| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
Cancer Biology and Therapeutics, Merck Research Laboratories, Boston, Massachusetts
Requests for reprints: Bart Lutterbach, Department of Molecular Oncology, BMB 9-122, Merck Research Laboratories, 33 Avenue, Louis Pasteur, Boston, MA 02115. Phone: 617-992-2038; E-mail: bart_lutterbach{at}merck.com.
| Abstract |
|---|
|
|
|---|
-catenin in the Met-amplified EBC-1 and H1993 cell lines. ShRNA-mediated Met knockdown induced significant growth inhibition, G1-S arrest, and apoptosis in EBC-1 and H1993 cells, whereas it had little or no effect on the cell lines that do not have Met amplification. These results strongly suggest that Met amplification identifies a subset of NSCLC likely to respond to new molecular therapies targeting Met. [Cancer Res 2007;67(5):20818] | Introduction |
|---|
|
|
|---|
80% of lung cancer (1). Standard therapies for advanced NSCLC include radiotherapy and chemotherapy, which confer palliative and moderate survival benefits with significant toxicities (1). To address the substantial unmet medical needs in NSCLC, extensive efforts have been made to identify molecular defects underlying the genesis and progression of NSCLC and to discover novel therapeutic agents targeting these defects. Recent clinical success of epidermal growth factor receptor (EGFR) inhibitors in refractory, advanced NSCLC (2) have raised hopes that targeting other deregulated growth factor signaling, such as the hepatocyte growth factor (HGF)/Met pathway, will lead to new therapeutic options for NSCLC.
Met is a heterodimeric transmembrane receptor tyrosine kinase composed of an extracellular
-chain disulfide-bonded to a membrane-spanning ß-chain (3, 4). The tyrosine kinase domain resides in the cytosolic domain of the ß-chain (3, 4). Binding of HGF/SF to Met induces receptor dimerization and trans-phosphorylation, triggering conformational changes that activate Met tyrosine kinase activity (5). The resultant tyrosine phosphorylation of a multisubstrate docking site, located near the COOH terminus of the Met ß-chain, mediates the activation of a number of signaling pathways, including phosphoinositide-3-kinase/phosphoinositide-dependent protein kinase 1/AKT, Ras-Rac/Rho, Ras-mitogen-activated protein kinase, and phospholipase C-
pathways (5). In addition to proliferative and antiapoptotic activities that are common to many growth factors, HGF/Met elicits unique motogenenic and morphogenic effects by stimulating cell-cell detachment, migration, invasiveness, and tubule formation and branching (5).
Aberrant Met signaling has been implicated in the development, maintenance, and progression of cancers in both animals and humans (5). Transgenic mice overexpressing HGF develop tumors in a number of tissues, and tissue-specific transgenic overexpression of Met or HGF causes or promotes malignant transformation of hepatocytes, airway epithelium, and mammary epithelium (5). In humans, Met plays a central role in hereditary papillary renal carcinoma, which is causally related to gain-of-function germ line mutations in the Met tyrosine kinase domain (6). Gain-of-function Met mutations have also been found in several nonrenal tumors, including lung cancers (5, 7). Notably, a somatic intronic mutation in the Met gene has been identified recently in lung cancer, resulting in a deletion in the juxtamembrane domain and stimulation of Met-transforming activity in vitro (8). In addition to mutations, several reports have shown genomic amplification of Met to occur in 5% to 10% of gastric cancers (911). Recent work has also identified Met amplification in 4% of esophageal (12) and 4% of lung cancers (13). While this work was in progress, gastric cancer cell lines with Met amplification were reported to be dependent on the amplified Met kinase for growth in vitro, indicating a critical role for Met in in vitro cell growth and survival (14). Met amplification also has clinical significance in that both Met gene amplification as well as Met and/or HGF overexpression have been correlated with poor clinical outcome in a variety of human cancers (5).
To assess the functional roles of Met in NSCLC, we evaluated a panel of lung cancer cell lines for Met gene amplification, Met expression, Met pathway activation, and the sensitivity of the cell lines to short hairpin RNA (shRNA)mediated Met knockdown. ShRNA-mediated Met knockdown induced significant growth inhibition, G1-S arrest, and apoptosis in cell lines harboring Met gene amplification, whereas it had little or no effects on the cell lines that do not have Met amplification. These results suggest that Met amplification may identify a subset of NSCLC sensitive to emerging Met inhibitors.
| Materials and Methods |
|---|
|
|
|---|
Quantitative PCR for analysis of Met genomic amplification. Quantitative PCR was done on genomic DNA purified using the DNA easy kit (Qiagen, Valencia, CA). Primers and probe used for MET are (5' to 3') F-TGTTGCCAAGCTGTATTCTGTTTAC; R-TCTCTGAATTAGAGCGATGTTGACA, VIC-TGGATAATTGTGTCTTTCTCTAG-MGBNFQ (14). Primers and probe for single-copy reference gene RNase P, which encodes the RNA moiety for the RNase P enzyme, are a product of Applied Biosystems (Foster City, CA), as well as TaqMan Universal PCR reagent mix. Reactions were done in quadruplicate with 20 ng of genomic DNA, primers at 900 nmol/L, and probes at 250 nmol/L under standard thermocycling conditions (2 min at 50°C; 10 min at 95°C; 40 cycles of 15 s 92°C; and 1 min 60°C) Data were normalized to RNase P and then to the calibrator sample (normal lung genomic DNA; BioChain Institute, Hayward, CA).
ShRNA production and infection. shRNA sequences for Met were M1: GAAGATCACGAAGATCCCATTCAAGAGATGGGATCTTCGTGATCTTC; M2: GATCTGGGCAGTGAATTAGTTCAAGAGACTAATTCACTGCCCAGATC; M3: GAGCTGTGATAATATACACTTCAAGAGAGTGTATATTCTCACAGCTC. For FGFR2, GCCAACCTCTCGAACAGTATTCAAGAGATACTGTTCGAGAGGTTGGC, and for luciferase: CACCGGTGTTGTAACAATATCGACGAATCGATATTGTTACAACACCAAAA. These oligonucleotides were annealed to make double-stranded oligonucleotides with a 5' BbsI overhang and a 3' SpeI overhang. The annealed oligonucleotides were cloned into a proprietary BbsI/SpeI cut ENTR plasmid (expression from mouse U6 promoter) Gateway technology (Invitrogen) was used to convert into Plenti6/Block-iT-DEST (Invitrogen).
Virus was produced using the Invitrogen lentiviral expression system as directed by the supplier with the following exceptions. Plasmids were transfected into 2.5 x 107 293FT cells on 15-cm polylysine-coated plates, and the supernatant was collected at 48 and 72 h posttransfection. Titer was determined using colony formation under blasticidin selection as described by Invitrogen (Invitrogen lentiviral expression system). Lentiviral infection was at a multiplicity of infection (MOI) of 10 for EBC-1 and MOI of 20 for the remaining cell lines. For growth analysis, cells were seeded at 4000 cells per well in 96-well plates, whereas for Western analysis, cells were seeded at 40,000 cells in 12-well plates. Viral supernatants were added for 14 to 16 h in the presence of 6 µg/mL polybrene, at which point viral supernatants were removed, and cells were washed once with PBS and replaced with growth medium containing 15% fetal bovine serum.
Proliferation analysis. Cell growth was analyzed using the Vialight assay kit (Cambrex, Rockland, ME). For some assays, independent analysis by cell counting on a hematocytometer confirmed the results of Vialight.
