| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology, and Genetics |
Departments of 1 Pharmacology, 2 Pathology, and 3 Dermatology, The Pennsylvania State University College of Medicine; 4 The Foreman Foundation for Melanoma Research; and 5 Penn State Melanoma Therapeutics Program, Hershey, Pennsylvania
Requests for reprints: Gavin P. Robertson, Department of Pharmacology-H078, The Pennsylvania State University College of Medicine, 500 University Drive, Hershey, PA 17033. Phone: 717-531-8098; Fax: 717-531-5013; E-mail: gprobertson{at}psu.edu.
| Abstract |
|---|
|
|
|---|
70% of melanomas. Thus, targeting Akt3 signaling in melanoma patients has significant therapeutic potential for inhibiting melanomas, but no Akt3-specific chemotherapeutic agent exists. Unfortunately, nonspecific Akt inhibitors can cause systemic toxicity or increase metastasis. Identifying and targeting the Akt3 substrate that deregulates apoptosis might circumvent these complications but would require demonstration of its functional importance in disrupting normal apoptosis. In this study, PRAS40 was identified as an Akt3 substrate that deregulated apoptosis to promote melanoma tumorigenesis. Levels of phosphorylated PRAS40 (pPRAS40) increased during melanoma tumor progression paralleling increasing Akt3 activity. Majority of melanomas from patients with elevated Akt activity also had correspondingly higher levels of pPRAS40. Targeting PRAS40 or upstream Akt3 similarly reduced anchorage-independent growth in culture and inhibited tumor development in mice. Mechanistically, decreased pPRAS40 increased tumor cell apoptosis as well as sensitivity of melanoma cells to apoptosis-inducing agents, thereby decreasing chemoresistance. Collectively, these studies provide a solid mechanistic basis for targeting PRAS40 to inhibit the Akt3 signaling cascade and thereby retard melanoma development. [Cancer Res 2007;67(8):362636] | Introduction |
|---|
|
|
|---|
70% of advanced-stage tumors (4, 5). The generic Akt pathway initiates at the cell surface after growth factors or other extracellular stimuli activate phosphatidylinositol 3-kinase (PI3K). Activated PI3K generates a lipid second messenger, phosphatidylinositol-3,4,5-trisphosphate (PIP3), causing translocation of Akt to the plasma membrane where it is activated through phosphorylation (6, 7). Cellular levels of PIP3 that regulate Akt function are in turn regulated primarily by a phosphatase called PTEN, which serves to lower its levels, thereby decreasing Akt activity (8, 9). Akt in turn phosphorylates >20 different substrates, thereby regulating the activities of proteins and signaling cascades controlling diverse cellular processes, such as cell proliferation and survival (5, 10, 11). Therefore, validation of the functional role of any Akt substrate in a tumorigenic process requires genetic and pharmacologic inhibition and demonstration of its relevance to the particular cellular process (5, 1214).
Three Akt kinase family members, Akt1/protein kinase B (PKB)
, Akt2/PKBß, and Akt3/PKB
, have been identified in human cells sharing extensive structural similarity (15, 16). However, Akt3 is the predominant isoform active in advanced-stage melanomas compared with melanocytes or early-stage lesions that have relatively low levels of activity (4). Although mechanisms of Akt3 activation in melanoma cells remain to be fully elucidated, overexpression of Akt3 and decreased PTEN activity have been identified as playing important roles in this process (4, 9). Reduction of Akt3 activity using small interfering RNA (siRNA) or through PTEN expression decreased the tumorigenic potential of melanoma cells by increasing cellular apoptotic sensitivity (4). Thus, therapeutically targeting Akt3 in melanoma patients has potential of shrinking tumors, but high degree of structural homology to Akt1 and Akt2 has hindered development of agents specifically inhibiting Akt3 rather than targeting all three isoforms (17, 18). Untargeted Akt inhibitors, such as API-2 (triciribine, 1,5-dihydro-5-methyl-1-ß-D-ribofuranosyl-1,4,5,6,8-pentaazaacenaphthylen-3-amine), would then have the drawback of causing systemic toxicity (5, 19, 20). Furthermore, Akt inhibition has been suggested to lead to increased metastasis due to inhibition of proteins, such as NFAT (21). To overcome these limitations, targeting a direct substrate of Akt3 in melanomas might circumvent this complication. An illustrative example is targeting the Akt substrate mammalian target of rapamycin (mTOR) with the drug rapamycin, which is a promising therapeutic for breast and prostate carcinomas (2224). However, for this type of therapeutic strategy to be effective for melanomas, the Akt3 substrate regulating apoptosis would need to be identified, which until now remained to be undertaken.
One recently identified Akt substrate is PRAS40 (proline-rich Akt substrate of 40 kDa; ref. 25). Although early studies are suggestive that it plays some role in cancer development, no study has shown its functional significance in tumorigenesis (26). Like the mTOR, PRAS40 is a cytosolic protein expressed by all tissues, with the highest levels occurring in the liver and heart (25). However, targeting mTOR with rapamycin has minimal manageable clinical side effects, raising the possibility that targeting PRAS40 might be equally effective (23, 27). PRAS40 contains
15% proline residues in contrast to normal proteins having an average of 5% and has an Akt consensus phosphorylation site (RXRXXS/T) located at Thr246 (25). This site can be phosphorylated in vitro using purified Akt, undergoes enhanced phosphorylation when PRAS40 was transiently expressed with constitutively active Akt in HEK293 cells, and undergoes decreased phosphorylation in cells lacking Akt1 and Akt2 (25). Several stimuli enhance PRAS40 phosphorylation, including insulin, nerve growth factor (NGF), and platelet-derived growth factor (28, 29). It also contains a consensus sequence for binding by 14-3-3 proteins (RXXpS/pT) within the Akt phosphorylation site, which may play a role in regulating its activity (25, 28). Inhibition of upstream PI3K using wortmannin or LY-294002 reduced PRAS40 phosphorylation, which could be reversed by expression of constitutively active Akt1 (25, 26, 29). Very little is currently known about the role of PRAS40 in cancer development, and it has no known role in melanoma.
In this study, we identified PRAS40 as an important substrate of the Akt3 kinase, which regulates the apoptotic sensitivity of melanoma cells, thereby promoting melanoma tumorigenesis. Levels of phosphorylated PRAS40 (pPRAS40) increased during melanoma tumor progression paralleling increasing Akt3 activity. The majority of melanomas from patients with high levels of phosphorylated (active) Akt also had correspondingly higher levels of pPRAS40. Targeting PRAS40 or inhibiting upstream Akt3 similarly increased melanoma cell apoptotic sensitivity, causing reduced anchorage-independent growth in culture and delayed tumor development in mice. Thus, PRAS40 is an important downstream target of Akt3 in melanomas, whose phosphorylation leads to pathway signaling that deregulates apoptosis.
| Materials and Methods |
|---|
|
|
|---|
Western blot analysis. For Western blot analysis, cell lysates were harvested by addition of lysis buffer containing 50 mmol/L HEPES (pH 7.5), 150 mmol/L NaCl, 10 mmol/L EDTA, 10% glycerol, 1% Triton X-100, 1 mmol/L sodium orthovanadate, 0.1 mmol/L sodium molybdate, 1 mmol/L phenylmethylsulfonyl fluoride, 20 µg/mL aprotinin, and 5 µg/mL leupeptin. Whole-cell lysates were centrifuged (
10,000 x g) for 10 min at 4°C to remove cell debris. Protein concentrations were quantitated using the bicinchoninic acid assay from Pierce (Rockford, IL), and 30 µg of lysate were loaded per lane onto NuPage gels from Life Technologies, Inc. (Carlsbad, CA). Following electrophoresis, samples were transferred to polyvinylidene difluoride membrane (Pall Corp., Pensacola, FL). The blots were probed with antibodies according to each supplier's recommendations: antibodies to PRAS40 and pPRAS40 from Biosource International (Camarillo, CA); antibodies to hemagglutinin (HA), cyclin D1, p27, C-Raf, extracellular signal-regulated kinase (ERK) 2, and
-enolase from Santa Cruz Biotechnology (Santa Cruz, CA); and antibodies to Akt3, phosphorylated Akt (pAkt; Ser473), phosphorylated ERK1/2, and cleaved and uncleaved caspase-3 from Cell Signaling Technology (Danvers, MA). Secondary antibodies conjugated with horseradish peroxidase were obtained from Santa Cruz Biotechnology. Immunoblots were developed using the enhanced chemiluminescence detection system (Amersham Pharmacia Biotech, Piscataway, NJ).
Ectopic expression studies using Akt3 constructs. HA-tagged wild-type (WT-Akt3), E40K (E40K-Akt3), myristoylated (myr-Akt3), and dead (Dead-Akt3) Akt3 constructs were generated as detailed previously and directionally subcloned into the pcDNA 3.1 (+) puro vector between EcoRI (5') and XbaI (3') sites (4, 31). Constructs were introduced into 1 x 106 WM35 cells via nucleofection using an Amaxa Nucleofector (Amaxa, Koeln, Germany) with the NHEM-Neo solution and electroporation program U-20. For Western blot analysis of nucleofected WM35 cells, 1 x 106 cells were seeded into 60-mm Petri dishes precoated with polyHEMA (Sigma Chemical Co., St. Louis, MO) and whole-cell lysates were collected in lysis solution 3 days later as detailed above.
siRNA protein knockdown studies. siRNA (50300 pmol) was introduced into 1 x 106 UACC 903 or WM115 cells via nucleofection with an Amaxa Nucleofector using Solution R/program K-17 or NHEM-Neo Solution/U-20 program, respectively. Transfection efficiency was >90%. Following nucleofection, cells were replated in culture dishes for 48 h after which protein lysates were harvested for Western blot analysis. Duplexed Stealth siRNA (Invitrogen) was used for these studies. The siRNA sequences used were as follows: PRAS40 #1, CCCUACCCACACAGCAGUACGCCAA; PRAS40 #2, CCAGAAGCUGAAGCGGAAAUAUUGA; C-RAF, GGUCAAUGUGCGAAAUGGAAUGAGC; AKT3, GGACUAUCUACAUUCCGGAAAGA; AKT2, GGCACGGGCUAAAGUGACCAUGAAU; and SCRAMBLED, AAUUCUCCGAACGUGUCACGUGAGA.
To show duration of siRNA-mediated protein knockdown in cultured cells, 1 x 106 UACC 903 cells were nucleofected with 100 pmol of siPRAS40 #1 or siPRAS40 #2 and replated in culture dishes and protein lysates were harvested 2, 4, 6, 8, and 10 days later for Western blot analysis to determine PRAS40 protein levels in cells. ERK2 served as a control for protein loading on Western blots. Cells nucleofected with a scrambled siRNA served as control.
Anchorage-independent growth and apoptosis studies. For anchorage-independent growth and apoptosis studies, 200 pmol of siRNA against PRAS40 or Akt3 were nucleofected into UACC 903 cells and replated in DMEM supplemented with 10% FBS. Forty-eight hours later, cells were trypsinized and plated into polyHEMA-coated 96-well plates at a density of 2 x 104 per well in 100 µL serum-free medium. Number of viable cells after 3 days of growth in serum-free medium was determined by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay (Promega, Madison, WI). For Western blot analysis, 1 x 106 cells were grown in serum-free medium for 3 days after nucleofection and protein lysates were collected as detailed above. Protein lysates obtained from buffer and scrambled siRNA-nucleofected cells served as controls. To measure apoptosis rates of cells growing anchorage independently, a caspase-3/7 assay was carried out using the Apo-ONE Homogeneous Caspase-3/7 Assay kit (Promega). Three days after plating 2 x 104 cells per well in a polyHEMA-coated 96-well plate, 100 µL of Apo-ONE Caspase-3/7 reagent substrate (Z-DEVD-Rhodamine 110, diluted 100 times in Apo-ONE Caspase-3/7 buffer) were added. After a light-protected 4-h room temperature incubation, liberated Rhodamine 110 product was measured using the SpectraMax M2 plate reader operating with SoftMax Pro version 5 software (Molecular Devices Corp., Sunnyvale, CA) at an excitation wavelength of 485 nm and emission wavelength of 520 nm. Results were expressed as relative fluorescent units. Cells transfected with buffer only or scrambled siRNA served as controls.
Studies involving human melanoma tumors. Melanomas from human patients were collected according to protocols approved by the Penn State Human Subjects Protection Office and Cooperative Human Tissue Network. Protein lysates were extracted from tumors containing >60% tumor material as detailed previously (4) and analyzed by Western blotting to measure levels of pAkt and pPRAS40. Protein levels were normalized to
-enolase expression, and three independent blots were quantified using FujiFilm Science Lab 2001 Image Gauge (version 4.0; Fuji Photo Film Co. Ltd., Tokyo, Japan) to establish the average levels of phosphorylation, which are listed. Correlation between pAkt and pPRAS40 levels was assessed by Pearson's correlation analysis.
Pharmacologic inhibition of PI3K or Akt. PI3K was inhibited in UACC 903 cells using 50 µmol/L LY-294002 from Alexis Biochemicals (San Diego, CA). Cells (2.5 x 105) grown in DMEM supplemented with 10% FBS were plated in 60-mm culture dishes, and after 48 h of growth, cells were serum starved for 24 h. Cells were then treated with either 50 µmol/L LY-294002 or DMSO vehicle in medium lacking serum for 1 h followed by serum stimulation for 30 and 60 min (9, 32). Akt was inhibited in UACC 903 and WM115 cells using API-2 from Tocris Bioscience (Ellisville, MO). For this study, UACC 903 cells (2.5 x 105) were plated in 60-mm dishes in DMEM containing 10% FBS for 48 h and then serum starved for 24 h. Cells were then treated with 100 µmol/L API-2 or DMSO vehicle in medium lacking serum for 48 h followed by stimulation with serum-containing medium for 15 or 30 min (33). Similarly for studies involving the WM115 cell line, 2.5 x 105 cells were grown in Tu2% medium lacking calcium chloride supplemented with 2% FBS and treated with API-2 (4, 9). Protein lysates were analyzed by Western blotting. Mitogen-activated protein kinase (MAPK)/ERK kinase (MEK) was inhibited by treating UACC 903 with U0126 from Cell Signaling Technology. UACC 903 cells (2.5 x 105) were plated in 60-mm dishes in DMEM containing 10% FBS and treated with 1, 5, 10, and 25 µmol/L concentrations of U0126 for 48 h. Protein lysates were harvested and analyzed by Western blotting (34, 35).
Apoptotic sensitivity assessments using staurosporine. UACC 903 cells containing an introduced chromosomal copy of PTEN (29A, 36A, and 37A) and revertant 36A-R1 and 36A-R2 cell lines that had lost the introduced PTEN were treated with 1 µmol/L staurosporine (BIOMOL International, Plymouth Meeting, PA) or with DMSO vehicle for 4 h and proteins were harvested for Western blotting (9). After 2 days of recovery in DMEM supplemented with 10% FBS, UACC 903 and WM115 cells nucleofected with siRNA against PRAS40 or Akt3 were treated with 0.4 µmol/L staurosporine for 4 h. Protein lysates were collected for Western blotting to measure levels of cleaved caspase-3, a marker of apoptosis.
Tumorigenicity assessments, knockdown of protein expression, and measurement of proliferation/apoptosis rates in tumors. Animal experimentation was done according to protocols approved by the Institutional Animal Care and Use Committee at The Pennsylvania State University College of Medicine. Tumor kinetics were measured by s.c. injection of 1 x 106 UACC 903 cells nucleofected with siRNA (siScrambled, siAkt3, siC-Raf, siPRAS40 #1, and siPRAS40 #2) in 0.2 mL of DMEM supplemented with 10% FBS above both left and right rib cages of 4- to 6-week-old female nude mice (Harlan Sprague Dawley, Indianapolis, IN). Dimensions of developing tumors were measured using calipers on alternate days up to day 17.5. To measure siRNA-mediated knockdown of protein expression in tumors developing in animals, 5 x 106 UACC 903 cells nucleofected with siRNA to Akt3 or 10 x 106 cells nucleofected with siPRAS40 (#1 and #2) were s.c. injected into nude mice. Six and 8 days later, tumors were removed from euthanized mice, flash frozen in liquid nitrogen, and pulverized and protein lysates were collected by the addition of 600 to 800 µL of protein lysis buffer [50 mmol/L Tris-HCl (pH 7.5) containing 0.1% Triton X-100, 1 mmol/L EDTA, 1 mmol/L EGTA, 50 mmol/L sodium fluoride, 10 mmol/L sodium ß-glycerol phosphate, 5 mmol/L sodium pyrophosphate, 1 mmol/L activated sodium orthovanadate, protease inhibitor cocktail from Sigma, 0.1% (v/v) 2-mercaptoethanol]. Protein lysates were quantitated using Bio-Rad protein assay reagent (Bio-Rad Laboratories, Hercules, CA) followed by Western blotting to measure levels of Akt3 protein in tumors. For mechanistic studies, 5 x 106 UACC 903 cells nucleofected with control siRNA, siC-Raf, siAkt2, or siAkt3 or 20 x 106 cells nucleofected with siRNA to PRAS40 (#1 or #2) were injected into nude mice to generate tumors of the same size developing at parallel time points. Size- and time-matched tumors were harvested 4 days later to assess changes in cell proliferation and apoptosis. Apoptosis and cell proliferation rates were measured in formalin-fixed, paraffin-embedded tumor sections using the terminal deoxynucleotidyl transferasemediated dUTP nick end labeling (TUNEL) TMR Red Apoptosis kit from Roche (Mannheim, Germany) or purified mouse anti-human Ki-67 from PharMingen (San Diego, CA), respectively (4, 9). A minimum of six different tumors with four to six fields per tumor was analyzed, and results were represented as the average ± SE.
Statistical analysis. Statistical analysis was undertaken using the one-way ANOVA followed by the Dunnett's post hoc test. Correlation assessment of pAkt and pPRAS40 levels in protein lysates extracted from patient melanomas was undertaken using the Pearson's correlation analysis. Results were considered significant at a P value of <0.05.
| Results |
|---|
|
|
|---|
|
Increased Akt activity in tumors from melanoma patients is accompanied by a corresponding increase in pPRAS40. Because the foregoing experiments identified PRAS40 as a substrate protein phosphorylated by Akt3, studies next focused on establishing whether PRAS40 phosphorylation paralleled increased Akt activity observed in tumors from melanoma patients. A collection of 30 flash-frozen metastatic melanomas removed from patients was examined by Western blotting to measure the relative intensity of pAkt and pPRAS40 to determine whether phosphorylation levels paralleled one another. Prior studies using this tumor panel showed increased Akt3 expression or activity compared with melanocytes in 43% to 60% of samples (4). Level of pPRAS40 in this panel of tumors increased in parallel to pAkt levels in a statistically significant fashion (P < 0.05, Pearson's correlation analysis; Fig. 1C). Coupling this discovery with prior immunohistochemical results showing strong levels of pAkt in 12% of dysplastic nevi, 53% of primary melanomas, and 67% of metastatic melanomas suggested that, as Akt activity increased during melanoma tumor progression, there was a corresponding increase in levels of pPRAS40 (4). Note that three tumors had elevated pAkt but low pPRAS40, whereas eight tumors with low pAkt had significantly elevated pPRAS40 levels. Thus, the majority of patient melanomas had elevated levels of pPRAS40, making this protein a reasonable downstream target in this signaling cascade.
Pharmacologic inhibition of PI3K or Akt reduces levels of pPRAS40 in melanoma cells. To confirm observations that inhibition of the Akt3 signaling cascade reduced PRAS40 phosphorylation, melanoma cells were exposed to the PI3K inhibitor LY-294002 (4, 32) or an Akt inhibitor called API-2 (Fig. 2A and B ; refs. 32, 33). Signaling through the PI3K pathway before pharmacologic inhibition was ensured by serum starving cells for 24 h followed by serum stimulation for 5 to 30 min in the absence or presence of each respective inhibitor. Serum stimulation for each cell line was determined empirically to identify two time points at which Akt signaling was significantly stimulated. Western blot analysis showed that exposure of UACC 903 cells to LY-294002 or API-2 but not to U0126, a MAPK pathway inhibitor (data not shown), reduced levels of pAkt and pPRAS40 in both cell lines (Fig. 2A and B). Interestingly, inhibition of PI3K with LY-294002 caused a decrease in Akt3 expression and increased levels of PRAS40 protein (Fig. 2A). However, because this change was not observed following Akt inhibition using API-2 (Fig. 2B), it was considered as a pharmacologic phenomenon related to LY-294002 and not investigated further. Thus, pharmacologic inhibition of upstream PI3K or Akt3 activity in melanoma cells reduced levels of pPRAS40.
|
-enolase loading control. Akt2 knockdown served as a control because it is activated or amplified in several cancer types but not in melanoma (3841). Increasing concentrations of siRNA against Akt3 or Akt2 led to a concentration-dependent decrease in expression of each respective protein (Fig. 2C). In contrast to Akt2 reduction, decreased Akt3 expression caused a dose-dependent decrease in both pAkt and pPRAS40 in UACC 903 and WM115 cells. No change was detected in level of total PRAS40 following knockdown of expression of either protein (Fig. 2C). Thus, siRNA-mediated inhibition of Akt3, but not Akt2, reduced levels of pPRAS40 in melanoma cells, showing that Akt3 regulates PRAS40 phosphorylation in melanoma cells. siRNA-mediated inhibition of PRAS40 retards anchorage-independent growth by increasing apoptosis in melanoma cells. To investigate the functional role of PRAS40 in melanoma development, siRNA was used to inhibit protein expression in cells and effect on anchorage-independent growth and apoptosis was measured. Knockdown of Akt3 protein expression (activity) served as a control to show the consequence of shutting down the signaling cascade upstream of PRAS40. Following introduction of siRNA, cells were seeded in polyHEMA-coated 96-well plates, and 3 days later, anchorage-independent cell viability and apoptosis rates were measured. Western blot analysis confirmed knockdown of PRAS40 and Akt3 protein expression and showed corresponding increases in cleaved caspase-3 levels, suggesting an increase in levels of apoptosis (Fig. 3A ). This possibility was further supported following detection of increased cellular apoptosis observed by measuring changes in levels of caspase-3/7 in cells in which siRNA had been used to decrease PRAS40 or Akt3 protein levels (P < 0.05, one-way ANOVA; Fig. 3B). Furthermore, anchorage-independent cell viability measured using the MTS assay decreased in a statistically significant (P < 0.05, one-way ANOVA) manner following reduction of PRAS40 or Akt3 protein levels (Fig. 3C). Similar results were observed when PRAS40 was knocked down using two different siRNA molecules compared with buffer only or scrambled siRNA controls. Mechanistically, cells, in which PRAS40 or Akt3 protein expression had been reduced, had significantly higher levels of cleaved caspase-3 and cellular apoptosis, suggesting that increased apoptosis was contributing to decreased anchorage-independent growth (Fig. 3A and B), which was subsequently confirmed in tumors developing in animals where PRAS40 has been targeted. Thus, reduction of PRAS40 or upstream Akt3 reduced anchorage-independent growth in a similar fashion by increasing levels of cellular apoptosis.
|
|
To directly show that decreased pPRAS40 would increase apoptotic sensitivity of melanoma cells, siRNA was used to reduce expression of PRAS40 or Akt3 followed by exposure to 0.4 µmol/L staurosporine for 4 h (Fig. 4C). Compared with untransfected cells or cells nucleofected with control scrambled siRNA, reduced Akt3 or PRAS40 protein expression similarly increased cleaved caspase-3 levels in both UACC 903 and WM115 cells following staurosporine exposure (Fig. 4C). Collectively, these results indicate that increased PRAS40 phosphorylation, associated with PTEN loss and/or Akt3 activation, functions to decrease sensitivity of melanoma cells to apoptotic stimuli, thereby promoting chemoresistance to these agents.
siRNA-mediated inhibition of PRAS40 decreased the tumorigenic potential of melanoma cells. The role played by PRAS40 in melanoma tumorigenesis is currently unknown. To identify its functional role in melanoma tumorigenesis, siRNA was used to inhibit PRAS40 in UACC 903 cells s.c. injected into mice. Two different PRAS40 siRNAs were independently introduced into UACC 903 cells via nucleofection, resulting in transfection efficiencies of >90%, which effectively knocked down protein expression. siRNA against Akt3 was used to knock down protein expression, which was then used as a control. Decreased PRAS40 protein levels 48 h after nucleofection are shown in Fig. 5A . In contrast to protein knockdown observed following treatment of cells with siRNA against PRAS40 or Akt3, control scrambled siRNA or siRNA to C-Raf did not alter expression of either of these proteins. siRNA-mediated knockdown of PRAS40 persisted for >10 days in culture (Fig. 5B), which is similar to prior reports for duration of siRNA-mediated protein knockdown using the nucleofection approach (4, 35, 42). Following s.c. injection of cells into mice, size of developing tumors was measured on alternate days up to 17.5 days following nucleofection (Fig. 5C). A reduction in tumorigenic potential was observed in UACC 903 cells in which PRAS40 expression had been decreased similar to that occurring following Akt3 protein knockdown (Fig. 5C). In contrast, siRNA-mediated inhibition of C-Raf, a scrambled siRNA, or buffer controls did not alter tumor development. Tumors removed from animals 7.5 and 9.5 days after nucleofection of siRNA into the cells showed decreased PRAS40 protein expression compared with a tumor formed from cells nucleofected with a scrambled siRNA control (Fig. 5D). Furthermore, decreased PRAS40 protein expression led to a corresponding reduction in pPRAS40 protein present in tumors. Thus, inhibition of PRAS40 or upstream Akt3 in melanoma cells similarly reduced the tumorigenic potential of melanoma cells.
|
|
| Discussion |
|---|
|
|
|---|
70% of melanomas functioning to promote tumorigenesis by deregulating apoptosis (4). Validating the role of any downstream Akt3 substrate in apoptosis deregulation, therefore, requires genetic and pharmacologic inhibition to validate its role in this process (5, 12, 43, 44). In this study, PRAS40 is shown to be an Akt3 substrate that deregulates apoptosis to promote melanoma development and chemoresistance to apoptosis-inducing agents. Thus, this is the first report to document a functional role for PRAS40 in melanoma development. Demonstration of PRAS40 as an Akt3 substrate in melanoma was established using siRNA and pharmacologic inhibition. Pharmacologically inhibiting Akt3 using API-2 or upstream PI3K using LY-294002 reduced levels of pPRAS40 in melanoma cells. In contrast, a MEK inhibitor, U0126, had no effect on levels of pPRAS40, indicating signaling pathway specificity. Other groups have similarly reported decreased phosphorylation of PRAS40 following exposure to PI3K inhibitor wortmannin or LY-294002 but not when using MAPK inhibitor PD098059 or U0126 (25, 26, 28, 29). Direct inhibition of Akt3 using siRNA specifically targeting this protein decreased levels of pPRAS40 similar to pharmacologic inhibition. In contrast, targeting Akt2 using siRNA had no discernible effect on pPRAS40 levels, which further showed involvement in the Akt3 signaling cascade. Thus, PRAS40 is a substrate downstream of Akt3 in melanomas.
Regulation of pPRAS40 levels by Akt3 during melanoma development was established using a cultured melanoma tumor progression model as well as in advanced melanomas removed from patients. Levels of pPRAS40 increased during melanoma tumor progression with lowest amounts detected in melanocytes and highest levels occurring in advanced-stage melanomas. This increase paralleled elevated Akt3 activity observed in more aggressive melanomas and could be observed both in cultured cell line progression models and in tumors taken directly from melanoma patients. The majority of melanomas from patients with high levels of phosphorylated (active) Akt have correspondingly higher levels of pPRAS40. The few patient melanomas that do not have elevated pPRAS40 likely have other yet to be identified genetic defects activating the signaling cascade downstream of PRAS40. Other groups have also reported elevated levels of pPRAS40 in cell lines established from breast and lung tumors compared with control tissue, further supporting an important role for PRAS40 in cancer development (26).
The importance of Akt3 deregulation for regulating pPRAS40 levels during melanoma development was shown using an ectopic expression model in which Akt3 was expressed in melanoma cells having very low endogenous levels of Akt3 activity and pPRAS40. Ectopically expressed Akt3 increased activity, leading to a proportional and corresponding increase in pPRAS40 levels. Increased Akt3 activity at physiologic levels following overexpression of normal WT or active E40K-Akt3 producing activity within the normal physiologic range led to higher pPRAS40 levels. Similar to these results, induction of a conditionally active myristoylated Akt1 in NIH3T3 cells led to increased phosphorylation of ectopically expressed PRAS40 (25). Thus, increasing Akt3 activity occurring during melanoma tumor progression leads to increased pPRAS40 levels.
The role played by PRAS40 in melanoma development was shown using siRNA-mediated inhibition to measure effect on the tumorigenic potential of melanoma cells. Two different siRNA molecules targeting PRAS40 at different sites reduced tumor development to levels similar to those occurring when Akt3 was targeted using siRNA. siRNA effectively reduced protein expression in cultured cells and significantly delayed tumor development in animals. Mechanism leading to tumor inhibition was established by comparison of apoptosis and proliferation in temporally and spatially matched tumors. Although PRAS40 inhibition did not affect proliferation, it did increase rates of apoptosis in the tumor by 15- to 20-fold compared with control cells in which siRNA was used to target Akt2 or C-Raf. Targeting PRAS40 also led to a
30% decrease in anchorage-independent growth, which seemed to be caused by increased levels of apoptosis, mediated through cleaved caspase-3. These observations were not surprising because we previously showed that Akt3 played a significant role in regulating apoptosis in melanomas (4). pPRAS40 has been previously linked to caspase-3mediated apoptosis through studies investigating neuronal apoptotic cell death after transient focal cerebral ischemia (28, 45). No colocalization of pPRAS40 and caspase-3 could be detected in cells either undergoing apoptosis or progressing toward apoptosis, which indicated that pPRAS40 inhibits cellular apoptosis by preventing caspase-3 cleavage (28, 45). The mechanism and signaling cascade downstream of PRAS40 regulating cellular apoptosis remains to be fully elucidated. However, PRAS40 is an Akt3 substrate deregulating apoptosis during melanoma tumor development by mediating levels of cleaved caspase-3.
Lack of therapeutic effectiveness in melanomas is due, in part, to deregulation of apoptosis (1, 5, 36). Because most chemotherapeutics function by triggering the apoptotic pathway, apoptotic deregulation in melanoma cells plays an important role in promoting chemoresistance to these agents (4, 36, 46, 47). The identity of PRAS40 as an Akt3 substrate promoting apoptotic deregulation and chemoresistance in melanoma cells is important for unraveling effective therapeutic strategies for melanoma patients. Here, cell-based models in which pPRAS40 levels were decreased, by PTEN expression or siRNA-mediated protein inhibition, were exposed to the apoptosis-inducing agent staurosporine, which is frequently used to establish cellular sensitivity to apoptosis-inducing agents in melanomas (9, 48). The presence of PTEN in melanoma cells significantly decreased pPRAS40 levels and sensitized cell to staurosporine-mediated apoptosis. Likewise, decreasing pPRAS40 protein levels using siRNA similarly increased rates of staurosporine-mediated apoptosis. The antiapoptotic activity of pPRAS40 mediated by NGF has been reported to play a neuroprotective role by decreasing neuronal cell death occurring after transient focal cerebral ischemia (28, 45, 49, 50). Thus, increased PRAS40 phosphorylation promotes melanoma cell survival in the tumor environment as well as development of chemoresistance.
In conclusion, we identified PRAS40 as an Akt3 substrate deregulating apoptosis to promote melanoma tumorigenesis and chemoresistance. Targeting PRAS40 reduced the tumorigenic potential of melanoma cells and increased sensitivity to agents triggering apoptosis. In contrast, presence of high levels of pPRAS40 provided melanoma cells with selective survival advantage in the tumor environment and resistance to apoptosis-inducing agents. Thus, this study provides a mechanistic-based underpinning for therapeutically targeting PRAS40 to inhibit melanoma development by restoring normal apoptotic control and sensitizing cells to apoptosis-inducing chemotherapeutic agents.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Mitchell Cheung, Melissa Tran, Kort Ulicny, Sandeep Shah, and Shantu Amin for technical assistance.
| Footnotes |
|---|
Received 11/16/06. Revised 1/25/07. Accepted 2/ 6/07.
| References |
|---|
|
|
|---|
with regulatory phosphorylation sites in the activation loop and in the C-terminal hydrophobic domain. J Biol Chem 1999;274:91336.This article has been cited by other articles:
![]() |
A. P. Petty, S. E. Wright, K. A. Rewers-Felkins, M. A. Yenderrozos, B. A. Vorderstrasse, and J. S. Lindsey Targeting Migration inducting gene-7 inhibits carcinoma cell invasion, early primary tumor growth, and stimulates monocyte oncolytic activity Mol. Cancer Ther., August 1, 2009; 8(8): 2412 - 2423. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sharma, A. K. Sharma, S. V. Madhunapantula, D. Desai, S. J. Huh, P. Mosca, S. Amin, and G. P. Robertson Targeting Akt3 Signaling in Malignant Melanoma Using Isoselenocyanates Clin. Cancer Res., March 1, 2009; 15(5): 1674 - 1685. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, T. E. Harris, and J. C. Lawrence Jr. Regulation of Proline-rich Akt Substrate of 40 kDa (PRAS40) Function by Mammalian Target of Rapamycin Complex 1 (mTORC1)-mediated Phosphorylation J. Biol. Chem., June 6, 2008; 283(23): 15619 - 15627. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Garcia and D. Danielpour Mammalian target of rapamycin inhibition as a therapeutic strategy in the management of urologic malignancies Mol. Cancer Ther., June 1, 2008; 7(6): 1347 - 1354. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Tran, C. D. Smith, M. Kester, and G. P. Robertson Combining Nanoliposomal Ceramide with Sorafenib Synergistically Inhibits Melanoma and Breast Cancer Cell Survival to Decrease Tumor Development Clin. Cancer Res., June 1, 2008; 14(11): 3571 - 3581. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cheung, A. Sharma, S. V. Madhunapantula, and G. P. Robertson Akt3 and Mutant V600EB-Raf Cooperate to Promote Early Melanoma Development Cancer Res., May 1, 2008; 68(9): 3429 - 3439. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Madhunapantula, D. Desai, A. Sharma, S. J. Huh, S. Amin, and G. P. Robertson PBISe, a novel selenium-containing drug for the treatment of malignant melanoma Mol. Cancer Ther., May 1, 2008; 7(5): 1297 - 1308. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Fonseca, E. M. Smith, V. H.-Y. Lee, C. MacKintosh, and C. G. Proud PRAS40 Is a Target for Mammalian Target of Rapamycin Complex 1 and Is Required for Signaling Downstream of This Complex J. Biol. Chem., August 24, 2007; 282(34): 24514 - 24524. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |