Cancer Research Cancer Epigenetics  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 67, 3345, April 1, 2007. doi: 10.1158/0008-5472.CAN-06-2519
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cui, H.
Right arrow Articles by Kobayashi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cui, H.
Right arrow Articles by Kobayashi, M.

Experimental Therapeutics, Molecular Targets, and Chemical Biology

Enhanced Expression of Asparagine Synthetase under Glucose-Deprived Conditions Protects Pancreatic Cancer Cells from Apoptosis Induced by Glucose Deprivation and Cisplatin

Hongyan Cui1,2, Stephanie Darmanin1, Mitsuteru Natsuisaka1,2, Takeshi Kondo2, Masahiro Asaka2, Masanobu Shindoh3, Fumihiro Higashino3, Junji Hamuro5,6, Futoshi Okada7, Masataka Kobayashi5, Koji Nakagawa5, Hideyuki Koide5 and Masanobu Kobayashi1,4,5

1 Department of Pathological Oncology, Division of Cancer, 2 Department of Gastroenterology and Hematology, Hokkaido University Graduate School of Medicine, 3 Department of Oral Pathobiological Science, Hokkaido University Graduate School of Dental Medicine, 4 Division of Cancer Biology, Institute for Genetic Medicine, Hokkaido University; 5 Oncorex, Inc., Sapporo, Japan; 6 Department of Microbiology and Immunology, Keio University of Medicine, Tokyo, Japan; and 7 Department of Biomolecular Function, Graduate School of Medical Science, Yamagata University, Yamagata, Japan

Requests for reprints: Masanobu Kobayashi, Oncorex, Inc., Kita-21, Nishi-12, Kita-Ku, Collabo-Hokkaido, Sapporo, 001-0021 Japan. Phone: 81-11-738-7277; Fax: 81-11-738-7277; E-mail: mkobaya{at}igm.hokudai.ac.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although hypovasculature is an outstanding characteristic of pancreatic cancers, the tumor cells survive and proliferate under severe hypoxic, glucose-deprived conditions caused by low blood supply. It is well known that the hypoxia-inducible factor-1 pathway is essential for the survival of pancreatic cancer cells under hypoxic conditions. To discover how pancreatic cancer cells adapt to glucose deprivation as well as hypoxia, we sought glucose deprivation–inducible genes by means of a DNA microarray system. We identified 63 genes whose expression was enhanced under glucose-deprived conditions at >2-fold higher levels than under normal glucose conditions. Among these genes, asparagine synthetase (ASNS) was studied in detail. Although it is known to be associated with drug resistance in leukemia and oncogenesis triggered by mutated p53, its function is yet to be determined. In this study, we found that glucose deprivation induced the overexpression of ASNS through an AMP-activated protein kinase–independent and activating transcription factor-4–dependent manner and that ASNS protects pancreatic cancer cells from apoptosis induced by glucose deprivation itself. ASNS overexpression also induced resistance to apoptosis triggered by cisplatin [cis-diammine-dichloroplatinum (CDDP)] and carboplatin, but not by 5-fluorouracil, paclitaxel, etoposide, or gemcitabine. We show that glucose deprivation induces the activation of c-jun NH2-terminal kinase (JNK)/stress-activated protein kinase (SAPK) in a mock transfectant but not in an ASNS transfectant. Consequently, an inhibitor of JNK/SAPK decreased the sensitivity of pancreatic cancer cells to apoptosis by glucose deprivation and CDDP. These results strongly suggest that ASNS is induced by glucose deprivation and may play a pivotal role in the survival of pancreatic cancer cells under glucose-deprived conditions. [Cancer Res 2007;67(7):3345–55]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
As solid tumors outgrow the existing vasculature, they are continuously exposed to a microenvironment in which the supply of oxygen is limited. Adaptation to such a microenvironment through angiogenesis and increased glycolysis, two universal characteristics of solid tumors, is regulated by hypoxia-inducible factor-1 (HIF-1) and is critical to the sustenance of neoplastic proliferation (13). Because oxygen homeostasis represents an indispensable organizing principle for human physiology (4), the requirement for oxidative phosphorylation to generate ATP is nevertheless balanced at the cost of oxidative damage to cellular compositions (5). As a tumor expands, vigorous growth of cancer cells creates a hypoxic microenvironment, which, if not alleviated, may restrict tumor growth or even cause cell death (6). In vivo studies have shown very convincingly that the areas of tumors stained with hypoxia markers, such as pimonidazole, show reduced proliferation and an increased fraction of apoptotic cells (7). Several in vitro studies have also shown that hypoxia induces apoptosis through the activation of HIF-1 (6, 8). However, these studies use a variety of experimental conditions, most often combining reduced oxygen conditions with additional apoptogenic conditions such as glucose and/or serum deprivation. A recent report showed that hypoxia alone (<0.5% oxygen) did not alter the growth of fibroblasts and cancer cells and that anoxia (<0.01% oxygen) induced apoptosis in a HIF-1–independent manner (9), suggesting that hypoxia alone is not sufficient to result in apoptosis. Additionally, areas of tumors that have poor perfusion and reduced delivery of oxygen could also suffer from other kinds of stress, such as low glucose. Glucose, in particular, is an indispensable nutrient under hypoxic conditions because enhanced glucose uptake and glycolysis compensate for the lack of energy production by aerobic metabolism under normoxic conditions (1012). Indeed, it has been reported that hypoxia causes apoptosis in myocytes only in the absence of glucose and that the presence of as little as 1 mmol/L glucose before exposure to hypoxia prevents apoptosis (13). These findings suggest that glucose-deprived conditions, rather than hypoxic conditions, may be a pivotal contributing factor for the death of cancer cells in the tumor microenvironments, which are always associated with an insufficient supply of glucose, as well as oxygen.

Enhanced anaerobic metabolism, through the enhanced expression of glycolytic enzymes and glucose transporters, is an important hypoxia-induced adaptation response to glucose-deprived conditions. Although under hypoxic glucose-deprived conditions in vivo, anaerobic metabolism could function through the enhanced uptake of glucose, which is supplied at very low levels albeit continuously, other mechanisms of tolerance to glucose-deprived conditions might be required. Previous reports showed that hypoxia conferred tolerance to glucose deprivation through the activation of AMP–activated protein kinase (AMPK; refs. 14, 15). Therefore, we hypothesized that glucose deprivation itself might be inducing tolerance to the same glucose deprivation in tumor tissues, where the cells are exposed to hypoxia and glucose deprivation. Cancer cells might be acquiring a tolerance for glucose deficiency during their progression, in addition to the ability to stimulate angiogenesis and glycolysis as hypoxic responses.

To test this hypothesis, we selected a pancreatic cancer cell line as a model because pancreatic cancers are well known to be hypovascular tumors, as determined by means of clinical angiography (16), and sought to identify glucose deprivation–inducible genes by a DNA microarray system. We identified 63 genes whose expressions were enhanced under glucose-deprived conditions at >2-fold higher levels than under normal glucose conditions. Among those genes, we chose asparagine synthetase (ASNS) for further study because its mRNA expression levels were the highest among the genes tested by real-time PCR, and its function(s) under glucose-deprived conditions are yet to be determined. Additionally, it has been reported that its expression is enhanced by amino acid deprivation and glucose deprivation and that it is related to drug resistance of leukemia and oncogenesis triggered by mutated p53 (17, 18). ASNS encodes an enzyme that catalyzes the biosynthesis of L-asparagine from L-aspartate in an ATP-dependent reaction for which L-glutamine is the nitrogen source (19). ASNS expression in mammalian tissues is highly regulated by the nutritional status of the cells (20) and is enhanced by glucose deprivation as well as amino acid deprivation (21). The up-regulation of ASNS transcription upon nutrient stress suggests that ASNS may be a critical cellular defense gene against glucose deprivation itself, although the exact roles of overexpressed ASNS under nutrient-deprived conditions have not yet been extensively investigated. To explore this potential defensive feature of ASNS, we examined the roles of ASNS under glucose-deprived conditions in pancreatic cancer cells by silencing ASNS with small interfering RNAs (siRNA) and establishing transfectants overexpressing ASNS.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture. BxPC3, PCI43, and MiaPaCa2 pancreatic cancer cells were cultured in DMEM containing 100 mg/dL glucose (Nissui Pharmaceutical Co., Ltd., Tokyo, Japan) supplemented with 10% fetal bovine serum (FBS; Japan Bioserum Co., Ltd., Nagoya, Japan), penicillin (25 units/mL), and streptomycin (25 µg/mL). Because normal glucose concentrations in human peripheral blood range between 70 and 200 mg/dL, we used DMEM containing 100 mg/dL glucose. Thus, a concentration of 100 mg/dL is defined as "normal glucose" in our study. As hypoglycemia in human peripheral blood delineates <50 mg/dL glucose, <50 mg/dL glucose in DMEM is defined as "low glucose" in our study. Oxygen concentration in tumor tissues is ~1.25% (about one tenth that in peripheral blood); thus, glucose concentration in tumor tissues could also be estimated to be around one tenth that in peripheral blood. Therefore, the cultures carried out under glucose-deprived conditions were done in glucose-free DMEM, supplemented with 10% FBS (the final concentration of glucose in this medium was 10 mg/dL, as measured in our laboratory), unless otherwise specified. In some experiments, glucose-free DMEM supplemented with 10% FBS and 15 or 40 mg/dL glucose (final concentration of glucose in the medium being 25 or 50 mg/dL) was used. The cells used for the experiments were mainly MiaPaCa2 cells, unless otherwise specified.

Antibodies and chemical reagents. Anti-Flag M2 monoclonal antibody, anti-actin antibody, anti–phospho-stress-activated protein kinase (SAPK)/c-jun NH2-terminal kinase (JNK; Thr183/Tyr185) antibody, and anti–SAPK/JNK antibody were purchased from Sigma Chemical Co. (St. Louis, MO), Santa Cruz Biotechnology (Santa Cruz, CA), and Cell Signaling Technology (Danvers, MA), respectively. The supernatant from a cloned mouse hybridoma cell line, HL 512 (3G6-2G8), which secretes an antibody [immunoglobulin G (IgG)-2a subclass] that recognizes human ASNS, was used as antihuman ASNS antibody. This was kindly provided by Dr. Sheldon Schuster (Department of Biochemistry, University of Florida, Gainesville, FL). Peroxidase-conjugated goat anti-mouse IgG, peroxidase-conjugated goat anti-rabbit IgG, and peroxidase-conjugated rabbit anti-goat IgG antibodies were purchased from Jackson ImmunoResearch Laboratories (West Grove, PA). Cisplatin [cis-diammine-dichloroplatinum (CDDP)] and gemcitabine were kind gifts from Pfizer (Tokyo, Japan) and Eli Lilly (Kobe, Japan), respectively. 5-Fluoruracil (5-FU) was purchased from Calbiochem (La Jolla, CA) whereas paclitaxel, etoposide (VP-16), and carboplatin were kind gifts from Bristol Pharmaceuticals Y.K. (Tokyo, Japan). Compound C, an AMPK inhibitor, was purchased from Calbiochem. The JNK1-3 inhibitor SP600125 was bought from Biomol International (Plymouth Meeting, PA). Hydrogen peroxide (30% solution) was purchased from Wako Pure Chemical Industries (Osaka, Japan).

DNA microarray analysis. Total RNA was extracted with the use of TRIZOL reagent (Life Technologies, Tokyo, Japan) from MiaPaca2 cells that had been incubated for 16 h under glucose-deprived conditions or normal glucose conditions. The glucose concentrations were 10 and 100 mg/dL, respectively. mRNA was purified from total RNA with the use of a QuickPrep mRNA Purification Kit (Amersham Pharmacia Biotech, Tokyo, Japan). The differentially expressed genes were screened using a DNA microarray system (Hokkaido System Science, Sapporo, Japan). We defined the genes that were expressed at >2-fold intensity under glucose-deprived conditions than under normal glucose conditions as possible glucose deprivation–inducible genes in this study.

Sensitivity to anticancer drugs. Sensitivity of tumor cell lines to anticancer drugs was determined by a colorimetric 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay according to the manufacturer's instructions (Cell Titer 96 Aqueous Non-Radioactive Cell Proliferation Assay, Promega, Madison, WI). Briefly, cells were inoculated in 96-well plates (8 x 103 per well) and incubated overnight in a humidified CO2 incubator (95% air/5% CO2) in triplicate, to allow the cells to adhere and assume a healthy condition, and then exposed to different doses of anticancer drugs for 48 h under normal glucose conditions. The cells were then incubated for a further 3 h with MTS solution. Subsequently, the absorbance was measured at 490 nm on an ELISA plate reader (model 680, Bio-Rad, Hercules, CA).

Apoptosis assay. Sensitivity of tumor cell lines to apoptosis was determined by two-color fluorescence-activated cell sorting (FACS) analysis using propidium iodide– and FITC-conjugated anti–Annexin V antibody according to the manufacturer's instructions (Roche Diagnostics GmbH, Germany). Briefly, after incubating the cells for 48 h under normal glucose conditions or under glucose-deprived conditions, the cells were stained with propidium iodide– and FITC-conjugated anti–Annexin V and then analyzed with a FACSCalibur (Becton Dickinson, Mountain View, CA). Apoptotic cell death was also examined by staining the cells with Hoechst-33342 (Molecular Probes) without fixation. Apoptotic cells were identified by characteristic bright blue fluorescence of nuclei due to condensed or fragmented chromatin. Digital images were acquired with an inverted light microscope (Nikon Eclipse TE300, Nikon Instech Co. Ltd., Kawasaki, Japan) attached to a 100-W halogen lamp source (Nikon Halogen 12V-100W, Nikon Instech) and a charge-coupled device camera (Nikon Coolpix 4500, Nikon).

Western blot analysis. Cells were lysed in cell lysis buffer (Cell Signaling Technology) and whole-cell lysates (40 µg) were run on 10% polyacrylamide gels and electrotransferred to nitrocellulose membranes. The membranes were blocked with blocking buffer (5% skimmed milk in 1% Tween-PBS), probed with primary antibodies overnight at 4°C, incubated with a secondary antibodies for 1 h at room temperature, and developed with the use of an enhanced chemiluminescence detection kit (Amersham, Tokyo, Japan).

Real-time PCR. Total RNA was extracted with the use of TRIZOL reagent according to the manufacturer's instructions. Each RNA sample (10 µg) was subjected to cDNA synthesis by means of Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies, Carlsbad, CA). Each cDNA (10 ng) was amplified in triplicate with the use of the Quantitect SYBR Green PCR Kit (Qiagen, Hilden, Germany) for 40 cycles (94°C for 15 s, 60°C for 30 s, and 72°C for 1 min) on an ABI PRISM 7900HT Sequence Detection System. The primers used were as follows: ASNS forward primer, CTGCACGCCCTCTATGACA; ASNS reverse primer, TAAAAGGCAGCCAATCCTTCT; ß-actin forward primer, TTGCCGACAGGATGCAGAA; ß-actin reverse primer, GCCGATCCACACGGAGTACT. Relative mRNA levels were determined by comparing the PCR cycle thresholds between the cDNA of ASNS and that of ß-actin.

siRNA preparation and transfection. The antisense sequences of the siRNAs for human ASNS were as follows: AAGAUUGCACACAGAGGUCCA, AAAGUGUUCCUGGGUAGAGAU, and AAAGAAGCCCAAGUACAGUA. These were designed using the Silencer siRNA Construction Kit (Ambion, Inc., Austin, TX). A nonsilencing control siRNA was purchased from Qiagen (Valencia, CA). siRNA transfection using 5 nmol/L siRNA was done with Lipofectamine 2000 (Invitrogen) at 30% to 40% cell confluence in an antibiotic-free medium. A cocktail of three siRNAs for human activating transcription factor-4 (ATF-4; siTrio Full Set) was purchased from B-Bridge International (Sunnyvale, CA) and used at 5 nmol/L concentrations. The antisense sequences for these siRNAs were as follows: UUCUCCAACAUCCAAUCUG, AUCUCCUUCAGUGAUAUCC, and UUCUUAUCCAGUUUCUCAC.

Establishment of ASNS transfectants. A cDNA for ASNS was amplified from reverse transcription products of mRNAs purified from MiaPaCa2 cells and cloned into p3XFLAG-cytomegalovirus-14 (CMV-14). PCR primers for the full-length cDNA of ASNS were as follows: forward primer, 5'-GACTGCGGCCGCATAGCTTCATTGCACCA-3'; reverse primer, 5'-CAGTAGATCTGCTTTGACAGCTGACTTG-3'. Plasmids were sequenced with a BigDye Version 3 Sequence Kit (Applied Biosystems, Tokyo, Japan) on an ABI Prism 3100-Avant automated sequencer (Applied Biosystems) according to the manufacturer's protocol. Cloned fragments were ligated into p3XFLAG-CMV-14 (Sigma Chemical). MiaPaCa2 cells were transfected with the expression vector alone (mock transfectant) or the expression vector containing the cloned fragments (ASNS transfectant) with the use of Lipofectamine 2000 (Invitrogen). Transfectants were cloned by a limiting dilution method following selection with G-418 (Sigma; 1,200 µg/mL). The transfectants were then maintained in the presence of 600 µg/mL G-418.

Statistical analysis. Real-time PCR results are represented as mean ± SD, whereas results for MTS assays are represented as means ± 95% confidence intervals (95% CI). Statistical differences among the groups were determined by two-tailed Student's t test as for independent samples. Mean values were considered significantly different when P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Genes whose expression was enhanced under glucose-deprived conditions. Representative genes whose expression was enhanced under glucose-deprived conditions compared with normal glucose conditions were classified into several categories (Table 1 ). Our analysis revealed a total of 63 genes up-regulated in MiaPaCa2 cells under glucose-deprived conditions when compared with normal glucose conditions. Because our result comes from a single microarray analysis, conclusions from our analysis cannot be made without further validation of the microarray results by another method, such as real-time PCR. Among the identified genes, ASNS was chosen for further study. Recent reports showed that its expression is enhanced by amino acid deprivation and glucose deprivation and that it is related to drug resistance of leukemia and oncogenesis triggered by mutated p53 (17, 18), whereas its function(s) are yet to be determined.


View this table:
[in this window]
[in a new window]

 
Table 1. Overexpressed genes under glucose-deprived conditions

 
Expression of ASNS under normal glucose/glucose-deprived and hypoxic/normoxic conditions. We examined the expression of ASNS mRNA by real-time PCR in three pancreatic cancer cell lines. In these cell lines, ASNS mRNA was expressed at higher levels following 16-h incubation under glucose-deprived conditions than under normal glucose conditions (Fig. 1A ). The increase in ASNS mRNA expression was sustained under glucose-deprived conditions in time course experiments (starting from 16 h and lasting up to 48 h; Fig. 1B). Various concentrations of glucose, ranging from 50 to 10 mg/dL, increased the expression of ASNS mRNA (Fig. 1C). Hypoxia alone increased the expression of ASNS mRNA in one of three cell lines (data not shown). ASNS protein expression was also higher under glucose-deprived conditions than under normal glucose conditions (Fig. 1D). As AMPK has been reported to be an energy sensor (2224), we then examined the implication of AMPK in the induction of ASNS expression under glucose-deprived conditions. Compound C, an inhibitor of AMPK, has no effect on the enhanced expression of ASNS induced by glucose deprivation (Fig. 1E). We then confirmed the role of ATF-4 in the induction of ASNS under glucose-deprived conditions because amino acid deprivation and glucose deprivation have been reported to stimulate the expression of ASNS through the activation of ATF-4 (25, 26). siRNAs for ATF-4 almost completely suppressed the enhanced expression of ASNS under glucose-deprived conditions (Fig. 1F). These results suggest that the expression of ASNS under glucose-deprived conditions is induced in an ATF-4–dependent but AMPK-independent manner.


Figure 1
View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Expression of ASNS under different conditions. A, BxPC3, MiaPaCa2, and PCI43 cells were incubated under normal glucose conditions (N) and glucose-deprived conditions (L). The glucose concentration of the normal glucose group was 100 mg/dL and that of the glucose-deprived group was 10 mg/dL. After incubation for 16 h, the mRNA level of ASNS was analyzed by real-time PCR. ß-Actin mRNA was used to standardize the total amount of cDNA. ASNS mRNA expressions were enhanced under low-glucose conditions. Representative results of three independent experiments. Columns, mean of triplicate wells; bars, SD. *, P < 0.05. B, MiaPaCa2 cells were incubated under the two different conditions for the indicated times. After incubation, the mRNA level of ASNS was analyzed by real-time PCR. The increase in ASNS mRNA expression was sustained under glucose-deprived conditions in time course experiments (from 16 h up to 48 h). Representative results of three independent experiments. Points, mean of triplicate wells; bars, SD. C, MiaPaCa2 cells were cultured in medium containing varying concentrations of glucose for 16 h and the mRNA level of ASNS was then analyzed by real-time PCR. Varying glucose concentrations (from 50 to 10 mg/dL) enhanced ASNS expression. Representative results of three independent experiments. Columns, mean of triplicate wells; bars, SD. *, P < 0.05. D, MiaPaCa2 cells were incubated under the two different conditions for 48 h and the protein levels of ASNS in whole-cell lysates were determined by Western blot analysis. ASNS protein expression was also enhanced under low-glucose conditions. Representative results of three independent experiments. E, after preincubation with an AMPK inhibitor, compound C, for 60 min, MiaPaCa2 cells were incubated under normal glucose conditions and glucose-deprived conditions for 16 h. ASNS mRNA was analyzed by real-time PCR. Compound C showed no effect on the expression of ASNS mRNA. Representative results of two independent experiments. Columns, mean of triplicate wells; bars, SD. F, MiaPaca2 cells were transfected with 5 nmol/L siRNA for ATF-4, under normal glucose and glucose-deprived conditions, and total RNA was extracted 48 h after transfection. ASNS mRNA was analyzed by real-time PCR. A mixture of siRNAs for ATF-4 completely suppressed the expression of ASNS mRNA. Representative results of three independent experiments. Columns, mean of triplicate wells; bars, SD. *, P < 0.05.

 
Silencing of ASNS by siRNA sensitizes pancreatic cancer cells to apoptosis. We then examined the roles of ASNS using siRNAs for ASNS. We made three siRNAs, all of which effectively suppressed both the mRNA and protein expressions of ASNS (Fig. 2A and B ). More than 95% of the cells were viable under normal glucose conditions. Although ~50% of the cells treated with a control siRNA were viable under glucose-deprived conditions, the percentages of viable cells treated with two siRNAs for ASNS (siRNA245 and siRNA572) decreased to ~20% and 7% under glucose-deprived conditions (Fig. 2C). These results suggest that overexpression of ASNS under glucose-deprived conditions plays an important role in the protection of cancer cells from apoptosis induced by glucose-deprived conditions. In addition to apoptosis induced by glucose deprivation, we examined the effects of silencing ASNS during treatment with an anticancer drug, CDDP. The cells treated with siRNAs for ASNS under glucose-deprived conditions were also more sensitive to apoptosis induced by CDDP, which, by itself, did not induce the expression of ASNS mRNA (Supplementary Fig. S1A), than those treated with a control siRNA (Fig. 2D, top). Under normal glucose conditions, siRNAs for ASNS showed no effect on the sensitivity to apoptosis induced by CDDP (Fig. 2D, bottom). These results suggest that glucose deprivation induced resistance to CDDP through the enhanced expression of ASNS.


Figure 2
View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Effects of siRNAs for ASNS on the sensitivity to apoptosis. A, MiaPaca2 cells were transfected with 5 nmol/L siRNA for ASNS, under normal glucose and glucose-deprived conditions, and total RNA was extracted 48 h after transfection. ASNS mRNAs were analyzed by real-time PCR. The relative copy number to ß-actin in the cells treated with control siRNA, under normal or low-glucose conditions, was artificially defined as one. All siRNAs for ASNS efficiently suppressed the expression of ASNS mRNA. Representative results of three independent experiments. Columns, mean of triplicate wells; bars, SD. *, P < 0.05. B, MiaPaca2 cells were transfected with 5 nmol/L siRNA for ASNS, under normal glucose and glucose-deprived conditions, and whole-cell lysates were prepared 48 h after transfection. Protein levels of ASNS were analyzed by Western blot analysis. Two siRNAs for ASNS efficiently suppressed the expression of ASNS protein. Representative results of three independent experiments. C, MiaPaca2 cells were transfected with 5 nmol/L siRNA for ASNS under normal glucose and glucose-deprived conditions for 48 h. Viable cells were analyzed by FACS two-color analysis using propidium iodide– and FITC-conjugated Annexin V. siRNAs for ASNS decreased the percentages of viable cells under low-glucose conditions. Representative results of four independent experiments. D, MiaPaCa2 cells, transfected with 5 nmol/L siRNA for ASNS, were cultured under normal glucose and glucose-deprived conditions with indicated concentrations of CDDP for 48 h. Viable cells were analyzed by a colorimetric MTS assay. siRNAs for ASNS decreased the percentages of viable cells following CDDP treatment only under glucose-deprived conditions. Representative results of three independent experiments. Columns, mean of triplicate wells; bars, 95% CI. *, P < 0.05.

 
Overexpression of ASNS protects cancer cells from apoptosis. We then established MiaPaCa2 cell lines overexpressing ASNS constitutively. Before cloning, we examined the sensitivity of the ASNS transfectants to apoptosis induced by glucose deprivation and confirmed that they were significantly more resistant to apoptosis than the mock transfectant (Fig. 3A ). Staining with Hoechst-33342 showed that more than half of the mock-transfected cells cultured under low-glucose conditions showed bright fluorescence, representing apoptotic cells, whereas nuclei of the ASNS-transfected cells displayed only dim staining, except for the small fraction (Fig. 3B). Two transfectant clones expressing Flag-tagged ASNS were selected for further experiments (Fig. 3C). These two ASNS transfectant clones were also more resistant to apoptosis induced by glucose deprivation than the mock-transfectant (Fig. 3D). Viable cells were examined by means of the MTS assay after incubating mock-transfected cells and ASNS-transfected cells under low-glucose conditions for up to 48 h (Supplementary Fig. S1B). After 24 and 48 h of incubation, ~100% and 50%, respectively, of the ASNS-transfected cells were viable, whereas the percentages of the viable mock-transfected cells were significantly lower than those of the ASNS-transfected cells. We then examined the expression levels of bcl-2 family proteins (bcl-2, bcl-xL, and Bax) in the transfectants, but we could not find any difference in bcl-2 family protein expressions between the mock transfectant and the ASNS transfectants (data not shown). We proceeded to examine the activation status of stress-inducible kinases such as JNK/SAPK. We found that glucose deprivation clearly activated JNK/SAPK in the mock transfectant but not in the ASNS transfectant (clone 7; Fig. 3E). Moreover, an inhibitor of JNK increased the percentage of viable MiaPaCa2 parent cells cultured under glucose-deprived conditions for 24 h in a dose-dependent manner (Fig. 3F). These results suggest that overexpression of ASNS, induced by glucose deprivation, plays an important role in the survival of pancreatic cancer cells through the suppression of JNK activation under glucose-deprived conditions. Furthermore, the sensitivity of uncloned ASNS transfectants to apoptosis induced by CDDP, under normal glucose conditions, was significantly lower than that of the mock transfectant (Supplementary Fig. S1C). When we examined the sensitivity of the ASNS-transfected clones to other anticancer drugs, the ASNS transfectants were more resistant to CDDP and carboplatin but not to 5-FU, VP-16, paclitaxel, or gemcitabine than the mock transfectant (Fig. 4A–F ).


Figure 3
View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Establishment of ASNS transfectants. A, the uncloned ASNS-transfected and mock-transfected cells were cultured under normal glucose and varying glucose concentrations for 48 h. Viable cells were analyzed by means of a colorimetric MTS assay. The uncloned ASNS transfectant is more resistant to apoptosis induced by glucose deprivation than the mock transfectant. Representative results of three independent experiments. Columns, mean of triplicate wells; bars, 95% CI. *, P < 0.05. B, digital images acquired by fluorescence microscopy. Staining with Hoechst-33342 reveals that more than half of the mock-transfected cells cultured under low-glucose conditions show bright fluorescence (representing apoptosis), whereas nuclei of the ASNS-transfected cells display only dim staining, except for a small fraction. C, MiaPaCa2 cells were transfected with the p3XFLAG-CMVTM-14 expression vector with the use of Lipofectamine 2000. Expression levels of ASNS protein in the transfectants are shown. Clone 7 and clone 26 were chosen for further experiments. D, the transfectants (ASNS-transfected clones 7 and 26 and a mock transfectant) were cultured under normal glucose and glucose-deprived conditions for 48 h. Viable cells were analyzed by FACS two-color analysis using propidium iodide– and FITC-conjugated Annexin V. The ASNS transfectants are resistant to apoptosis induced by glucose deprivation. E, JNK/SAPK activation by low glucose in mock and ASNS transfectants is shown by Western blotting. ASNS clearly inhibits JNK/SAPK activation under glucose-deprived conditions. F, MiaPaCa2 parent cells were incubated under glucose-deprived conditions for 24 h in the presence (+) or absence (–) of SP600125, an inhibitor of JNK. After incubation, viable cells were analyzed by a colorimetric MTS assay. SP600125 increased the number of viable cells. Columns, mean of three different experiments; bars, 95% CI. Viability is compared with the cells cultured without SP600125 (–), under normal glucose conditions (–). *, P < 0.05.

 

Figure 4
View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Sensitivity of ASNS transfectants to several anticancer drugs. ASNS transfectants were incubated under normal glucose conditions with the indicated concentrations of CDDP (A), carboplatin (B), 5-FU (C), VP-16 (D), paclitaxel (E), and gemcitabine (F) for 48 h. After incubation, viable cells were analyzed by a colorimetric MTS assay. The two transfectant clones are resistant to both CDDP and carboplatin but not to 5-FU, VP-16, paclitaxel, or gemcitabine. Representative results of three independent experiments. Columns, mean of triplicate wells; bars, 95% CI. *, P < 0.05.

 
Sensitivity of MiaPaCa2 parent cells to CDDP in the presence of asparagine. Because overexpression of ASNS induces the accumulation of asparagine in the cells, we then examined the effect of the addition of L-asparagine into the medium. Higher concentrations of asparagine in the medium (up to 20 mmol/L) showed no effect on the sensitivity of MiaPaCa2 parent cells to CDDP (Fig. 5A ).


Figure 5
View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Roles of asparagine and JNK/SAPK in CDDP resistance. A, asparagine added in the culture medium up to 20 mmol/L had no effect on the MiaPaCa2 cell sensitivity to CDDP following 48 h of incubation under normal glucose conditions. Viable cells were analyzed by a colorimetric MTS assay. Representative results of three independent experiments. Columns, mean of triplicate wells; bars, 95% CI. B, JNK/SAPK activation induced by CDDP and 5-FU. CDDP but not 5-FU clearly activated JNK/SAPK after 12-h incubation under normal glucose conditions. The activation of JNK/SAPK was suppressed in the ASNS transfectant. Representative results of three independent experiments. C, MiaPaCa2 parent cells were cultured under normal glucose conditions for 48 h in the presence (+) or absence (–) of CDDP, 5-FU, and SP600125 (an inhibitor of JNK), as illustrated. After incubation, viable cells were analyzed by a colorimetric MTS assay. Representative results of three independent experiments. Columns, mean of triplicate wells; bars, 95% CI. *, P < 0.05.

 
Phosphorylation of JNK in ASNS transfectants treated with CDDP or 5-FU. We also examined the activation of JNK/SAPK in the cells treated with CDDP and 5-FU. We found that CDDP, but not 5-FU, induced a significant activation of JNK/SAPK in the mock transfectant (Fig. 5B). Overexpression of ASNS suppressed the activation of JNK/SAPK induced by CDDP in the ASNS transfectant (clone 7; Fig. 5B). We then examined the effects of a JNK inhibitor on the sensitivity of the MiaPaCa2 parent cells to CDDP to mimic the inhibiting effects of ASNS on JNK. As predicted, treatment of the cells with the inhibitor of JNK for 48 h increased the percentage of viable MiaPaCa2 parent cells treated with CDDP compared with the control. However, it did not show any effect on the numbers of viable cells treated with 5-FU (Fig. 5C).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Here, we clearly show that glucose deprivation induces the expression of ASNS, in accordance with previous reports (10, 27), and that the enhanced expression of ASNS protects pancreatic cancer cells from apoptosis induced by glucose deprivation through the suppression of JNK/SAPK activation. These results show for the first time that ASNS, induced by glucose deprivation, is implicated in adaptation responses to the same glucose-deprived conditions, frequently observed in tumor tissues. Furthermore, we show that the enhanced expression of ASNS protects pancreatic cancer cells from apoptosis induced by CDDP and that this resistance to CDDP is also mediated through the suppression of JNK/SAPK activation. As recent studies showed that potent ASNS inhibitors may have clinical usefulness in treating childhood acute lymphoblastic leukemia, which overexpresses ASNS (17), we envisage that inhibitors of ASNS may also become a beneficial tool for treating pancreatic cancers.

ASNS encodes an enzyme that catalyzes the glutamine- and ATP-dependent conversion of aspartic acid to asparagine (19). The expression of ASNS is enhanced by amino acid deprivation, and this regulation is transcriptional in nature (20). A recent report showed that the human ASNS gene is also activated when cells are incubated in the absence of glucose (21). The cellular significance of ASNS overexpression induced by glucose deprivation is not yet fully understood, although it is reported that ASNS may be a serum marker for neoplasias (28) and is related with cell cycle regulation (29) and resistance to apoptosis induced by L-asparaginase (30). As the addition of L-asparagine in the culture medium had no effect on the resistance to CDDP, it seems unlikely that ASNS may induce resistance to apoptosis through the accumulation of L-asparagine, produced by ASNS. Our work reveals that glucose deprivation, CDDP, and carboplatin, but not 5-FU, activated JNK/SAPK and that the overexpression of ASNS suppressed this activation. These results suggest that glucose deprivation and CDDP may induce apoptosis, at least partially, through the activation of JNK/SAPK and that the overexpression of ASNS may inhibit apoptosis through the suppression of this JNK/SAPK activation. Unlike our results, several reports showed that 5-FU and other anticancer drugs also induced apoptosis through the activation of JNK/SAPK (3134). Contrastingly, the genetic removal of SEK-1, an immediate upstream activator kinase of JNK, promoted apoptosis of hepatocytes and T cells (35, 36), which proposes that JNK has a dual role in cell survival. These contradictory results suggest that the role of the activation of JNK in cell survival is still unclear. A definite mechanism for the role of ASNS in cell survival also remains to be determined.

Our results show that ATF-4, but not AMPK, is involved in the induction of ASNS expression by glucose deprivation. Glucose deprivation induces two major cellular response pathways: an unfolded protein response pathway and an AMPK-dependent signaling pathway (22, 23, 37, 38). AMPK is an energy sensor that regulates the energy balance within the cell by means of switching off ATP-consuming pathways and switching on ATP-generating pathways (22). Because it has been reported that glucose deprivation increased the mRNA level of some hypoxia-inducible genes, such as vascular endothelial growth factor (VEGF), glucose-transporter 1 (Glut-1), and 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase-3 (PKFKB3; ref. 39), we assumed that AMPK was involved in enhancing the expression of ASNS mRNA under glucose-deprived conditions. However, our result clearly shows that AMPK is not involved in the signal transduction pathway for ASNS induction. Our finding on ATF-4 is consistent with previous reports showing that ATF-4 is one of the mediators of the nutrient-sensing response pathway, also known as the unfolded protein response pathway, which activates the human ASNS gene (25, 26). It is well known that many disturbances in the normal functions of the endoplasmic reticulum lead to the unfolded protein response pathway, which is aimed initially at compensating for damage but can eventually trigger cell death if endoplasmic reticulum dysfunction is severe and prolonged (37). Hypoxia and CDDP, as well as glucose deprivation, also lead to endoplasmic reticulum stress and then the unfolded protein response pathway (37, 40, 41). In our study, hypoxia induced the expression of ASNS mRNA in only one of the three cell lines tested (data not shown). Furthermore, CDDP, which has been reported to induce endoplasmic reticulum stress, did not increase the expression of ASNS mRNA (Supplementary Fig. S1A). All these results suggest that ATF-4 is an essential transcription factor for enhanced expression of ASNS under glucose-deprived conditions and that glucose deprivation may activate an ATF-4 pathway independently of endoplasmic reticulum stress.

Because tumor tissues are exposed to glucose-deprived conditions, as well as hypoxic conditions, adaptation responses against hypoxia through the activation of the HIF-1 pathway are not enough for the survival of solid tumor cells in vivo. Recently, we have reported that transforming growth factor-ß was involved in the tolerance to glucose starvation under hypoxic conditions (15). This finding indicates that hypoxia induces the adaptation responses to glucose deprivation under hypoxic, glucose-deprived conditions. Our question in this study was whether glucose deprivation itself induces any adaptation responses to hypoxic, glucose-deprived conditions. Our present results clearly indicate that one effect of glucose deprivation is the induction of adaptation responses to apoptosis brought about by the same glucose deprivation. We now propose that glucose deprivation itself induces the adaptation responses of cancer cells to the tumor microenvironment other than the HIF-1 pathway activated by hypoxia.

Collectively, our results provide evidence that glucose deprivation induces the overexpression of ASNS in pancreatic cancer cells, which in turn leads to resistance to apoptosis. Consequently, ASNS overexpression suppresses the activation of JNK/SAPK, thus inhibiting death signal transduction. Hence, ASNS may very well be an important therapeutic target for pancreatic cancers, as well as acute lymphoid leukemias.


    Acknowledgments
 
Grant support: Cancer Research from the Japanese Ministry of Education, Culture, Sports, Science and Technology (M. Kobayashi).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Jun-ichi Hamada (Division of Cancer-related Genes, Institute for Genetic Medicine, Sapporo, Japan) and Dr. Hiroshi Ishikura (The First Department of Pathology, Hokkaido University School of Medicine, Sapporo, Japan) for providing us with the cell lines, Dr. Sheldon Schuster (Department of Biochemistry, University of Florida College of Medicine) for providing us with the anti-ASNS antibody, and M. Yanome for her valuable assistance in the preparation of the manuscript.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 7/11/06. Revised 11/27/06. Accepted 1/19/07.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bergers G, Benjamin LE. Tumorigenesis and the angiogenic switch. Nat Rev Cancer 2003;3:401–10.[CrossRef][Medline]
  2. Jiang CQ, Fan LF, Liu ZS, et al. Expression levels and significance of hypoxia inducible factor-1{alpha} and vascular endothelial growth factor in human colorectal adenocarcinoma. Chin Med J (Engl) 2004;117:1541–6.[Medline]
  3. Vaupel P. The role of hypoxia-induced factors in tumor progression. Oncologist 2004;5:10–7.
  4. Semenza GL. Hypoxia-inducible factor 1: oxygen homeostasis and disease pathophysiology. Trends Mol Med 2001;7:345–50.[CrossRef][Medline]
  5. Semenza GL. Perspectives on oxygen sensing. Cell 1999;98:281–4.[CrossRef][Medline]
  6. Greijer AE, van der Wall E. The role of hypoxia inducible factor 1 (HIF-1) in hypoxia induced apoptosis. J Clin Pathol 2004;57:1009–14.[Abstract/Free Full Text]
  7. Evans SM, Hahn SM, Magarelli DP, Koch CJ. Hypoxic heterogeneity in human tumors: EF5 binding, vasculature, necrosis, and proliferation. Am J Clin Oncol 2001;24:467–72.[CrossRef][Medline]
  8. Kim JY, Ahn HJ, Ryu JH, Suk K, Park JH. BH3-only protein noxa is a mediator of hypoxic cell death induced by hypoxia-inducible factor 1{alpha}. J Exp Med 2004;199:113–24.[Abstract/Free Full Text]
  9. Papandreou I, Krishna C, Kaper F, Cai D, Giaccia AJ, Denko NC. Anoxia is necessary for tumor cell toxicity caused by a low-oxygen environment. Cancer Res 2005;65:3171–8.[Abstract/Free Full Text]
  10. Brown JM, Giaccia AJ. The unique physiology of solid tumors: opportunities (and problems) for cancer therapy. Cancer Res 1998;58:1408–16.[Abstract/Free Full Text]
  11. Dang CV, Semenza GL. Oncogenic alterations of metabolism. Trends Biochem Sci 1999;24:68–72.[CrossRef][Medline]
  12. Hockel M, Schlenger K, Hockel S, Vaupel P. Hypoxic cervical cancers with low apoptotic index are highly aggressive. Cancer Res 1999;59:4525–8.[Abstract/Free Full Text]
  13. Malhotra R, Brosius FC III. Glucose uptake and glycolysis reduce hypoxia-induced apoptosis in cultured neonatal rat cardiac myocytes. J Biol Chem 1999;274:12567–75.[Abstract/Free Full Text]
  14. Esumi H, Izuishi K, Kato K, et al. Hypoxia and nitric oxide treatment confer tolerance to glucose starvation in a 5'-AMP-activated protein kinase-dependent manner. J Biol Chem 2002;277:32791–8.[Abstract/Free Full Text]
  15. Suzuki A, Kusakai G, Shimojo Y, et al. Involvement of transforming growth factor-ß1 signaling in hypoxia-induced tolerance to glucose starvation. J Biol Chem 2005;280:31557–63.[Abstract/Free Full Text]
  16. Koito K, Namieno T, Nagakawa T, et al. Congenital arteriovenous malformation of the pancreas: its diagnostic features on images. Pancreas 2001;22:267–73.[CrossRef][Medline]
  17. Richards NG, Kilberg MS. Asparagine synthetase chemotherapy. Annu Rev Biochem 2006;75:629–54.[CrossRef][Medline]
  18. Scian MJ, Stagliano KE, Deb D, et al. Tumor-derived p53 mutants induce oncogenesis by transactivating growth-promoting genes. Oncogene 2004;23:4430–43.[CrossRef][Medline]
  19. Richards NG, Schuster SM. Mechanistic issues in asparagine synthetase catalysis. Adv Enzymol Relat Areas Mol Biol 1998;72:145–98.[Medline]
  20. Fafournoux P, Bruhat A, Jousse C. Amino acid regulation of gene expression. Biochem J 2000;351:1–12.[CrossRef][Medline]
  21. Barbosa-Tessmann IP, Pineda VL, Nick HS, Schuster SM, Kilberg MS. Transcriptional regulation of the human asparagine synthetase gene by carbohydrate availability. Biochem J 1999;339:151–8.[CrossRef][Medline]
  22. Luo Z, Saha AK, Xiang X, Ruderman NB. AMPK, the metabolic syndrome and cancer. Trends Pharmacol Sci 2005;26:69–76.[CrossRef][Medline]
  23. Carling D. The AMP-activated protein kinase cascade—a unifying system for energy control. Trends Biochem Sci 2004;29:18–24.[CrossRef][Medline]
  24. Hardie DG. New roles for the LKB1-AMPK pathway. Curr Opin Cell Biol 2005;17:167–73.[CrossRef][Medline]
  25. Siu F, Bain PJ, LeBlanc-Chaffin R, Chen H, Kilberg MS. ATF-4 is a mediator of the nutrient-sensing response pathway that activates the human asparagine synthetase gene. J Biol Chem 2002;277:24120–7.[Abstract/Free Full Text]
  26. Chen C, Dudenhausen E, Chen H, Pan YX, Gjymishka A, Kilberg MS. Amino-acid limitation induces transcription from the human C/EBPß gene via an enhancer activity located downstream of the protein coding sequence. Biochem J 2005;391:649–58.[CrossRef][Medline]
  27. Barbosa-Tessmann IP, Chen C, Zhong C, Schuster SM, Nick HS, Kilberg MS. Activation of the unfolded protein response pathway induces human asparagine synthetase gene expression. J Biol Chem 1999;274:31139–44.[Abstract/Free Full Text]
  28. Cooney DA, King VD, Cable RG, Taylor B, Jr., Wodinsky I. L-Asparagine synthetase in serum as a marker for neoplasia. Cancer Res 1976;36:3238–45.[Abstract/Free Full Text]
  29. Greco A, Gong SS, Ittmann M, Basilico C. Organization and expression of the cell cycle gene, ts11, that encodes asparagine synthetase. Moll Cell Biol 1989;9:2350–9.[Abstract/Free Full Text]
  30. Aslanian AM, Fletcher BS, Kilberg MS. Asparagine synthetase expression alone is sufficient to induce L-asparaginase resistance in MOLT-4 human leukaemia cells. Biochemical J 2001;357:321–8.[CrossRef][Medline]
  31. Masuda M, Toh S, Koike K, et al. The roles of JNK1 and Stat3 in the response of head and neck cancer cell lines to combined treatment with all-trans-retinoic acid and 5-fluorouracil. Jpn J Cancer Res 2002;93:329–39.[CrossRef]
  32. Kang CD, Ahn BK, Jeong CS, et al. Down-regulation of JNK/SAPK activity is associated with the cross-resistance to P-glycoprotein-unrelated drugs in multidrug-resistant FM3A/M cells overexpressing P-glycoprotein. Exp Cell Res 2000;256:300–7.[CrossRef][Medline]
  33. Boldt S, Weidle UH, Kolch W. The role of MAPK pathways in the action of chemotherapeutic drugs. Carcinogenesis 2002;23:1831–8.[Abstract/Free Full Text]
  34. Ham YM, Choi JS, Chun KH, Joo SH, Lee SK. The c-Jun N-terminal kinase 1 activity is differentially regulated by specific mechanisms during apoptosis. J Biol Chem 2003;278:50330–7.[Abstract/Free Full Text]
  35. Nishina H, Vaz C, Billia P, et al. Defective liver formation and liver cell apoptosis in mice lacking the stress signaling kinase SEK1/MKK4. Development 1999;126:505–16.[Abstract]
  36. Nishina H, Radvanyi L, Raju K, Sasaki T, Kozieradzki I, Penninger JM. Impaired TCR-mediated apoptosis and Bcl-XL expression in T cells lacking the stress kinase activator SEK1/MKK4. J Immunol 1998;161:3416–20.[Abstract/Free Full Text]
  37. Xu C, Bailly-Maitre B, Reed JC. Endoplasmic reticulum stress: cell life and death decisions. J Clin Invest 2005;115:2656–64.[CrossRef][Medline]
  38. Schroder M, Kaufman RJ. ER stress and the unfolded protein response. Mutat Res 2005;569:29–63.[Medline]
  39. Yun H, Lee M, Kim SS, Ha J. Glucose deprivation increases mRNA stability of vascular endothelial growth factor through activation of AMP-activated protein kinase in DU145 prostate carcinoma. J Biol Chem 2005;280:9963–72.[Abstract/Free Full Text]
  40. Koong AC, Chauhan V, Romero-Ramirez L. Targeting XBP-1 as a novel anti-cancer strategy. Cancer Biol Ther 2006;5:756–9.[Medline]
  41. Fels DR, Koumenis C. The PERK/eIF2{alpha}/ATF-4 module of the UPR in hypoxia resistance and tumor growth. Cancer Biol Ther 2006;5:723–8.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cui, H.
Right arrow Articles by Kobayashi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cui, H.
Right arrow Articles by Kobayashi, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online