Western blotting, immunoprecipitation, antibodies, and growth factors. After removing growth medium, tissue culture dishes were placed on ice and lysis buffer containing 30 mmol/L Tris-HCl (pH, 7.5), 50 mmol/L NaCl, 5 mmol/L EDTA, 50 mmol/L NaF, 30 mmol/L NaPPi, 1% Triton, 0.5% IGEPAL, 10% glycerol, 1 mmol/L vanadate, 1 mmol/L bpPhen (Calbiochem, San Diego, CA), and protease inhibitor cocktail (Roche, Indianapolis, IN) was added with shaking for 10 min at 4°C. Cells were scraped from dishes, transferred to Eppendorf tubes followed by freezing at 70°C, thawing, and clarification of cellular debris by centrifugation at 20,000 x g for 5 min at 4°C. SDS-PAGE was on 40 µg of cell lysates, and Western blotting followed standard procedures. For ß-catenin immunoprecipitation, the cell lysate was incubated with 2 µg of antibody for 1 h, then 15 µL of agarose-conjugated donkey anti-rabbit antibody (Jackson ImmunoResearch, West Grove, PA) was added, and the incubation was continued overnight. The next day, the beads were pelleted and washed thrice in lysis buffer plus phosphatase and protease inhibitors. Proteins were eluted by boiling in Laemmli buffer followed by SDS-PAGE and Western blotting. The following antibodies were used: Met 25H2 (Cell Signaling Technology, Danvers, MA) or AF276 (R&D Systems, Minneapolis, MN); Y1349 Met, Y1234,1235 Met, Y845 EGFR, phosphorylated AKT (pAKT) 473, AKT, pERK, extracellular signal-regulated kinase (ERK), poly(ADP-ribose) polymerase (PARP), caspase-3 (8G10), and ß-actin antibodies were from Cell Signaling Technology. Y1173 EGFR antibody was from Biosource Invitrogen (Carlsbad, CA). 4G10 phosphotyrosine was from Upstate (Charlottesville, VA). Antibody to Y228
-catenin was from BD Transduction Laboratories (San Jose, CA). Antibody to delta catenin was C4864 from Sigma-Aldrich (St. Louis, MO). ß-Catenin antibody sc7199 and isoform-specific antibodies for K-ras (sc-30), H-ras (sc-520), and N-ras (sc-31) were from Santa Cruz Biotechnology (Santa Cruz, CA). Recombinant HGF was from R&D Systems.
Met protein levels were quantitated relative to actin using densitometry (Molecular Dynamics, Sunnyvale, CA) and Image Quant software.
Ras activation assays. Ras activation was assayed using a Ras activation kit (Upstate), which uses glutathione S-transferase-Raf to precipitate active Ras from cell lysates. Three hundred to 600 µg of cell lysates were used, and binding and washing were according to kit procedures.
Flow cytometry. A Becton Dickinson (Franklin Lakes, NJ) FACS Calibur was used for flow cytometry. A total of 500,000 cells were infected with virus and analyzed at the indicated time points. Nonadherent cells were collected and combined with trypsinized adherent cells. Cells were centrifuged at 250 x g, washed in PBS, and fixed overnight in 1 mL ice-cold 70% ethanol. Cells were then washed in PBS and stained with PI/RNase solution (BD PharMingen, San Diego, CA) for 1 h overnight. ModFit software was used to determine the relative distribution in G1, S, G2-M, and manual gating to determine the sub-G1 content.
Receptor tyrosine kinase array. Array 001 (R&D Systems) was used according to supplier protocols to detect tyrosine-phosphorylated receptor tyrosine kinases. This array contains 42 receptor tyrosine kinase capture antibodies spotted in duplicate. Briefly, 50 µg of cell lysates were incubated with the membrane overnight in the provided buffer. Target proteins are captured by their respective antibodies. After washing, incubation with a phosphotyrosine antibody conjugated to horseradish peroxidase allows the detection of captured receptor tyrosine kinases that are tyrosine phosphorylated. A more detailed description of this array is provided in the Supplementary Data.
| Results |
|---|
|
|
|---|
|
-catenin only in the Met-amplified lines (Fig. 2A). In addition, we observed high levels of activated ras in EBC-1 and H1993 cells, although this was similar to other cells in the panel (Fig. 2B). Interestingly, the amount of activated ras in EBC-1 and H1993 was similar to levels found in A549, which is homozygous for mutant K-ras, as well as Calu-1, which contains a heterozygous mutant of K-ras (16). EBC-1 has wild-type ras isoforms,1 and H1993 K-ras was also reported be wild type (17). Using isoform-specific antibodies, we found that the activated ras isoform in EBC-1 and H1993 is exclusively K-ras (data not shown). Thus, both EBC-1 and H1993 cells have activated signaling pathways that, in some cases, are qualitatively and quantitatively dissimilar from pathways activated by HGF stimulation.
|
50% of the starting cell number within 48 to 72 h of virus removal (Fig. 3C, EBC-1). Although Met knockdown in H1993 cells did not result in a decrease in starting cell numbers, there was still no significant increase in cell number from the time of virus removal (Fig. 3B, H1993). To test for specificity of growth inhibition by Met shRNA, we treated the remaining cell lines in our panel with the M3 shRNA, and we tested each of the three Met shRNAs for growth inhibition in EBC-1, H1993, and A549 cells. Met shRNA treatment resulted in growth inhibition in EBC-1 and H1993 cells that corresponded to the amount of protein knockdown in Fig. 3A. Proliferation in A549 and the remaining cell lines was not inhibited by Met shRNA treatment (Fig. 3C), despite efficient knockdown of Met (Fig. 3D). Although H1048 and Calu-1 showed minor growth inhibition, we note that the cell numbers in these lines increased 4-fold when treated with M3 shRNA (data not shown), which is in contrast to the potent inhibition seen in H1993 and EBC-1.
|
|
Finally, flow cytometry was used to characterize the cell cycle profile of EBC-1 and H1993 cells treated with Met shRNA M3 (Fig. 4A). Within 24 h of virus removal, both EBC-1 and H1993 cells sustained a 3- to 4-fold reduction of cells in the S phase, such that the percentage of S-phase cells was decreased from 19% (in EBC-1) and 17% (in H1993) to 5% in each. This decrease in S phase persisted through the time course, suggesting that the cell cycle was blocked at G1-S. At 48 and 72 h, there was an increase in cells in sub-G1 that was most prominent for EBC-1 (6-fold induction at 72 h), indicative of cell death. This increase in the percentage of sub-G1 cells is consistent with the decrease in cell number observed in Fig. 3B. In addition, both cell lines had a strong decrease in the G2-M population at 48 and 72 h, consistent with a loss of cycling cells, but also suggesting that Met inhibition does not result in a block at G2-M. The increased sub-G1 population prominent in EBC-1 cells suggested an increase in apoptosis in these cells. Western blotting in EBC-1 cells indeed revealed the presence of cleaved PARP, an indicator of apoptosis, at 24 and 48 h (Fig. 4B). H1993 also revealed cleaved PARP, but to a lesser extent than EBC-1 cells, starting at 72 h after virus removal (Fig. 4B). The cleaved PARP was also accompanied by cleaved caspase-3 (data not shown).
Having shown that EBC-1 and H1993 cells require Met for growth, we next determined whether key signaling pathways were also inhibited after Met shRNA treatment. Twenty-four hours after M3 virus removal, the knockdown of Met protein was accompanied by a loss of tyrosine phosphorylation in
-catenin and ß-catenin, pAKT, and pERK, each accompanied by only minimal changes in protein levels (Fig. 5
). There was also an almost complete loss of activated ras upon knockdown of Met (Fig. 5). These results reveal that for H1993 and EBC-1 cells, the loss of a single kinase, Met, causes a cessation of multiple signaling pathways and results in profound growth and morphology changes.
|
|
| Discussion |
|---|
|
|
|---|
Our work thus defines the importance of amplified Met for NSCLC growth. While this work was in progress, another group found that Met amplification is critical for gastric cancer cell growth (14). The expression levels of Met in H1993 and EBC-1 are similar to Met expression levels in the Met-amplified gastric cancer cell lines SNU5, MKN45, HS746t, and GTL-16 (data not shown). Neither these gastric cell lines nor EBC-1 and H1993 cell lines secrete HGF as assayed by a lack of scatter activity from cell supernatants (data not shown). Mutation does not account for activation because Met is wild type in GTL-16 cells (15), and Smolen et al. (14) reported that Met is wild type in SNU5, MKN45, HS746T, and KATOII Met-amplified gastric cancer cell lines. Thus, the activation of amplified Met could result from highly expressed receptor clustering independent of ligand.
Met has previously been reported to contribute to the growth of nonMet-amplified cell lines, including the colon cancer cell lines KM20 (18), prostate cancer cell line PC3 (19), and the rhabdomyosarcoma cell line SJRH30 (20). Both KM20 and PC3 cells contain low levels of basal Met phosphorylation, and a proprietary Met small-molecule inhibitor does not inhibit the growth of PC3, KM20, or SJRH30 cell lines, whereas both EBC-1 and H1993 (and Met-amplified gastric cancer cell lines) are potently growth inhibited (data not shown). It is possible that Met protein-protein interactions are important for the growth of KM20, PC3, and SJRH30 cell lines, such that the loss of Met protein (as opposed to the loss of kinase activity) is required to inhibit growth in vitro.
Interestingly, we found that the amplified Met kinase can activate signaling pathways differently from HGF stimulation. Although ERK signaling is activated in the Met-amplified lines, the level of activation is much lower than that found in HGF-stimulated nonMet-amplified lines. By contrast, both p120/
-catenin and ß-catenin contained a striking increase in tyrosine phosphorylation only in the Met-amplified cell lines. HGF has been suggested to activate ß-catenin signaling in primary cells (21), and a link between constitutively activated Met and tyrosine-phosphorylated ß-catenin was suggested by Danilkovitch-Miagkova et al. (22). In this work exogenous expression of a mutationally activated Met (M1268T mutant) activates tyrosine phosphorylation in ß-catenin, resulting in nuclear translocation and activation of target genes such as myc (22). In addition to a role in proliferation, ß-catenin can function in cell adhesion through interactions with cadherin family members and the actin cytoskeleton (23, 24). Increased tyrosine phosphorylation in ß-catenin has also been reported to correlate with a disruption of cell adhesion (25). In contrast to ß-catenin, a link between Met and p120/
-catenin has not been previously described. Although the function of p120/
-catenin has been less well characterized, this catenin family member has recently been shown to cooperate with ß-catenin to activate ß-catenin target gene transcription (26). These studies warrant further investigation of amplified Met kinase in the function of cell-cell adhesion components.
Because we did not observe tyrosine phosphorylation in ß-catenin or p120/
-catenin after HGF stimulation, it is possible that the combined activation of EGFR and Met may be required for this effect. Surprisingly, we found that the basal level of phosphorylation in the activation site and the Y1173 docking site in EGFR was dependent on Met in EBC-1 and H1993 cells. This suggests that EGFR is phosphorylated by Met in Met-amplified cell lines and reveals that the knockdown of Met results in a loss of aspects of EGFR signaling as well. Although previous work has suggested that activation of EGFR can result in the activation of Met phosphorylation, we did not observe phosphorylation of Met at Y1349 in the HCC827 cell line, which contains both EGFR amplification and mutation (data not shown). In addition to EBC-1 and H1993 cells, we also found EGFR basal phosphorylation in Met-amplified gastric cancer cell lines, and where tested (GTL-16 cells), EGFR phosphorylation was dependent on Met (data not shown). Thus, it seems that the relationship between amplified Met and EGFR activation may be common to Met-amplified cancer cell lines. However, the role of EGFR in the growth of Met-amplified cancer cell lines remains to be determined. Smolen et al. (14) reported that transient EGFR small interfering RNA did not affect the growth of Met-amplified SNU5 gastric cells. We observed minor growth inhibition in H1993 cells on transient shRNA knockdown of EGFR1, as well as in stable lines with EGFR knockdown, suggesting that EGFR is contributing to growth in H1993 cells (data not shown). Curiously, we were unable to significantly inhibit basal EGFR phosphorylation in Met-amplified cell lines with the EGFR inhibitor gefitinib (data not shown).
The multistep hypothesis of cancer development (27) proposes that multiple gain of function and loss of function alterations are required to transform a normal cell to malignancy. In contrast, we have shown that for a subset of Met-amplified cancer cells, cell proliferation is dependent on a single activated tyrosine kinase. However, in support of this hypothesis, we have shown that multiple oncogenic pathways are activated by Met kinase in Met amplified cell lines. Ras alleles are wild type in both EBC-1 and H1993 cells, but ras is activated similarly to the homozygous mutant K-ras in A549 cells. As described above, intense tyrosine phosphorylation of catenin family members was found only in Met-amplified cells. Finally, both EBC-1 and H1993 cell lines have a basal level of phosphorylation in EGFR1, which is dependent on Met, and which may be contributing to cell growth. Thus, amplified Met activates multiple signaling pathways that, in combination, may be sufficient for oncogenesis.
Our results and those of Smolen et al. (14) regarding Met, combined with previous work for EGFR (2831) and Her2 (32, 33), show that cancer cell lines can be dependent on a single amplified receptor tyrosine kinase for viability and growth. This requirement for growth in vitro may correlate with in vivo growth in patients. In fact, recent evidence suggests that the amplification of EGFR in lung and colon cancer is significantly associated with survival and response rates after EGFR inhibitor therapy (2, 28, 34). It will be of interest to determine whether patients with amplified Met kinase have clinical responses to Met inhibitors similar to those observed for EGFR and Her2 inhibitors in cancers with respective EGFR and Her2 amplification (2, 35).
| Acknowledgments |
|---|
We thank Bill Dahlberg for technical support. We thank Drs. Peter Blume Jensen, Chris Dinsmore, Roy Pollock, Guillermo Paez, and Wei Lu for critical reading of the article.
| Footnotes |
|---|
Current address for J.B. Gibbs: AstraZeneca Pharmaceuticals, Waltham, MA 02451.
1 S. Forbes, B. Choudhury, personal communication. ![]()
Received 9/24/06. Revised 11/15/06. Accepted 12/18/06.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. A. Milligan, P. Burke, D. T. Coleman, R. L. Bigelow, J. J. Steffan, J. L. Carroll, B. J. Williams, and J. A. Cardelli The Green Tea Polyphenol EGCG Potentiates the Antiproliferative Activity of c-Met and Epidermal Growth Factor Receptor Inhibitors in Non-small Cell Lung Cancer Cells Clin. Cancer Res., August 1, 2009; 15(15): 4885 - 4894. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ichihara, K. Ohashi, N. Takigawa, M. Osawa, A. Ogino, M. Tanimoto, and K. Kiura Effects of Vandetanib on Lung Adenocarcinoma Cells Harboring Epidermal Growth Factor Receptor T790M Mutation In vivo Cancer Res., June 15, 2009; 69(12): 5091 - 5098. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Cappuzzo, A. Marchetti, M. Skokan, E. Rossi, S. Gajapathy, L. Felicioni, M. del Grammastro, M. G. Sciarrotta, F. Buttitta, M. Incarbone, et al. Increased MET Gene Copy Number Negatively Affects Survival of Surgically Resected Non-Small-Cell Lung Cancer Patients J. Clin. Oncol., April 1, 2009; 27(10): 1667 - 1674. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Cappuzzo, P. A. Janne, M. Skokan, G. Finocchiaro, E. Rossi, C. Ligorio, P. A. Zucali, L. Terracciano, L. Toschi, M. Roncalli, et al. MET increased gene copy number and primary resistance to gefitinib therapy in non-small-cell lung cancer patients Ann. Onc., February 1, 2009; 20(2): 298 - 304. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Marek, K. E. Ware, A. Fritzsche, P. Hercule, W. R. Helton, J. E. Smith, L. A. McDermott, C. D. Coldren, R. A. Nemenoff, D. T. Merrick, et al. Fibroblast Growth Factor (FGF) and FGF Receptor-Mediated Autocrine Signaling in Non-Small-Cell Lung Cancer Cells Mol. Pharmacol., January 1, 2009; 75(1): 196 - 207. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yano, W. Wang, Q. Li, K. Matsumoto, H. Sakurama, T. Nakamura, H. Ogino, S. Kakiuchi, M. Hanibuchi, Y. Nishioka, et al. Hepatocyte Growth Factor Induces Gefitinib Resistance of Lung Adenocarcinoma with Epidermal Growth Factor Receptor-Activating Mutations Cancer Res., November 15, 2008; 68(22): 9479 - 9487. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Bachleitner-Hofmann, M. Y. Sun, C.-T. Chen, L. Tang, L. Song, Z. Zeng, M. Shah, J. G. Christensen, N. Rosen, D. B. Solit, et al. HER kinase activation confers resistance to MET tyrosine kinase inhibition in MET oncogene-addicted gastric cancer cells Mol. Cancer Ther., November 1, 2008; 7(11): 3499 - 3508. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Zucali, M. G. Ruiz, E. Giovannetti, A. Destro, M. Varella-Garcia, K. Floor, G. L. Ceresoli, J. A. Rodriguez, I. Garassino, P. Comoglio, et al. Role of cMET expression in non-small-cell lung cancer patients treated with EGFR tyrosine kinase inhibitors Ann. Onc., September 1, 2008; 19(9): 1605 - 1612. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shehata, I. Bieche, R. Boutros, J. Weidenhofer, S. Fanayan, L. Spalding, N. Zeps, K. Byth, R. K. Bright, R. Lidereau, et al. Nonredundant Functions for Tumor Protein D52-Like Proteins Support Specific Targeting of TPD52 Clin. Cancer Res., August 15, 2008; 14(16): 5050 - 5060. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kim, U. J. Lee, M. N. Kim, E.-J. Lee, J. Y. Kim, M. Y. Lee, S. Choung, Y. J. Kim, and Y.-C. Choi MicroRNA miR-199a* Regulates the MET Proto-oncogene and the Downstream Extracellular Signal-regulated Kinase 2 (ERK2) J. Biol. Chem., June 27, 2008; 283(26): 18158 - 18166. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kunii, L. Davis, J. Gorenstein, H. Hatch, M. Yashiro, A. Di Bacco, C. Elbi, and B. Lutterbach FGFR2-Amplified Gastric Cancer Cell Lines Require FGFR2 and Erbb3 Signaling for Growth and Survival Cancer Res., April 1, 2008; 68(7): 2340 - 2348. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bean, C. Brennan, J.-Y. Shih, G. Riely, A. Viale, L. Wang, D. Chitale, N. Motoi, J. Szoke, S. Broderick, et al. MET amplification occurs with or without T790M mutations in EGFR mutant lung tumors with acquired resistance to gefitinib or erlotinib PNAS, December 26, 2007; 104(52): 20932 - 20937. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. McDermott, S. V. Sharma, L. Dowell, P. Greninger, C. Montagut, J. Lamb, H. Archibald, R. Raudales, A. Tam, D. Lee, et al. Identification of genotype-correlated sensitivity to selective kinase inhibitors by using high-throughput tumor cell line profiling PNAS, December 11, 2007; 104(50): 19936 - 19941. [Abstract] [Full Text] [PDF] |
||||
![]() |
Correction: Met Dependence of Lung Cancer Cell Lines Cancer Res., April 15, 2007; 67(8): 3987 - 3987. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |