Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium  Cancer Health Disparities Conference 2009
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 67, 2114-2123, March 1, 2007. doi: 10.1158/0008-5472.CAN-06-3821
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Andrieux, L. O.
Right arrow Articles by Langouët, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Andrieux, L. O.
Right arrow Articles by Langouët, S.

Cell, Tumor, and Stem Cell Biology

GATA-1 Is Essential in EGF-Mediated Induction of Nucleotide Excision Repair Activity and ERCC1 Expression through ERK2 in Human Hepatoma Cells

Lise O. Andrieux1, Alain Fautrel1, Anne Bessard2, André Guillouzo1, Georges Baffet2 and Sophie Langouët1

1 Institut National de la Santé et de la Recherche Médicale U620, Université de Rennes I and 2 Institut National de la Santé et de la Recherche Médicale U522, Hôpital Pontchaillou, IFR 140, Rennes, France

Requests for reprints: Sophie Langouët or Andre Guillouzo, Institut National de la Santé et de la Recherche Médicale U620, 2 av du Pr Léon Bernard, 35043 Rennes Cedex, France. Phone: 33-2-23-23-48-06; Fax: 33-2-23-23-47-94; E-mail: sophie.langouet{at}rennes.inserm.fr or andre.guillouzo{at}univ-rennes1.fr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The nucleotide excision repair (NER) pathway and its leading gene excision-repair cross-complementary 1 (ERCC1) have been shown to be up-regulated in hepatocellular carcinomas even in the absence of treatment with chemotherapeutics. The aim of this study was to determine the mechanism involved in NER regulation during the liver cell growth observed in hepatocellular carcinoma. Both NER activity and ERCC1 expression were increased after exposure to the epidermal growth factor (EGF) in cultured normal and tumoral human hepatocytes. These increases correlated with the activation of the kinase signaling pathway mitogen-activated protein/extracellular signal-regulated kinase (ERK) kinase (MEK)/ERK that is known to be a key regulator in the G1 phase of the hepatocyte cell cycle. Moreover, EGF-mediated activation of ERCC1 was specifically inhibited by either the addition of U0126, a MEK/ERK inhibitor or small interfering RNA-mediated knockdown of ERK2. Basal expression of ERCC1 was decreased in the presence of the phosphoinositide-3-kinase (PI3K) inhibitor and small hairpin RNA (shRNA) against the PI3K pathway kinase FKBP12-rapamycin-associated protein or mammalian target of rapamycin. Transient transfection of human hepatocytes with constructs containing different sizes of the 5'-flanking region of the ERCC1 gene upstream of the luciferase reporter gene showed an increase in luciferase activity in EGF-treated cells, which correlated with the presence of the nuclear transcription factor GATA-1 recognition sequence. The recruitment of GATA-1 was confirmed by chromatin immunoprecipitation assay. In conclusion, these results represent the first demonstration of an up-regulation of NER and ERCC1 in EGF-stimulated proliferating hepatocytes. The transcription factor GATA-1 plays an essential role in the induction of ERCC1 through the mitogen-activated protein kinase (MAPK) pathway, whereas the PI3K signaling pathway contributes to ERCC1 basal expression. [Cancer Res 2007;67(5):2114–23]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The nucleotide excision repair (NER) pathway is a complex network of 25 polypeptides assembled in a DNA repair system for helix-disturbing lesions such as bulky DNA adducts formed by chemicals and radiation exposure (1). This pathway removes interstrand and intrastrand adducts and is also active against a variety of endogenously generated oxidative lesions (2). Excision-repair cross-complementary 1 (ERCC1) has a leading role within the NER process because of its involvement in the excision of DNA adducts (3). It acts in a complex with XPF to make the incision 5' to the lesion site (4).

Both NER activity and ERCC1 expression are increased in platinum-resistant cell lines and tumors (5). The more the cells are resistant, the more the NER is induced. Accordingly, low levels of ERCC1 mRNA are associated with increased sensitivity of cell lines to platinum and increased incidence of malignancies, such as lung, head and neck, and ovary. Similarly, a large clinical study has recently shown a close relationship between ERCC1 protein expression and cisplatin-based chemotherapy efficiency in non-small-cell lung cancer (6).

DNA damage induced by cisplatin, alkylating agents, and ionizing radiation results in the activation of c-Jun-NH2-kinase (JNK)/stress-activated protein kinase, a subfamily of mitogen-activated protein kinase (MAPK) in the Ras pathway, and enhanced transcription and expression of activated protein 1 (AP-1)–regulated genes (7, 8). The nuclear transcriptional factor AP-1 is a dimeric complex of basic leucine-zipper proteins, most often made up of either homodimers of c-Jun or heterodimers of c-Fos and c-Jun (7). The direct involvement of oncogenic H-Ras in the development of resistance of tumor cells to cisplatin and other chemotherapeutic agents and ionizing radiation has been shown in different cell lines and associated with increased DNA repair activity (9, 10). A marked up-regulation of ERCC1 by the activated H-Ras through an increase of AP-1 transcriptional activity has recently been reported in NIH3T3 and MCF-7 cells (11).

In addition to JNK, another MAPK, the extracellular signal-regulated kinase (ERK), is stimulated in response to oncogenic H-Ras and cisplatin treatment (12). ERK is essential for cell survival and division, and its functional activity is greatly increased in human hepatocellular carcinomas (HCC) compared with normal liver (13, 14). ERK is known to be activated by growth factors such as epidermal growth factor (EGF) and hepatocyte growth factor. Moreover, EGF has been reported to enhance ERCC1 expression in some tumoral cell lines (15). Recently, we found that some essential NER proteins, including ERCC1, were augmented in HCC in the absence of any treatment with chemotherapeutics, as well as in fibrotic and cirrhotic livers, especially in necroinflammatory samples, thereby suggesting that their increase could be, at least in part, related to factors other than the recognized peculiar chemoresistance of HCC (16, 17). Because cell proliferation is augmented in HCC and cirrhotic livers and DNA integrity must be controlled before its replication, we postulated that the NER is modulated during liver cell growth.

In this study, we analyzed NER activity as well as the expression of several essential NER proteins in hepatocytes treated by EGF. The results provide evidence that the phosphoinositide-3-kinase (PI3K) pathway is implicated in the basal expression of ERCC1, and that both NER activity and ERCC1 expression are augmented during hepatocyte growth mediated by EGF. ERCC1 induction is dependent on the MAP/extracellular signal-regulated kinase (ERK) kinase (MEK)/ERK pathway in the late G1 phase of the cell cycle and involves the transcriptional factor GATA-1.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemicals. U0126, LY29004, and EGF were obtained from Promega (Charbonnières, France) and DMSO was from Sigma-Aldrich (St. Louis, MO). PD98059, SB203580, and SP600125 were supplied from Calbiochem (Darmstadt, Germany).

Liver cell cultures and treatments. Human liver samples were obtained from nine patients undergoing liver resection for primary or secondary hepatomas. Access to this material was in agreement with French laws and fulfilled the requirements of the local ethics committee. Hepatocytes were isolated by a two-step perfusion procedure as previously described (18). The cells were plated at a density of 105 cells/cm2 in 60-mm-diameter dishes in 2 mL of Williams' E medium (Eurobio, Les Ulis, France) containing 2.5 mmol/L glutamine, bovine serum albumin (1 mg/mL), insulin (5 µg/mL), and penicillin (100 IU/mL)-streptomycin (100 µg/mL) and supplemented with 10% FCS (v/v). Twenty-four hours after plating, the medium was replaced with fresh medium without FCS but with 5 x 10–5 mol/L hydrocortisone hemisuccinate (Aventis, Antony, France) and renewed everyday thereafter.

HepaRG cells derived from a human hepatocarcinoma has been well characterized for their ability to mimic hepatocyte differentiation (19, 20). These cells were seeded at a density of 4 x 104 cells/cm2 in Williams' E medium containing 2.5 mmol/L glutamine, insulin (1 µg/mL), penicillin (100 IU/mL)-streptomycin (100 µg/mL) and supplemented with 10% FCS. The medium was renewed every 2 to 3 days.

Primary hepatocytes were treated with EGF (50 ng/mL) after synchronization at the restriction point, i.e., 48 h after seeding (21, 22). HepaRG cells were cultivated in serum-supplemented medium, followed by 24 h in serum-deprived medium before EGF (50 ng/mL) treatment at different times after seeding.

To efficiently inhibit the kinases, cells were pretreated with the various inhibitors dissolved in DMSO for 45 min, then exposed to EGF (50 ng/mL) from 30 min to 48 h. Control cells received the same amount of DMSO that did not exceed 0.5%.

RNA isolation and quantitation of gene products of interest. Real-time quantitative PCR (RT-qPCR) was done on total RNA extracted with SV Total RNA Isolation Kit (Promega) and with the fluorescence dye SYBR Green methodology using the PCR master mix (Applied Biosystems, Foster City, CA) on an ABI Prism 7000. Results were normalized with the relative expression of 18S. Primer pairs were ERCC1 forward, TAGCGGAGGCTGAGGAACA; ERCC1 reverse, GGCGACGTAATTCCCGACT; 18S forward, CGCCGCTAGAGGTGAAATTC; and 18S reverse, TTGGCAAATGCTTTCGCTC.

Small interfering and short hairpin RNA transfection assay. Primary human hepatocytes and HepaRG cells were plated at the density of 7 x 104 and 3 x 104 cells/cm2, respectively, in 35-mm-diameter dishes and after 48 h transfected for 5 h with 200 µL OPTIMEM, 5 µL Lipofectamine 2000 (Invitrogen, Carlsbad, CA), and 5 or 15 µL of 20 µmol/L small interfering RNA (siRNA) or 3 µg small hairpin RNA (shRNA), depending on the gene to be knocked out 48 h later. The sequences for ERK2 RNA interference were duplex 1, sense r(GUGUUGUGUCAACAAGAGCTT)dTdT; duplex 2, sense, r(CACCACCUGUGAUCUCAAGTT)dTdT. SiRNA and shRNA directed against rat ERK2 and a nucleotide sequence targeting no protein, respectively, were used as negative controls.

Total cell extract preparation. After washing in PBS, cultured cells were scraped in homogenization buffer [60 mmol/L ß-glycerophosphate, 15 mmol/L p-nitrophenylphosphate, 25 mmol/L MOPS (pH 7.2), 15 mmol/L EGTA, 15 mmol/L MgCl2, 2 mmol/L DTT, 1 mmol/L vanadate, 1 mmol/L NaF, 1 mmol/L phenylphosphate, 100 µmol/L benzamidine, protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany) supplemented with 100 µmol/L phenylmethanesulfonyl fluoride]. Samples were then centrifuged 5 min at 1,000xg, and supernatants were immediately stored at –20°C in blue loading buffer, whereas an aliquot was kept apart for protein estimation by the Bradford's method (23).

Immunoblotting analysis. Cell lysates were resolved by denaturating SDS-PAGE (10% gel). Proteins were transferred to nitrocellulose membranes and hybridized for 3 h with diluted (1:200) mouse monoclonal ERCC1 antibodies for human (Interchim, Montluçon, France) or rat (Santa Cruz Biotechnology, Heidelberg, Germany) samples, or with rabbit antiserum anti-XPF (1:1,000; kindly provided by Dr. Wim Vermeulen, Erasmus Medical Center, Rotterdam, the Netherlands), or with anti-phosphoERK antibody (1:1,000; Cell Signaling Technology, Beverly, MA) that detects phosphorylated (and, therefore, activated) ERK1/2. Hybridization with a polyclonal antibody (1:2,000) that recognizes ERK1 and ERK2 (Cell Signaling Technology) was also used to assess siRNA efficiency in inhibiting ERK2. The same blots were subsequently stripped and reprobed with either ERK1/2 or mouse monoclonal heat shock clathrin (HSC70; Santa Cruz Biotechnology) at 1:3,000 to verify equal amounts of the protein in the various samples. Blots were also hybridized with anti-p70S6K phosphorylated on residue Thr389 (1:500) or anti-phospho-p90RSK on residue Ser380 (1:1,000) antibodies (Cell Signaling Technology). Proteins were detected by the Amersham enhanced chemiluminescence kit procedure.

Reporter gene constructs and transient transfection. Several constructs containing different sizes of the ERCC1 5'-flanking region upstream the firefly luciferase gene have been used for transfections of HepaRG cells. The pERCC1-GL3 (–4,000) construct containing the 5'-flanking region (–4,000 to +1 nt) of the human ERCC1 gene upstream of the firefly luciferase reporter gene was a gift from Dr. Lars Borrmann (Center for Human Genetics, Bremen, Germany) and has been previously described (24). ERCC1 promoter fragments were PCR amplified and cloned directly into the KpnI-SacI site of luciferase reporter gene plasmid pGL3-basic (Promega). Suitable restriction sites for subcloning were generated using a reverse primer 5'-extended to encompassing the SacI restriction site: 5'-ATCGAGCTGCCGGCCTCTCTGGCCCCGCT-3'. To include the KpnI restriction site, the forward primers 5'-extended were as follows: 5'-ATCCCATGGATCTCCCATCCCAGACCTGC-3' for pERCC1-GL3(–477); 5'-ATCCCATGGGACAAGGAATATGAGCAAGC-3' for pERCC1-GL3(–730); 5'-ATCCATGGATGACCCTGGGTTATGGCAG-3' for pERCC1-GL3(–975); and 5'-ATCCCATGGTGTCCCTCACTGAACTGTAA-3' for pERCC1-GL3(–1,389).

HepaRG cells were transfected with the jetPEI kit (Polyplus, Illkirch, France). Cells were cotransfected with the pRL-SV40 vector that codes for Renilla luciferase (Promega) plus the pERCC1-GL3 constructs. Similar experiments were done with a basic control consisting of the promoterless pGL3-luciferase construct (pGL3-basic) and a pGL3-promoter plasmid containing the SV40 promoter upstream of the luciferase gene. About 100 µL of NaCl 150 mmol/L containing 1 µg of promoter construct pERCC1-GL3 along with 0.1 µg of the pRL-SV40 DNA and 2 µL of jetPEI-Gal were added to 500 µL of Williams' E medium with HepaRG cells at the density of 3 x 104 cells/cm2. One hour before transfection, cells were either treated or untreated with EGF, and incubation after transfection lasted 24 h before performing the dual luciferase assays (firefly and Renilla; Promega).

Chromatin immunoprecipitation assay. HepaRG cells, grown to subconfluence, were maintained in serum-free medium for 2 days, then exposed to 50 ng/mL EGF for 3 h. At the end of treatment, the cells were washed and cross-linked with 1% formaldehyde at room temperature for 10 min. The following steps were done essentially as previously described (25). Immunoprecipitation was done overnight with GATA-1 (R&D Systems, Minneapolis, MN), p-c-Jun (Santa Cruz Biotechnology) and Ets-1 (Santa Cruz Biotechnology) antibodies. Five microliters of DNA preparations were subjected to amplification by using the primers 5'-GACAAGGAATATGAGCAAGC-3' (forward primer) and 5'-GCAGGTCTGGGATGGGAGAT-3' (reverse primer) corresponding to the region –730/–458 of the ERCC1 promoter.

Host cell reactivation assay. HepaRG cells at 3 x 104 cells/cm2 were transfected with the jetPEI kit (Polyplus). Before transfection, luciferase reporter gene plasmids were damaged with increasing UV doses (J/cm2; Biolink, Vilber Lourma, Marne-la-Vallée, France). A total of 500 µL of transfection medium (serum-free Williams' E medium) containing 1 µg of luciferase reporter plasmid were added to HepaRG cells, along with 0.1 µg of the pRL-SV40 DNA and 4 µL of jetPEI-Gal. One hour after transfection, cells were either treated or untreated with EGF and incubated for 24 h. Dual luciferase assays were then done.

Flow cytometer analysis. One day after seeding, serum-supplemented medium was discarded and replaced by fresh serum-deprived medium for the following 24 h. For proliferation assays with synchronized cells, HepaRG cells were either treated or untreated with EGF for 7 to 24 h. DNA stained with propidium iodide (CycleTest Plus DNA reagent kit; BD Biosciences, San Jose, CA) was then quantitated through the FACScalibur flow cytometer. Each measurement was conducted on 10,000 events and analyzed on Cell Quest and Modfit Mac V2 Softwares (BD Biosciences).

Statistical analysis. Data are presented as the mean ± SD. The statistical analyses were carried out using Student's t test with Statistica software program (StatSoft, Maisons-Alfort, France). A P value <0.05 was considered as statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
EGF increases NER activity in human hepatoma HepaRG cells. First, the influence of EGF on HepaRG cell proliferation activity was estimated by treating the cells with 50 ng/mL EGF for either 7, 12, 24, or 30 h. HepaRG cells were used 2 days after plating and arrested in the G1 phase by a 24-h serum starvation before either addition of the growth factor or not. In control culture, only 3.8 ± 1.8% cells were found in the S phase as measured by flow cytometry analysis (Fig. 1A ). Interestingly, in EGF-treated cultures, the percentage of S phase reached 22 ± 2% after a 24-h treatment. A stimulating effect was no longer observed after 30 h of treatment.


Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
Figure 1. Effects of EGF on cell proliferation and NER activity in HepaRG cell cultures. A, HepaRG cells were cultivated for 2 d in serum-supplemented medium, followed by 1 d in serum-deprived medium, which led to the accumulation of cells in the G1 phase of the cell cycle (0 h). They were then exposed to EGF (50 ng/mL) for different times. The percentages of S phases were determined by flow cytometry. B, NER activity was measured by the host cell reactivation assay. Two days after plating, the cells were exposed to EGF and transfected with plasmids containing a luciferase reporter gene and damaged with various UV doses (J/cm2) for 24 h. Results are expressed as percent luciferase activity. Columns, means of three independent experiments; bars, SD. *, P < 0.05 and **, P < 0.01 (Statistica software program).

 
Second, to estimate the effect of EGF on NER activity, the host cell reactivation assay was done. The cells were transfected with UV-damaged plasmids containing a luciferase reporter gene unable to express luciferase activity unless repaired by NER. A dose response was evidenced in control cells transfected with the differently damaged plasmids: the more the plasmids were irradiated, the less the luciferase reporter gene was expressed. Twenty-four–hour EGF-treated cells exhibited a significant enhanced repair of UV-damaged plasmid after an irradiation of 0.08 J/cm2 (Fig. 1B).

NER increase is correlated with ERCC1 expression. To further elucidate the mechanism by which EGF increased NER activity in HepaRG cells, we analyzed the expression of the main enzymes involved in the NER machinery. The levels of mRNA encoding XPA, XPB, XPC, XPD, XPF, XPG, ERCC1, CSA, CSB, and hHR23B were estimated in proliferating HepaRG cells (3 days after seeding) using the RT-qPCR approach. Interestingly, only ERCC1 mRNA levels were significantly augmented after EGF treatment (Table 1 ). The increase was evidenced at the mRNA and protein levels after 3 h, peaked after 7 to 12 h, and was still significant after 24 h (Fig. 2A and B ). Because EGF is known to stimulate cell proliferation through the activation of the MAPK pathway, phosphorylation of ERK was studied by immunoblotting. Phosphorylated ERK was shown as early as 30 min after EGF treatment and was still observed after 24 h (Fig. 2B).


View this table:
[in this window]
[in a new window]

 
Table 1. Effects of EGF on NER gene expression

 

Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
Figure 2. Induction of ERCC1 expression by EGF in HepaRG cells. HepaRG cells were cultivated for 2 d in serum-supplemented medium, followed by 1 d in serum-deprived medium, and then treated with EGF either from 0.5 to 48 h (A and B) or for 7 h at different times after plating (C and D). A and C, ERCC1 transcripts measured by RT-qPCR. ERCC1 values of EGF-treated cells are expressed as a ratio to those of corresponding controls. Data were normalized to the mean level of expression in control cells arbitrarily set at 1. Student's t test was applied for statistical analysis between control and EGF-treated cells. *, P < 0.05; **, P < 0.01; and ***, P < 0.001. B and D, ERCC1, P-ERK, XPF, ERK-T, and HSC70 immunoblots of control and EGF-stimulated cells. Western blots were probed with specific antibodies as described in Experimental Procedures. The results are representative of one experiment reproduced thrice.

 
Because a 7-h treatment with EGF seemed to be optimal for ERCC1 increase at both mRNA and protein levels as well as for ERK activation in our culture conditions, this duration of treatment was selected to study the EGF effect on HepaRG cells at different times of culture. As illustrated in Fig. 2C and D, EGF increased ERCC1 mRNA and protein levels, whether the cells were treated 1, 3, or 6 days after seeding corresponding to 19%, 13%, and 6% of cells in S phase, respectively (data not shown). No change was observed in XPF protein content after EGF treatment (Fig. 2D).

ERCC1 increase by EGF is related to MAPK MEK/ERK. In standard culture conditions, primary human hepatocytes are blocked in the G1 phase. To determine whether ERCC1 was also increased in dividing normal adult human hepatocytes, nine distinct primary human hepatocyte populations were treated with EGF for 7 h. In all experiments, ERCC1 mRNA levels were found to be augmented in cell populations stimulated by the growth factor (Fig. 3A ). The increase factor ranged between 2 and 8, and when the median increase factor was compared with that measured in HepaRG cells, it was found to be similar in both cultures (4.0 versus 3.3). ERCC1 increase was confirmed at the protein level in EGF-treated human hepatocytes by immunoblotting (Fig. 3B).


Figure 3
View larger version (21K):
[in this window]
[in a new window]

 
Figure 3. Inhibition of ERCC1 mRNA induction by EGF in different human hepatocyte populations by U0126, a specific MEK/ERK inhibitor. Primary human hepatocytes were treated for 7 h with EGF alone ({blacksquare}), U0126 alone (Figure 3), or both EGF and U0126 (Figure 3). U0126 was added 45 min before EGF treatment as described in Experimental Procedures. A, mRNA ERCC1 levels measured by RT-qPCR. ERCC1 values of treated cells are expressed as a ratio to those of corresponding controls in nine human hepatocyte populations. B, ERCC1, ERK-T, phosphorylated ERK (P-ERK), phosphorylated P90RSK (P-P90RSK), and HSC70 immunoblots of three representative experiments. Western blots were probed with specific antibodies as described in Experimental Procedures.

 
EGF has a broad specificity on MAPK pathways. It can activate p38 and JNK pathways that are implied in stress signaling and apoptosis as well as MEK/ERK and another kinase pathway, PI3K, that are involved in cell survival and proliferation of hepatocytes.

To characterize the role of these kinases, ERCC1 induction upon an EGF treatment of human hepatocytes was assessed in the presence of specific inhibitors of the different pathways (Table 2 ). SB203580 (5 µmol/L) and SP600125 (15 µmol/L), used to block, respectively, the p38 and JNK pathways, did not prevent ERCC1 induction by EGF. By contrast, preventing MEK/ERK activation by EGF with two specific inhibitors, U0126 (50 µmol/L) and PD98059 (75 µmol/L), led to a strong reduction of ERCC1 mRNA induction. This effect was more important with U0126 likely due to a higher stability and efficacy of this compound toward MEK/ERK inhibition (26). Interestingly, inhibition of the PI3K pathway by LY29004 (10 µmol/L) resulted in a decrease of ERCC1 basal expression and, consequently, a decrease of ERCC1 mRNA levels in cells treated with EGF (Table 2). Involvement of the MEK/ERK pathway in ERCC1 mRNA induction by EGF was confirmed in nine independent primary human hepatocyte populations by both RT-qPCR and immunoblotting using U0126 as a specific inhibitor (Fig. 3A and B).


View this table:
[in this window]
[in a new window]

 
Table 2. Effects of MAPK and PI3K inhibitors on ERCC1 mRNA induction by EGF

 
Second, we extend our results to human tumoral hepatocytes in which U0126 treatment led to an inhibition of ERCC1 mRNA and protein levels. To confirm the influence of the MEK/ERK pathway on ERCC1 expression, we used two distinct sequence-specific siRNAs, allowing to specifically inhibit ERK2, the main isoform increased by EGF. Our results showed that ERCC1 transcripts were no longer activated by EGF in HepaRG cells when ERK2 was inhibited with either D1 or D2 duplex (Fig. 4A ); this finding was confirmed by immunoblotting (Fig. 4B). The same observation was made with primary human hepatocytes (data not shown).


Figure 4
View larger version (19K):
[in this window]
[in a new window]

 
Figure 4. Influence of siERK2 and shFRAP-mTOR on ERCC1 expression in EGF-stimulated HepaRG cells. Nonconfluent HepaRG cells were transfected for 5 h with no (–siRNA) or 100 nmol/L siRNA control, siERK2 duplex 1 (siERK2 D1) or duplex 2 (siERK2 D2). Serum-deprived medium was renewed for 48 h; then cells were treated for 7 h with EGF. A, ERCC1 mRNA expression was analyzed by RT-qPCR. Data were normalized to the mean level of expression in control cells equal to 1. **, P < 0.01, statistical significance from the control. B, ERCC1, ERK-T, phosphorylated P90RSK (P-P90RSK), phosphorylated P70S6K (P-P70S6K), and HSC70 immunoblots were probed with specific antibodies as described in Experimental Procedures. C, Western blot analysis of ERCC1, FRAP-mTOR, and HSC70 expression in human hepatocytes transfected with two shRNA against FRAP-mTOR (shmTORA1 and shmTORA2), EGF receptor (sh EGFR) or small hairpin control and treated with EGF during 7 h, 48 h after the transfection.

 
Moreover, phosphorylation of p90RSK, recognized to be activated by ERK1 and 2 in response to growth factors (27), decreased in the presence of siERK2 (Fig. 5B ). Similarly, phospho-p70S6K diminished when ERK2 was abolished, confirming that p70S6K is located downstream ERK2 in both human hepatoma cells and normal hepatocytes (Fig. 4B; ref. 28).


Figure 5
View larger version (17K):
[in this window]
[in a new window]

 
Figure 5. Identification of the transcription factor implicated in ERCC1 induction by EGF. A, localization of the promoter region of ERCC1 gene involved in its induction by EGF and schematic representation of the transcription factor binding sites in the ERCC1 promoter potentially involved in the induction of the gene by EGF. HepaRG cells were transfected with plasmids carrying the pGL3 basic or different deletions of the promoter of ERCC1 upstream a luciferase reporter gene: pERCC1-GL3 (–477), pERCC1-GL3 (–730), pERCC1-GL3 (–975) and pERCC1-GL3 (–1,389). Cells were transfected and cotreated with EGF for 24 h before measurement of luciferase activity. The values represent the mean ± SD of three determinations. B, chromatin immunoprecipitation analysis of GATA-1, Ets-1, and c-Jun binding on the human ERCC1 promoter. Fragmented chromatins of HepaRG cells treated or untreated with EGF were immunoprecipitated by the addition of GATA-1–, Ets-1–, or c-Jun–specific antibodies or nonspecific anti-immunoglobulin G. Recovered DNA was subjected to PCR using primers corresponding to the ERCC1 promoter region between –730 and –477. The input chromatin from untreated and treated cells was also amplified by PCR (Input) to compare the relative amounts of chromatin used in immunoprecipitation. The data are representative of three similar experiments. C, loss of increase in ERCC1 promoter activity with mutated GATA-1 sequence. HepaRG cells were transfected with either pERCC1-GL3 (–730; GATA-1 wt) or pERCC1-GL3 (–730 containing GATA-1 mutation; GATA-1 m) and treated or untreated with EGF. Results are expressed as luciferase activity and correspond to the mean of three independent experiments. D, chromatin immunoprecipitation analysis of GATA-1 binding on the human ERCC1 promoter in HepaRG cells treated or untreated with EGF in the presence or absence of U0126.

 
To establish the influence of the PI3K pathway in basal and EGF-induced ERCC1 expression, human hepatocarcinoma cells HuH7 were transfected with two distinct shRNA directed against FKBP12-rapamycin-associated protein or mammalian target of rapamycin (FRAP/mTOR), a protein kinase of the PI3K signaling pathway (29). Western blot analysis showed a 60% decrease in FRAP/mTOR expression in the presence of shRNA, compared with hepatocytes treated with control-shRNA (Fig. 4C). In the presence of FRAP/mTOR shRNA, ERCC1 basal expression highly decreased. Induction by EGF still occurred at a lower extent than in corresponding control cells. Taken altogether, these results showed that ERK2 is essential for ERCC1 increase by EGF, whereas the PI3K pathway plays a role in basal expression of ERCC1. Interestingly, as a positive control, shRNA against the EGF receptor completely blocked ERCC1 induction by EGF but not basal expression (Fig. 4C), confirming the crucial role of the EGF receptor in the induction of ERCC1 mediated by EGF.

Mechanisms involved in ERCC1 mRNA increase by EGF. To further understand the mechanisms of ERCC1 induction by EGF, we first determined whether an active transcriptional activity was required. Human hepatocytes were cotreated with actinomycin (3 µg/mL) and EGF for 7 h. No ERCC1 mRNA induction was detected in the three different cell populations exposed to actinomycin (data not shown).

To determine whether regulatory sequences present in the 5'-flanking region of the ERCC1 gene were involved in its transcriptional activation, a series of constructs containing different deletions of the ERCC1 promoter upstream the luciferase reporter gene was transfected in HepaRG cells. Transfection with a pERCC1-GL3 (–4,000) led to a 5-fold induction after a 24-h EGF treatment (data not shown). The pERCC1-GL3 (–1,389), pERCC1-GL3 (–975), and pERCC1-GL3 (–730) constructs containing the corresponding 5'-flanking regions of the ERCC1 promoter upstream of the firefly luciferase reporter gene and obtained after successive deletions of the ERCC1 5'-flanking region also led to a significant induction (Fig. 5A). By contrast, a nearly complete loss of activity was observed with the pERCC1-GL3 (–477) construct, suggesting that the region between –477 and –730 contains some regulatory sequences essential for ERCC1 responsiveness to EGF in human hepatocytes. This region is also implicated in the basal expression of ERCC1 as a high drop was observed between the two constructs. A myeloid zinc finger 1 (MZF1) transcription factor is also localized at position –509 to –503 but does not seem to be implicated in this decrease contrary to the other one at position –324 to 298 recently reported to repressively regulate ERCC1 expression upon cisplatin exposure in ovarian cancer cells (30). Moreover, the decrease was much higher in hepatic cells than in HeLa cells (data not shown); this could be due to the presence of the hepatospecific sequence HNF1 at position –584/–591.

Analysis of human ERCC1 promoter sequence with TFSEARCH (31) led to identify several transcription factor motifs that could be activated by the MEK/ERK pathway. In particular, that region contains two Ets-1 motifs located from –541 to –550 (nt 23,079–23,088; M63796) and from –598 to –606 (nt 23,136–23,145; M63796), one GATA-1 motif located from –491 to –499 (nt 23,030–23,040; M63796), and two AP-1 motifs located from –591 to –600 (nt 23,129–23,136; M63796) and from –515 to –523 (nt 23,054–23,062; M63796), suggesting that at least one of these three factors is involved in ERCC1 regulation by EGF (Fig. 5A). Consequently, to determine whether AP-1, Ets-1, or GATA-1–binding sequences were involved in the transcriptional activation of the ERCC1 gene after EGF treatment, we did a chromatin immunoprecipitation (ChIP) assay using corresponding specific antibodies and a nonspecific immunoglobulin G as a negative control (Fig. 5B). An increase of a specific PCR product corresponding to GATA-1 was readily detected, whereas no change was evidenced in c-Jun and Ets-1 PCR products after EGF treatment, thereby suggesting that only GATA-1 is involved in ERCC1 induction mediated by EGF through the MAPK pathway. To confirm this result, pERCC1-GL3 (–730) mutated in the GATA-1 binding site was transfected in HepaRG cells, and as illustrated in Fig. 5C, ERCC1 induction by EGF was totally suppressed. Moreover, the presence of U0126 completely abolished GATA-1 binding to ERCC1 promotor, confirming the implication of MEK/ERK pathway in ERCC1 induction (Fig. 5D).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present report, we show that both NER activity and expression of ERCC1 increased in both normal and tumoral human hepatocytes induced to proliferate under stimulation by EGF. The increase seems to be directly correlated to the activation of the MEK/ERK pathway and the transcriptional factor GATA-1.

The peak of NER increase occurred after a 7-h treatment with EGF of normal adult hepatocytes corresponding to mid-late G1 phase and paralleling increased activation of the MERK/ERK signaling pathway (21). It is well known that the late G1 progression and commitment to DNA replication are controlled by growth factors, such as EGF, through the activation of the MERK/ERK pathway that allows hepatocytes to cross the restriction point. Similarly, an increase in NER activity and ERCC1 expression was observed in vivo around 8 to 10 h after partial hepatectomy in synchronized rat regenerating hepatocytes (late G1 phase; data not shown). The increase of ERCC1 occurring in the late G1 phase might be essential to eliminate DNA adducts before the S phase to avoid nucleotide misincorporations and, consequently, possible mutations in DNA. Further investigations would be necessary to clarify this mechanism of induction in the presence of DNA adducts and to characterize ERCC1 regulation during the other cell cycle phases, especially the G2-M transition. All these results, which are totally supported by those obtained with HepaRG cells, favor the conclusion that NER is up-regulated during hepatocyte growth stimulated by growth factor, whether the cells are normal or transformed. The increase in NER activity and ERCC1 expression by EGF treatment is therefore not specific of tumoral hepatocytes. However, it must be borne in mind that although in normal adult liver, hepatocytes are quiescent, in HCC they are in a growing state, and the MEK/ERK signaling pathway is constantly activated (14), making our present observations in total agreement with those showing ERCC1 up-regulation in HCC compared with normal liver in vivo (16).

To more precisely investigate the regulation of NER capacity during hepatocyte proliferation, the main rate-limiting proteins were analyzed. Among the seven essential NER transcripts studied in proliferating normal and tumoral hepatocytes, only the expression of ERCC1 was up-regulated in parallel to NER activity. Even XPF that forms an heterodimer with ERCC1 remained unchanged, leading to the conclusion that ERCC1 could be rate limiting in the NER process and consequently directly related to hepatocyte growth. The absence of any change in XPF content is supported by the fact that only a low XPF amount is required for ERCC1 activity (32). These observations contrast with those reported in various cell lines and tumors resistant to platinum-based chemotherapeutic agents as well as in fibrotic/cirrhotic livers and hepatocellular carcinoma in which additional NER proteins were also found to be increased (16, 17, 33, 34). Such discrepancies are unclear and they could be explained by the involvement of factors other than EGF-stimulated growth activity in the induction of NER proteins, in particular a production of reactive oxygen species and/or proinflammatory mediators in the in vivo situations. Further studies are required to clarify this point.

MEK/ERK and PI3K are the two major signaling cascades controlling the mitogenic response of hepatocytes to growth factors, whereas JNK and p38 are rather linked to stress signaling and apoptosis. To show the direct involvement of these kinases in ERCC1 regulation, specific inhibitors were used. The specific inhibitors, U0126 and PD98059, for MERK/ERK prevented ERCC1 induction. Addition of SP600125 and SB203580, specific inhibitors of, respectively, JNK and p38 pathways, was without effect, whereas LY29004, a PI3K inhibitor, decreased the basal level of ERCC1. The implication of ERK2 in ERCC1 induction was confirmed by the inhibition of this regulation in liver cells transfected with siRNA ERK2. Furthermore, we confirmed that the PI3K pathway decreased ERCC1 basal expression by using shRNA against FRAP/mTOR, a key kinase involved in this pathway (28, 29). These findings led to the conclusion that mostly ERK2 regulated the growth factor induction of ERCC1 expression in proliferating normal and tumoral hepatocytes, whereas the PI3K pathway was mainly involved in ERCC1 basal expression.

In cisplatin-resistant cell lines, ERCC1 was found to be markedly augmented by activated H-Ras through an increase in AP-1 transcriptional activity and a direct interaction of c-Jun and c-Fos to AP-1 binding sites of the ERCC1 promoter (11). Two AP-1 motifs were found to be crucial, a distal one, identical to our –515 to –523 sequence, and a proximal one located from –362 to –368. A mutation in either motif resulted in a 40% inhibition, whereas a double mutation gave a marked inhibition reaching 80% in NIH3T3 and MCF7 cells. In HepaRG cells, transfection experiments with constructs containing successive deletions of the ERCC1 gene 5'-flanking region clearly indicated that most of the responsiveness of ERCC1 promoter to EGF was located between –730 and –477, showing that the proximal AP-1 motif was not involved. Based on our ChIP experiments, the distal AP-1 motif seemed to be similarly not implicated. These results led us to postulate that the increase in NER activity and ERCC1 expression in EGF-stimulated hepatocytes results from a different mechanism from that occurring in cisplatin-resistant nonhepatic tumoral cells. This idea has been reinforced by recent data demonstrating a synergistic interaction between the transcription factors AP-1 (–375 to –355) and MZF1 (–324 to –298); such an effect is responsible for ERCC1 promoter activity activation upon cisplatin exposure in ovarian cancer cell lines (30) and seems not implicated in ERCC1 regulation by EGF.

The ERCC1 promoter region between –730 and –477 contains several binding sites for other transcriptional factors including two Ets-1 and one GATA-1. Ets-1 has been shown to be correlated with increased cisplatin resistance and to activate various genes, including ERCC1, in human ovarian carcinoma cells (35). Moreover, a synergic action with c-Fos on different target genes has been suggested (36), and this factor has also been reported to be a potential target for reactive oxygen species and to be regulated by growth factors. ChIP experiments did not support the involvement of Ets-1 in ERCC1 induction in EGF-treated hepatocytes.

GATA-1 belongs to a family of transcriptional factors with two conserved zinc finger DNA-binding motifs and currently comprising six members (37). It is abundantly expressed and regulates the transcription of many cell cycle genes in erythroid cells (38). Little knowledge exists regarding its involvement in the regulation of human liver genes; however, it has been shown to regulate the expression of the HFE gene (39). Our results using the ChIP approach and mutant GATA-1 clearly show that GATA-1 plays an essential role in EGF-mediated induction of ERCC1 through the MAPK signaling pathway. This conclusion is in agreement with a recent report showing that GATA-1 is a MAPK substrate in hematopoietic cell lines and contains at least six constitutive phosphorylation sites (40). It is, moreover, supported by our recent observation that GATA-1 protein content is also increased by EGF in HepaRG cells (data not shown). In addition, ERCC1 mRNA induction by EGF was also abolished by LY29004, a specific inhibitor of the PI3K/AKT pathway, suggesting that GATA-1 is similarly a PI3K substrate, as recently shown in erythroid cells (41). All these observations lead to the conclusion that GATA-1 can be activated by both the MERK/ERK and the PI3K signaling pathways in hepatocytes. Further studies are, however, needed to dissect the PI3K implication and to identify the sites of phosphorylation in GATA-1 implicated in ERCC1 induction through the two kinase pathways.

The present study shows that NER was increased by EGF independently of any exogenous genotoxic stress in growing normal and tumoral hepatocytes. Moreover, ERCC1 knock-out mice display features of senescence, profound cell abnormalities in the liver including accelerated hepatocyte polyploidy, the level of ploidy being the same in 3-week-old ERCC1–/– mice as in 2-year-old wild-type mice, and blockage of hepatocytes in the G2 phase (42), and die before weaning from liver failure (42, 43). They are also infertile and show increased levels of DNA strand breaks and oxidative DNA damage in the testis (44). Moreover, reduction of the ratio of chromatid exchanges to breaks in ERCC1-deficient cell lines has been attributed to the loss of the recombination repair process rather than the NER (45). Indeed, unlike other NER proteins, ERCC1 and XPF are also involved in the recombination repair pathways distinct from NER (46, 47). It has been shown that DNA double strand breaks (DSB) can arise from aborted stalled replication fork, and that interstrand cross-links occurring during normal metabolism or cancer chemotherapy can form DSB through progression in the S phase (48, 49). Interstrand cross-links–induced DSB require ERCC1/XPF to be repaired (48, 50). Consequently, it may be postulated that ERCC1 increases during EGF-stimulated liver cell growth could favor repair of DNA lesions by NER before replication and by recombination during the replication phase. On this basis, NER and ERCC1 increase could be interpreted as a protective response of the hepatocytes to the risk of DNA damage before replication and the ERCC1 increase as not exclusively related to NER augmentation.

To our best knowledge, our results represent the first demonstration of a direct correlation between cell proliferation stimulated by a growth factor and up-regulation of NER activity and ERCC1 expression and provide evidence that ERCC1 increase is related to the activation of MEK/ERK. Moreover, whereas AP-1, known to be activated by factors other than growth factors, such as oxidative stress, as well as Ets-1 have been shown to be implicated in ERCC1 increase during cisplatin-based chemotherapy and exposure of cell lines to cisplatin, another transcriptional factor, GATA-1, seems to be primarily involved in ERCC1 induction through the MAPK pathway.


    Acknowledgments
 
Grant support: Institut National de la Sante et de la Recherche Medicale, the Association pour la Recherche sur le Cancer (ARC) contract numbers 7764 and 3209, Ligue contre le Cancer-Comité d'Ille et Vilaine, Fondation Langlois, Ministère délégué à la Recherche (L.O. Andrieux), and the region Bretagne/INSERM (A. Bessard).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Pr. O. Coqueret for his help with the chromatin immunoprecipitation assay, Dr. B. Drenou for flow cytometry advices, the "Centre de Ressources Biologiques" of Rennes (CHU Pontchaillou) for providing human primary hepatocytes, Transat (Lyon) and the French "Ligue Nationale Contre le Cancer" for giving us the human FRAP-mTOR shRNAs, and Dr. F. Morel for critical reading of the manuscript.


    Footnotes
 
Note: L.O. Andrieux and A. Fautrel contributed equally to this study.

Received 10/16/06. Revised 12/ 4/06. Accepted 12/14/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. de Laat WL, Jaspers NG, Hoeijmakers JH. Molecular mechanism of nucleotide excision repair. Genes Dev 1999;13:768–85.[Free Full Text]
  2. de Boer J, Hoeijmakers JH. Nucleotide excision repair and human syndromes. Carcinogenesis 2000;21:453–60.[Abstract/Free Full Text]
  3. de Laat WL, Appeldoorn E, Jaspers NG, Hoeijmakers JH. DNA structural elements required for ERCC1-XPF endonuclease activity. J Biol Chem 1998;273:7835–42.[Abstract/Free Full Text]
  4. Evans E, Moggs JG, Hwang JR, Egly JM, Wood RD. Mechanism of open complex and dual incision formation by human nucleotide excision repair factors. EMBO J 1997;16:6559–73.[CrossRef][Medline]
  5. Ferry KV, Hamilton TC, Johnson SW. Increased nucleotide excision repair in cisplatin-resistant ovarian cancer cells: role of ERCC1-XPF. Biochem Pharmacol 2000;60:1305–13.[CrossRef][Medline]
  6. Olaussen KA, Dunant A, Fouret P, et al. DNA repair by ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant chemotherapy. N Engl J Med 2006;355:983–91.[Abstract/Free Full Text]
  7. Karin M. The regulation of AP-1 activity by mitogen-activated protein kinases. J Biol Chem 1995;270:16483–6.[Free Full Text]
  8. Liu ZG, Baskaran R, Lea-Chou ET, et al. Three distinct signalling responses by murine fibroblasts to genotoxic stress. Nature 1996;384:273–6.[CrossRef][Medline]
  9. Isonishi S, Hom DK, Thiebaut FB, et al. Expression of the c-Ha-ras oncogene in mouse NIH 3T3 cells induces resistance to cisplatin. Cancer Res 1991;51:5903–9.[Abstract/Free Full Text]
  10. Yen L, Nie ZR, You XL, Richard S, Langton-Webster BC, Alaoui-Jamali MA. Regulation of cellular response to cisplatin-induced DNA damage and DNA repair in cells overexpressing p185(erbB-2) is dependent on the ras signaling pathway. Oncogene 1997;14:1827–35.[CrossRef][Medline]
  11. Youn CK, Kim MH, Cho HJ, et al. Oncogenic H-Ras up-regulates expression of ERCC1 to protect cells from platinum-based anticancer agents. Cancer Res 2004;64:4849–57.[Abstract/Free Full Text]
  12. Persons DL, Yazlovitskaya EM, Cui W, Pelling JC. Cisplatin-induced activation of mitogen-activated protein kinases in ovarian carcinoma cells: inhibition of extracellular signal-regulated kinase activity increases sensitivity to cisplatin. Clin Cancer Res 1999;5:1007–14.[Abstract/Free Full Text]
  13. Schmidt CM, McKillop IH, Cahill PA, Sitzmann JV. Increased MAPK expression and activity in primary human hepatocellular carcinoma. Biochem Biophys Res Commun 1997;236:54–8.[CrossRef][Medline]
  14. Ito Y, Sasaki Y, Horimoto M, et al. Activation of mitogen-activated protein kinases/extracellular signal-regulated kinases in human hepatocellular carcinoma. Hepatology 1998;27:951–8.[CrossRef][Medline]
  15. Yacoub A, McKinstry R, Hinman D, Chung T, Dent P, Hagan MP. Epidermal growth factor and ionizing radiation up-regulate the DNA repair genes XRCC1 and ERCC1 in DU145 and LNCaP prostate carcinoma through MAPK signaling. Radiat Res 2003;159:439–52.[CrossRef][Medline]
  16. Fautrel A, Andrieux L, Musso O, Boudjema K, Guillouzo A, Langouet S. Overexpression of the two nucleotide excision repair genes ERCC1 and XPC in human hepatocellular carcinoma. J Hepatol 2005;43:288–93.[CrossRef][Medline]
  17. Zindy P, Andrieux L, Bonnier D, et al. Upregulation of DNA repair genes in active cirrhosis associated with hepatocellular carcinoma. FEBS Lett 2005;579:95–9.[CrossRef][Medline]
  18. Guguen C, Guillouzo A, Boisnard M, Le Cam A, Bourel M. Ultrastructural study of monolayer hepatocytes in adult rat cultures in the presence of hydrocortisone hemisuccinate. Biol Gastroenterol (Paris) 1975;8:223–31.
  19. Gripon P, Rumin S, Urban S, et al. Infection of a human hepatoma cell line by hepatitis B virus. Proc Natl Acad Sci U S A 2002;99:15655–60.[Abstract/Free Full Text]
  20. Aninat C, Piton A, Glaise D, et al. Expression of cytochromes P450, conjugating enzymes and nuclear receptors in human hepatoma HepaRG cells. Drug Metab Dispos 2006;34:75–83.[Abstract/Free Full Text]
  21. Talarmin H, Rescan C, Cariou S, et al. The mitogen-activated protein kinase kinase/extracellular signal-regulated kinase cascade activation is a key signalling pathway involved in the regulation of G(1) phase progression in proliferating hepatocytes. Mol Cell Biol 1999;19:6003–11.[Abstract/Free Full Text]
  22. Rescan C, Coutant A, Talarmin H, et al. Mechanism in the sequential control of cell morphology and S phase entry by epidermal growth factor involves distinct MEK/ERK activations. Mol Biol Cell 2001;12:725–38.[Abstract/Free Full Text]
  23. Bradford MA. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248–54.[CrossRef][Medline]
  24. Borrmann L, Schwanbeck R, Heyduk T, et al. High mobility group A2 protein and its derivatives bind a specific region of the promoter of DNA repair gene ERCC1 and modulate its activity. Nucleic Acids Res 2003;31:6841–51.[Abstract/Free Full Text]
  25. Barre B, Vigneron A, Coqueret O. The STAT3 transcription factor is a target for the Myc and riboblastoma proteins on the Cdc25A promoter. J Biol Chem 2005;280:15673–81.[Abstract/Free Full Text]
  26. Favata MF, Horiuchi KY, Manos EJ, et al. Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J Biol Chem 1998;273:18623–32.[Abstract/Free Full Text]
  27. Frodin M, Gammeltoft S. Role and regulation of 90 kDa ribosomal S6 kinase (RSK) in signal transduction. Mol Cell Endocrinol 1999;151:65–77.[CrossRef][Medline]
  28. Bessard A, Coutant A, Rescan C, et al. An MLCK-dependent window in late G1 controls S phase entry of proliferating rodent hepatocytes via ERK-p70S6K pathway. Hepatology 2006;44:152–63.[CrossRef][Medline]
  29. Peterson RT, Beal PA, Comb MJ, Schreiber SL. FKBP12-rapamycin-associated protein (FRAP) autophosphorylates at serine 2481 under translationally repressive conditions. J Biol Chem 2000;275:7416–23.[Abstract/Free Full Text]
  30. Yan QW, Reed E, Zhong XS, Thornton K, Guo Y, Yu JJ. MZF1 possesses a repressively regulatory function in ERCC1 expression. Biochem Pharmacol 2006;71:761–71.[CrossRef][Medline]
  31. Heinemeyer T, Wingender E, Reuter I, et al. Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 1998;26:362–7.[Abstract/Free Full Text]
  32. Gaillard PH, Wood RD. Activity of individual ERCC1 and XPF subunits in DNA nucleotide excision repair. Nucleic Acids Res 2001;29:872–9.[Abstract/Free Full Text]
  33. Damia G, Guidi G, D'Incalci M. Expression of genes involved in nucleotide excision repair and sensitivity to cisplatin and melphalan in human cancer cell lines. Eur J Cancer 1998;34:1783–8.[CrossRef][Medline]
  34. Welsh C, Day R, McGurk C, Masters JR, Wood RD, Koberle B. Reduced levels of XPA, ERCC1 and XPF DNA repair proteins in testis tumor cell lines. Int J Cancer 2004;110:352–61.[CrossRef][Medline]
  35. Wilson LA, Yamamoto H, Singh G. Role of the transcription factor Ets-1 in cisplatin resistance. Mol Cancer Ther 2004;3:823–32.[Abstract/Free Full Text]
  36. Logan SK, Garabedian MJ, Campbell CE, Werb Z. Synergistic transcriptional activation of the tissue inhibitor of metalloproteinases-1 promoter via functional interaction of AP-1 and Ets-1 transcription factors. J Biol Chem 1996;271:774–82.[Abstract/Free Full Text]
  37. Evans T, Felsenfeld G. The erythroid-specific transcription factor Eryf1: a new finger protein. Cell 1989;58:877–85.[CrossRef][Medline]
  38. Tsai SF, Martin DI, Zon LI, D'Andrea AD, Wong GG, Orkin SH. Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells. Nature 1989;339:446–51.[CrossRef][Medline]
  39. Mura C, Le Gac G, Jacolot S, Ferec C. Transcriptional regulation of the human HFE gene indicates high liver expression and erythropoiesis coregulation. FASEB J 2004;18:1922–4.[Abstract/Free Full Text]
  40. Yu YL, Chiang YJ, Chen YC, et al. MAPK-mediated phosphorylation of GATA-1 promotes Bcl-XL expression and cell survival. J Biol Chem 2005;280:29533–42.[Abstract/Free Full Text]
  41. Zhao W, Kitidis C, Fleming MD, Lodish HF, Ghaffari S. Erythropoietin stimulates phosphorylation and activation of GATA-1 via the PI3-kinase-AKT signaling pathway. Blood 2006;107:907–15.[Abstract/Free Full Text]
  42. Chipchase MD, O'Neill M, Melton DW. Characterization of premature liver polyploidy in DNA repair (Ercc1)-deficient mice. Hepatology 2003;38:958–66.[CrossRef][Medline]
  43. Nunez F, Chipchase MD, Clarke AR, Melton DW. Nucleotide excision repair gene (ERCC1) deficiency causes G(2) arrest in hepatocytes and a reduction in liver binucleation: the role of p53 and p21. FASEB J 2000;14:1073–82.[Abstract/Free Full Text]
  44. Hsia KT, Millar MR, King S, et al. DNA repair gene Ercc1 is essential for normal spermatogenesis and oogenesis and for functional integrity of germ cell DNA in the mouse. Development 2003;130:369–78.[Abstract/Free Full Text]
  45. Melton DW, Ketchen AM, Nunez F, et al. Cells from ERCC1-deficient mice show increased genome instability and a reduced frequency of S-phase–dependent illegitimate chromosome exchange but a normal frequency of homologous recombination. J Cell Sci 1998;111:395–404.[Abstract]
  46. Davies AA, Friedberg EC, Tomkinson AE, Wood RD, West SC. Role of the Rad1 and Rad10 proteins in nucleotide excision repair and recombination. J Biol Chem 1995;270:24638–41.[Abstract/Free Full Text]
  47. Montelone BA, Liang-Chong BC. Interaction of excision repair gene products and mitotic recombination functions in yeast. Curr Genet 1993;24:481–6.[CrossRef][Medline]
  48. Niedernhofer LJ, Odijk H, Budzowska M, et al. The structure-specific endonuclease Ercc1-Xpf is required to resolve DNA interstrand cross-link–induced double-strand breaks. Mol Cell Biol 2004;24:5776–87.[Abstract/Free Full Text]
  49. De Silva IU, McHugh PJ, Clingen PH, Hartley JA. Defining the roles of nucleotide excision repair and recombination in the repair of DNA interstrand cross-links in mammalian cells. Mol Cell Biol 2000;20:7980–90.[Abstract/Free Full Text]
  50. Kuraoka I, Kobertz WR, Ariza RR, Biggerstaff M, Essigmann JM, Wood RD. Repair of an interstrand DNA cross-link initiated by ERCC1-XPF repair/recombination nuclease. J Biol Chem 2000;275:26632–6.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
R. Rouget, Y. Auclair, M. Loignon, E. B. Affar, and E. A. Drobetsky
A Sensitive Flow Cytometry-based Nucleotide Excision Repair Assay Unexpectedly Reveals That Mitogen-activated Protein Kinase Signaling Does Not Regulate the Removal of UV-induced DNA Damage in Human Cells
J. Biol. Chem., February 29, 2008; 283(9): 5533 - 5541.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Andrieux, L. O.
Right arrow Articles by Langouët, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Andrieux, L. O.
Right arrow Articles by Langouët, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online