptosis is reduced in the splenic cells in the mice that received repeated X-ray exposure, the dynamics of p53 activation was not altered in spite of the difference in the delayed apoptosis. Consistent with the normal induction of p53, mitotic recombination is not as highly increased in 4 x 1 Gy mice as in p53–/– mice (14). Collectively, these data suggest that higher p53 levels are not selected against by repeated exposures to X-rays. This is unexpected. One possible explanation is that the cells that repopulate lymphoid tissues after radiation exposure are derived from stem cells in which p53 does not express and, thus, are not subjected to p53 mediated apoptosis.

Nevertheless, the induction of apoptosis is decreased in mice that had received split doses of X-rays with weekly intervals although p53 activation is normal. This reduced apoptosis probably contributes to the increase of Aprt mutations in T cells of mice. It has been reported that ectopic expression of Bcl-2 or Bcl-x leads to increased radioresistance in both p53 wild-type cells and p53 mutant cells (35). Importantly and consistent with our findings, LOH mutations at TK1 locus were elevated markedly by IR when Bcl-2 or Bcl-xL expression was increased; mutations at Hprt locus, on the other hand, were increased only slightly (35).

Although apoptosis has been recognized as the safeguard mechanism for the maintenance of genomic integrity (10), there have been very few studies that systematically evaluate the mutational consequences caused by failure of apoptosis. Our study provides the first evidence that associates decreased apoptosis with increased mutation accumulation in vivo. In a separate study, we found that in p21-null mice whose lymphocytes are more sensitized to IR-induced apoptosis, somatic mutations at Aprt locus in T cells are reduced.4 Collectively, these findings implicate the role of apoptosis in the prevention of some types of somatic mutations.

The mutagenicity of different radiation schemes we report here is correlated to the lymphomagenic activity of IR that was reported by Kaplan and Brown (32), who studied lymphoma incidence and latent period in C57 black mice treated with whole body X-irradiation in a single exposure or equal fractions at different time intervals. They showed that although there was a rather gradual increase in lymphoma incidence with increased dosage when it was given in a single exposure or divided into four fractions at daily intervals, the same total dose, when separated into four fractions given at intervals of 4 to 8 days, yielded a much higher lymphoma incidence and a shorter latent period. Shimada et al. (36) showed that X-irradiation fractionated at weekly intervals (4 x 1.6 Gy) was very efficient in inducing thymic lymphomas in B6C3F1 mice, and multiloci LOH events were more common in the induced lymphomas than in spontaneous lymphomas. Our results provide one possible mechanistic explanation for the differential induction of lymphomas by the different radiation schemes. Our results suggest that both reduced apoptosis and increased somatic mutations contribute to the increased frequency of lymphomas in mice treated with similar fractionation schemes.


   Acknowledgments
 
Grant support: NIH grant R01ES011633 and P30ES05022; NASA grant NNG05GN24G; and a New Jersey Stem Cell Research grant from NJCST.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank an anonymous reviewer for providing many critical comments and helpful suggestions.


   Footnotes
 
3 Liang and Tischfield, unpublished data. Back

4 Shao, Liang, Chen, and Tischfield, unpublished data. Back

Received 4/24/06. Revised 12/12/06. Accepted 12/22/06.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Little JB. Radiation carcinogenesis. Carcinogenesis 2000;21:397–404.[Abstract/Free Full Text]
  2. Storer JB. Carcinogenic effects: an overview. In: Upton AC, Albert RE, Burns FJ, Shore RE, editors. Radiation Carcinogenesis. New York: Elsevier; 1986. p. 11–22.
  3. Huang L, Snyder AR, Morgan WF. Radiation-induced genomic instability and its implications for radiation carcinogenesis. Oncogene 2003;22:5848–54.[CrossRef][Medline]
  4. Pfeiffer P, Goedecke W, Obe G. Mechanisms of DNA double-strand break repair and their potential to induce chromosomal aberrations. Mutagenesis 2000;15:289–302.[Abstract/Free Full Text]
  5. Morgan WF. Non-targeted and delayed effects of exposure to ionizing radiation: II. Radiation-induced genomic instability and bystander effects in vivo, clastogenic factors and transgenerational effects. Radiat Res 2003;159:581–96.[CrossRef][Medline]
  6. Wright EG. Inherited and inducible chromosomal instability: a fragile bridge between genome integrity mechanisms and tumourigenesis. J Pathol 1999;187:19–27.[CrossRef][Medline]
  7. Bernstein C, Bernstein H, Payne CM, Garewal H. DNA repair/pro-apoptotic dual-role proteins in five major DNA repair pathways: fail-safe protection against carcinogenesis. Mutat Res 2002;511:145–78.[CrossRef][Medline]
  8. Kastan MB, Bartek J. Cell-cycle checkpoints and cancer. Nature 2004;432:316–23.[CrossRef][Medline]
  9. Gudkov AV, Komarova EA. The role of p53 in determining sensitivity to radiotherapy. Nat Rev Cancer 2003;3:117–29.[CrossRef][Medline]
  10. Zhivotovsky B, Kroemer G. Apoptosis and genomic instability. Nat Rev Mol Cell Biol 2004;5:752–62.[CrossRef][Medline]
  11. Stambrook PJ, Shao C, Stockelman M, Boivin G, Engle SJ, Tischfield JA. APRT: a versatile in vivo resident reporter of local mutation and loss of heterozygosity. Environ Mol Mutagen 1996;28:471–82.[CrossRef][Medline]
  12. Shao C, Deng L, Henegariu O, et al. Mitotic recombination produces the majority of the recessive fibroblast variants in heterozygous mice. Proc Natl Acad Sci U S A 1999;96:9230–5.[Abstract/Free Full Text]
  13. Liang L, Deng L, Shao C, Stambrook PJ, Tischfield JA. In vivo loss of heterozygosity in T-cells of B6C3F1 Aprt(+/–) mice. Environ Mol Mutagen 2000;35:150–7.[CrossRef][Medline]
  14. Liang L, Shao C, Deng L, Mendonca MS, Stambrook PJ, Tischfield JA. Radiation-induced genetic instability in vivo depends on p53 status. Mutat Res 2002;502:69–80.[Medline]
  15. Jessberger R, Berg P. Repair of deletions and double-strand gaps by homologous recombination in a mammalian in vitro system. Mol Cell Biol 1991;11:445–57.[Abstract/Free Full Text]
  16. Liang L, Deng L, Chen Y, Li GC, Shao C, Tischfield JA. Modulation of DNA end joining by nuclear proteins. J Biol Chem 2005;280:31442–9.[Abstract/Free Full Text]
  17. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248–54.[CrossRef][Medline]
  18. Liang L, Chen J, Vittal R, et al. Expression Profiling of Crystal-Induced Injury in Human Kidney Epithelial Cells. Nephron Physiol 2006;103:53–62.
  19. Grdina DJ, Kataoka Y, Basic I, Perrin J. The radioprotector WR-2721 reduces neutron-induced mutations at the hypoxanthine-guanine phosphoribosyl transferase locus in mouse splenocytes when administered prior to or following irradiation. Carcinogenesis 1992;13:811–4.[Abstract/Free Full Text]
  20. Lorenz R, Deubel W, Leuner K, Gollner T, Hochhauser E, Hempel K. Dose and dose-rate dependence of the frequency of HPRT deficient T lymphocytes in the spleen of the 137Cs {gamma}-irradiated mouse. Int J Radiat Biol 1994;66:319–26.[Medline]
  21. Wijnhoven SW, Van Sloun PP, Kool HJ, et al. Carcinogen-induced loss of heterozygosity at the Aprt locus in somatic cells of the mouse. Proc Natl Acad Sci U S A 1998;95:13759–64.[Abstract/Free Full Text]
  22. Lowe SW, Schmitt EM, Smith SW, Osborne BA, Jacks T. p53 is required for radiation-induced apoptosis in mouse thymocytes. Nature 1993;362:847–9.[CrossRef][Medline]
  23. Clarke AR, Purdie CA, Harrison DJ, et al. Thymocyte apoptosis induced by p53dependent and independent pathways. Nature 1993;362:849–52.[CrossRef][Medline]
  24. Lotem J, Sachs L. Hematopoietic cells from mice deficient in wild-type p53 are more resistant to induction of apoptosis by some agents. Blood 1993;82:1092–6.[Abstract/Free Full Text]
  25. Lee JM, Bernstein A. p53 mutations increase resistance to ionizing radiation. Proc Natl Acad Sci U S A 1993;90:5742–6.[Abstract/Free Full Text]
  26. Hall EJ. Radiobiology for the radiologist. 4th ed. Philadelphia: JB Lippincott; 1994. p. 315–6.
  27. Shieh SY, Ikeda M, Taya Y, Prives C. DNA damage-induced phosphorylation of p53 alleviates inhibition by MDM2. Cell 1997;91:325–34.[CrossRef][Medline]
  28. Siliciano JD, Canman CE, Taya Y, Sakaguchi K, Appella E, Kastan MB. DNA damage induces phosphorylation of the amino terminus of p53. Genes Dev 1997;11:3471–81.[Abstract/Free Full Text]
  29. Erlacher M, Michalak EM, Kelly PN, et al. BH3-only proteins Puma and Bim are rate-limiting for {gamma}-radiation- and glucocorticoid-induced apoptosis of lymphoid cells in vivo. Blood 2005;106:4131–8.[Abstract/Free Full Text]
  30. Shao C, Deng L, Henegariu O, Liang L, Stambrook PJ, Tischfield JA. Chromosome instability contributes to loss of heterozygosity in mice lacking p53. Proc Natl Acad Sci U S A 2000;97:7405–10.[Abstract/Free Full Text]
  31. Ponomareva ON, Rose JA, Lasarev M, Rasey J, Turker MS. Tissue-specific deletion and discontinuous loss of heterozygosity are signatures for the mutagenic effects of ionizing radiation in solid tissues. Cancer Res 2002;62:1518–23.[Abstract/Free Full Text]
  32. Kaplan HS, Brown MB. A quantitative dose-response study of lymphoid-tuor develepment in irradiated C57 black mice. J Natl Cancer Inst 1952;13:185–208.[Medline]
  33. Saxena S, Dutta A. Geminin-Cdt1 balance is critical for genetic stability. Mutat Res 2005;569:111–21.[Medline]
  34. Coates PJ, Lorimore SA, Lindsay KJ, Wright EG. Tissue-specific p53 responses to ionizing radiation and their genetic modification: the key to tissue-specific tumour susceptibility? J Pathol 2003;201:377–88.[CrossRef][Medline]
  35. Cherbonnel-Lasserre C, Gauny S, Kronenberg A. Suppression of apoptosis by Bcl-2 or Bcl-xL promotes susceptibility to mutagenesis. Oncogene 1996;13:1489–97.[Medline]
  36. Shimada Y, Nishimura M, Kakinuma S, et al. Radiation-associated loss of heterozygosity at the Znfn1a1 (Ikaros) locus on chromosome 11 in murine thymic lymphomas. Radiat Res 2000;154:293–300.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liang, L.
Right arrow Articles by Tischfield, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liang, L.
Right arrow Articles by Tischfield, J. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online