| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
Surgery Branch, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, Maryland
Requests for reprints: Richard A. Morgan, Surgery Branch, National Cancer Institute, Room 3W5940, Building 10, MSC 1201, 10 Center Drive, Bethesda, MD 20892-1201. Phone: 301-594-9629; Fax: 301-435-5167; E-mail: rmorgan{at}mail.nih.gov.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In that regard, we recently showed that TCR in which the human constant regions were replaced with murine ones functioned better in human cells, leading to an increased sensitivity to tumor cells (3). Although the possible antigenicity of murine constant regions expressed in human patients remains to be proven, we sought to develop additional strategies that could promote preferential pairing of the introduced TCR. Boulter et al. developed an approach to stabilize soluble TCR by mutating defined residues in the constant regions to cysteines to generate an additional disulfide bond between the TCR chains (4). Herein, we sought to examine whether this additional disulfide bond introduced into native TCR would function in the context of a living cell. Several TCRs that were accordingly mutated exhibited enhanced surface expression, tumor recognition, and more efficient pairing. These results could have significant implications for the improvement of TCR gene therapy in patients.
| Materials and Methods |
|---|
|
|
|---|
Cysteine-modified TCR generation and cloning. We generated cysteine-modified
and ß chains from different TCRs using a PCR megaprimer approach. We generated the first fragment by amplifying the chains with a 5'-specific primer and either the
-Cys48rev primer, TAGACCTCATGTCTAGCACGCATTTGTCTGTGATATACACATC or the ß-Cys57rev primer, TGAGGGGCTGCGGGTCCGTGCAGACCCCACTGTGCACCTCC for the
and ß chains, respectively (mutated bases are underlined). The product of this reaction was used as a megaprimer to amplify full-length TCR chain with a 3'-specific primer. The full-length chain was subcloned into the pGEM-4Z/64A vector as previously described (3).
Electroporation of peripheral blood lymphocytes. This technique has been extensively described in our previous reports (3, 6). Briefly, in vitro transcribed mRNA encoding
and ß TCR chains generated using mMESSAGE-mMACHINE (Ambion, Austin, TX) was electroporated into OKT3-stimulated lymphocytes using an ElectroSquarePorator ECM-830 (BTX, San Diego, CA). The amount of in vitro transcribed mRNA for each chain was 1.5 µg per 106 PBMCs unless indicated otherwise.
Antibodies and MHC multimers. Human Vß12 antibody phycoerythrin-conjugated was supplied by Immunotech (Westbrook, ME). p53264-272/HLA-A2 pentamer was supplied by ProImmune (Oxford, United Kingdom), and MART-127L/HLA-A2 tetramer was supplied by Beckman Coulter (San Jose, CA).
Cytokine release assays. Peripheral blood lymphocytes (PBL) cultures were tested for reactivity in cytokine release assays using commercially available ELISA kits (Endogen, Cambridge, MA).
Statistical analysis. Results of cytokine secretion shown as mean ± SD were compared using Student's t test. The P obtained is indicated in the figure legends.
51Cr release assay. The ability of the electroporated PBLs to lyse targets was measured using a 51Cr release assay as described (5).
CD4/CD8 separation. CD4+ and CD8+ populations were separated using commercially available kits (Dynal Biotech, Brown Deer, WI and Miltenyi Biotech, Auburn, CA).
| Results and Discussion |
|---|
|
|
|---|
chain and Ser57 on the ß chain with cysteines to facilitate the creation of an additional disulfide bond between the TCR constant regions (ref. 4; Fig. 1A
). Boulter et al. originally showed the successful stabilization of the soluble form of this TCR by the addition of the same nonnative interchain disulfide bond, later confirmed by crystallographic analysis (4). We electroporated OKT3-stimulated human PBLs with mRNA encoding the TCR
and ß chains from 1G4 or its cysteine-modified form (1G4-Cys) and cocultured those cells with different NY-ESO+ cell lines. RNA electroporation enables the use of normalized levels of mRNA and is, unlike other common gene transfer methods, not dependent on retroviral vector titer, insertion sites, or the influence of diverse transcription mechanisms (3, 6). We observed an increased secretion of IFN-
mediated by 1G4-Cys compared with the wild-type receptor 1G4 (e.g., 2,639 versus 942 pg/mL for 624.38, respectively, in Fig. 1B). It is interesting to note that the validity of observations first shown in soluble molecules (4) could be extended to cellular systems, paving the way for novel immunologic approaches for the study of TCR structure and function.
|
|
chain with the cysteine-modified ß (noted as F4-
/ßCys), or the opposite (F4-
Cys/ß)]. PBLs expressing both F4 combinations
/ßCys and
Cys/ß stained with MART-1 tetramer (23% and 25%, respectively). This shows that the
Cys or ßCys can pair with wild-type ß or
chain, respectively, but that cysteines on both chains are simultaneously needed to achieve enhanced TCR expression.
We determined if the enhanced surface expression of F4-Cys was correlated with a higher biological activity by coculturing PBLs expressing F4 or F4-Cys with different human melanoma tumor lines. HLA-A2+ melanoma tumors (526 and 624) specifically stimulated MART-1 TCR-expressing T cells to secrete cytokines IFN-
and granulocyte macrophage colony-stimulating factor (GM-CSF; Fig. 2C). F4-Cys was able to trigger up to 5-fold more cytokine secretion than F4. No significant cytokine secretion was noted in cocultures with control HLA-A2 melanoma lines (888 and 938). In addition, we observed TCR down-regulation in cells expressing either F4 or F4-Cys following overnight coculture with cells pulsed with the MART-1 epitope (data not shown), which shows that TCR internalization is not influenced by the cysteine modifications.
Additionally, cell-mediated cytotoxicity of PBLs expressing either F4 or F4-Cys was compared in a 3-h 51Cr release assay. CD8+ PBLs were electroporated with mRNA encoding both anti-MART-1 TCRs and cocultured with 51Cr-labeled tumors. Although both TCRs were able to mediate specific lysis of HLA-A2+ melanoma lines (Fig. 2D), the lymphocytes expressing F4-Cys showed higher lysis compared with the wild type (e.g., 25.4 % versus 11.8 % of specific lysis for the 624 target cell line, at 25:1 E/T ratio, respectively). No significant lysis was observed by mock-electroporated PBLs or of control 888 and 938 melanoma lines that were HLA-A2.
The additional engineered disulfide bond cannot substitute for the native interchain one. In three independent experiments with a mutant version of F4-Cys, in which we eliminated the original bond, we observed much lower TCR and Vß12 surface expression as well as impaired cytokine secretion in coculture with specific tumors (data not shown). These results are consistent with previous reports that showed that the original interchain disulfide bond is essential for TCR activity (7, 8).
Enhanced expression and activity is a general property of cysteine-modified TCRs. To investigate the generality of these results, we similarly mutated the following TCRs by adding cysteine residues: F5, a second MART-1specific TCR (9) and both humanized (p53-H) and wild-type (p53-M) forms of the murine anti-p53 TCR (previously described in refs. 3, 10).
All cysteine-engineered TCRs showed enhanced surface expression and improved biological activity when compared with their wild-type versions (Fig. 3
). This effect was not restricted only to TCR expressed in CD8+ cells because OKT3-stimulated CD4+ lymphocytes (>98% purity) that were electroporated with the cysteine-modified version of the CD8-independent receptor F5 (i.e., F5-Cys) stained a greater proportion of cells than the wild-type F5 receptor (85% versus 67%, respectively; Fig. 3A) and triggered higher cytokine secretion (IFN-
: Fig. 3B and GM-CSF: data not shown). The enhancement of CD4+ cell function and their recruitment at tumor sites may be especially important because CD4 helper responses can be essential for mediating efficient antitumor activity as well as the maintenance of functional CD8+ T-cell memory (11).
|
: p53-H, 12,315 pg/mL; p53-Hcys, 21,347 pg/mL; and p53-M, 33,770 pg/mL in Fig. 3D; GM-CSF: data not shown). These results indicated that it is possible to partly overcome the loss of biological activity due to the partial humanization of murine TCRs using cysteine modifications.
We additionally mutated the native fully murine anti-p53 TCR by adding cysteines at the corresponding positions in mouse constant regions (p53-MCys). The latter TCR showed higher surface expression than p53-M (84% versus 78% pentamer-positive cells) and greater cytokine-mediated secretion (e.g., for the H2087 cell line, IFN-
: 41,252 versus 33,770 pg/mL in Fig. 3C and D). These results suggested that this region of the TCR constant subunits exhibits similar structural features both in human and murine receptors, and that this approach might be further applied to enhance the efficacy of TCR gene transfer in mouse models.
Preferential pairing of cysteine-modified TCR chains. The mispairing of the introduced TCR subunits with endogenous TCR chains may result in the reduction of the cell surface density of the exogenous TCR and therefore greatly impairs its function (3, 13). In contrast, we showed an increased proportion of MHC/multimerpositive cells that expressed the cysteine-modified form of any TCR tested, rather than its wild-type form (Figs. 2 and 3), which may suggest a more effective pairing of the cysteine-modified constant regions with themselves, leading to improved biological function.
To test this hypothesis, we did two types of experiments. First, we electroporated OKT3-stimulated PBLs with titrated amounts of mRNA encoding either the F5 or F5-Cys receptor (from 0.1 to 3 µg for each chain). We then cocultured those lymphocytes with melanoma tumors and compared cytokine secretion 24 h after electroporation. Figure 4A
shows that lower amounts of F5-Cys are required to achieve similar levels of IFN-
secretion compared with F5. This was paralleled by improved MART-1 tetramer staining of lymphocytes expressing the F5-Cys receptor compared with F5 (data not shown). Comparable results were obtained in titration experiments with F4 and F4-Cys (data not shown). These observations suggested that specific pairing of cysteine-modified
and ß chains was more efficient and accounted for the enhanced biological activity.
|
As shown in Fig. 4B, F4-Cys was relatively insensitive to the addition of competitive TCR. In contrast, the expression of the native receptor F4 was significantly reduced by the presence of competitive TCR. We stained the electroporated cells for Vß12 surface expression and observed similar levels for both MART-1 TCRs (data not shown), suggesting that the decrease in tetramer staining of F4 was not due to a lower TCR chain expression but more likely to nonspecific pairing with the competitor chains. Competition seemed to be dose dependent because we observed an increase in fluorescence intensity for both F4-H and F4-Hcys when we lowered the amount of the p53-H competitor to half (1:0.5). Additionally, we noted diverse levels of competition by different competitor TCRs, which may reflect preferential interactions of certain TCRs with the F4 variable regions, leading to different expression efficiencies (14, 15) or a "functional allelic exclusion" at the protein level (16). Comparable results were obtained when we compared the expression of p53-H and p53-HCys in similar TCR competition experiments (data not shown).
Taken together, these findings indicated that a cysteine-modified TCR is less likely to participate in unproductive mispairing with the endogenous TCR in lymphocytes, which leads to its overrepresentation on the cell surface and improved biological activity. Our findings that the introduction of an additional disulfide bond in five distinct TCRs enhanced expression and activity suggest that this modification is likely to improve the function of any TCR. These observations of preferential paring have potential clinical relevance for ongoing cancer gene therapy trials (2). Moreover, a higher density of TCR may help to reach the critical threshold for T-cell activation as previously shown (17).
In conclusion, we showed that it is possible to improve expression and biological activity of TCRs by promoting the creation of an additional interchain disulfide bond. Such biological improvement has important implications for the treatment of viral disease and cancer using TCR gene transfer to reprogram the specificity of patient lymphocytes.
| Acknowledgments |
|---|
Received 10/27/06. Revised 2/ 1/07. Accepted 2/ 8/07.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G. P. Wright, C. A. Notley, S.-A. Xue, G. M. Bendle, A. Holler, T. N. Schumacher, M. R. Ehrenstein, and H. J. Stauss Adoptive therapy with redirected primary regulatory T cells results in antigen-specific suppression of arthritis PNAS, November 10, 2009; 106(45): 19078 - 19083. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wang, K. Natarajan, and D. H. Margulies Structural Basis of the CD8{alpha}{beta}/MHC Class I Interaction: Focused Recognition Orients CD8{beta} to a T Cell Proximal Position J. Immunol., August 15, 2009; 183(4): 2554 - 2564. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. de Witte, A. Jorritsma, A. Kaiser, M. D. van den Boom, M. Dokter, G. M. Bendle, J. B. A. G. Haanen, and T. N. M. Schumacher Requirements for Effective Antitumor Responses of TCR Transduced T Cells J. Immunol., October 1, 2008; 181(7): 5128 - 5136. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Griffioen, H.M. E. van Egmond, H. Barnby-Porritt, M. A.W.G. van der Hoorn, R. S. Hagedoorn, M. G.D. Kester, N. Schwabe, R. Willemze, J.H. F. Falkenburg, and M. H.M. Heemskerk Genetic engineering of virus-specific T cells with T-cell receptors recognizing minor histocompatibility antigens for clinical application Haematologica, October 1, 2008; 93(10): 1535 - 1543. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Sebestyen, E. Schooten, T. Sals, I. Zaldivar, E. San Jose, B. Alarcon, S. Bobisse, A. Rosato, J. Szollosi, J. W. Gratama, et al. Human TCR That Incorporate CD3{zeta} Induce Highly Preferred Pairing between TCR{alpha} and {beta} Chains following Gene Transfer J. Immunol., June 1, 2008; 180(11): 7736 - 7746. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.-H. Voss, R. A. Willemsen, J. Kuball, M. Grabowski, R. Engel, R. S. Intan, P. Guillaume, P. Romero, C. Huber, and M. Theobald Molecular Design of the C{alpha} Interface Favors Specific Pairing of Introduced TCR{alpha} in Human T Cells J. Immunol., January 1, 2008; 180(1): 391 - 401. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Thomas, S.-A. Xue, M. Cesco-Gaspere, E. San Jose, D. P. Hart, V. Wong, R. Debets, B. Alarcon, E. Morris, and H. J. Stauss Targeting the Wilms Tumor Antigen 1 by TCR Gene Transfer: TCR Variants Improve Tetramer Binding but Not the Function of Gene Modified Human T Cells J. Immunol., November 1, 2007; 179(9): 5803 - 5810. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |