| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Department of Biochemistry, Graduate School of Dentistry, Osaka University, Suita, Osaka, Japan; 2 Department of Histology and Cell Biology, Matsumoto Dental University, Shiojiri, Nagano, Japan; 3 Department of Therapeutic Radiation Oncology, Kyoto University Graduate School of Medicine; and 4 Department of Anesthesia, Kyoto University Hospital, Kyoto, Japan
Requests for reprints: Toshiyuki Yoneda, Department of Biochemistry, Graduate School of Dentistry, Osaka University, 1-8 Yamadaoka, Suita, Osaka 565-0871, Japan. Phone: 81-6-6879-2887; Fax: 81-6-6879-2890; E-mail: tyoneda{at}dent.osaka-u.ac.jp.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
fused with HIV-TAT, and procaspase-3. TOP3 selectively induced apoptosis in hypoxic tumor cells in vitro and significantly reduced bone metastases in vivo. We next examined the role of HIF-1 in bone metastases by establishing MDA-MB-231 cells overexpressing constitutively active or dominant-negative HIF-1 (MDA/CA-HIF or MDA/DN-HIF, respectively). Bone metastases of MDA/CA-HIF were significantly increased with elevated number of CD31-positive blood vessels. In contrast, bone metastases were significantly reduced in MDA/DN-HIF. Because the progression of osteolytic bone metastases is due in part to the imbalance between bone formation and bone resorption, we examined the effects of hypoxia and HIF-1 on the differentiation of osteoblasts and osteoclasts. Hypoxia and CA-HIF overexpression markedly inhibited osteoblastic differentiation, whereas hypoxia increased osteoclast-like cell formation. In conclusion, these results suggest that tumor-associated hypoxia and HIF-1 expression promote the progression of bone metastases in breast cancer. Our results also suggest that hypoxia and HIF-1 lead to the development of osteolytic bone metastases by suppressing osteoblast differentiation and promoting osteoclastogenesis. [Cancer Res 2007;67(9):4157–63] |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1.3%, which is much lower than the surrounding normal tissue. Tumor hypoxia has been considered to be a potential therapeutic problem because hypoxic tumor cells are resistant to radiotherapy and chemotherapy (1–3). Furthermore, recent studies suggest that tumor hypoxia is associated with malignant biological phenotype, including enhanced invasiveness, angiogenesis, and distant metastasis (1–3).
The transcription factor hypoxia-inducible factor-1 (HIF-1), which consists of a heterodimer of HIF-1 and HIF-1ß, is a major regulator for cancer cells to adapt hypoxia (2, 5). More than 60 putative direct HIF-1 target genes, including glycolytic enzymes, glucose transporter, angiogenic factors, growth factors, enzymes, and proteins involved in tumor invasiveness and metastasis, and apoptosis resistance–related proteins, have been identified (2, 5). HIF-1 possesses a unique oxygen-dependent degradation domain (ODD) that controls protein stability (2, 5, 6). Under normoxia, HIF-1 is continuously degraded by ubiquitin-proteasome pathway, which specifically targets the ODD. On the other hand, under hypoxia, HIF-1 is stabilized, dimerizes with HIF-1ß, and initiates gene transcription. Clinicopathologic studies have shown that the expression level of HIF-1 in breast cancer increases as the pathologic stage elevates (7). Furthermore, increased levels of HIF-1 are associated with increased proliferation, metastasis, and poor prognosis in breast cancer patients (8–10).
Bone is one of the most common sites of metastases in breast cancer (11). Bone metastases are usually associated with devastating complications, including severe bone pain, pathologic bone fracture, hypercalcemia, and nerve compression syndromes, and causes increased morbidity and eventual mortality in breast cancer patients (11). In the present study, we studied whether hypoxia and HIF-1 contribute to the development of bone metastases using an animal model of human breast cancer. To examine the role of hypoxia in bone metastases, we used a fusion protein, which comprised of the protein transduction domain (PTD) embedded in the HIV-TAT protein, ODD, and procaspase-3 [TAT-PTD-ODD-Procaspase-3 (TOP3); refs. 2, 12]. It has been shown that HIV-TAT fusion protein can be delivered to all tissues, including brain, and used to deliver functional biomolecules in vivo (13). Of note, because this fusion protein contains ODD, it is degraded under the normoxic condition; however, under the hypoxic condition, the protein is stabilized and causes caspase-3–induced cell death. We previously showed that the TAT-ODD fusion protein was accumulated specifically in the hypoxic regions in tumors (12). Furthermore, TOP3 selectively killed the hypoxic cells and suppressed the tumor growth in mice (12). To examine the role of HIF-1 in bone metastases, we established MDA-MB-231 human breast cancer cells stably transfected with constitutively active or dominant-negative HIF-1 cDNA (MDA/CA-HIF or MDA/DN-HIF, respectively; refs. 14, 15). The effects of YC-1, an inhibitor of HIF-1 (16), on bone metastases of MDA-MB-231 were also studied. It is well known that the bone metastases of breast cancer are predominantly osteolytic (11); however, the mechanisms are not fully understood. To approach this, we studied the effects of hypoxia and HIF-1 on bone cells, osteoblasts, and osteoclasts, in vitro.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
antibody and rat monoclonal anti-CD31 antibody were purchased from BD Biosciences. Rabbit polyclonal anti-poly(ADP-ribose) polymerase (PARP) antibody and mouse monoclonal anti-FLAG antibody were from Stressgen Bioreagents Corp. and Sigma, respectively. YC-1 [3-(5'-hydroxymethyl-2'-furyl)1-benzylindazole; ref. 16] was from Alexis Corp. Recombinant human bone morphogenetic protein 2 (BMP2) was obtained as described previously (17). All other chemicals used in this study were purchased from Sigma or Wako Pure Chemical Industries, Ltd., unless otherwise described.
Cell Culture
The human breast cancer cell line MDA-MB-231 (American Type Culture Collection) was cultured in DMEM (Sigma) supplemented with 10% FCS (Asahi Glass Techno Corp.) and 100 µg/mL kanamycin sulfate (Meiji Seika Kaisha, Ltd.). C3H10T1/2 cells were purchased from RIKEN BioResource Center and cultured in -MEM (Sigma) supplemented with 10% FCS and 100 µg/mL kanamycin sulfate. Mouse primary osteoblasts were isolated as described previously (17). All cells were maintained in a humidified atmosphere of 5% CO2 in air. Hypoxia was achieved by incubating cells in a humidified environment at 37°C in a CO2 incubator (ASTEC Co., Ltd.) maintained at 94% N2, 5% CO2, and 1% O2.
TAT Fusion Protein
TOP3 and TAT-PTD-ODD fused to ß-galactosidase (TAT-PTD-ODD-ß-Gal) were prepared as previously described (12). For X-gal staining, TAT-ODD-ß-Gal (1 unit of ß-Gal activity/mL) was added to subconfluent MDA-MB-231 cells in 24-well plates and the cells were cultured for 24 h. X-gal staining was done as described previously (12).
Western Blot
Whole-cell lysates and nuclear extracts were prepared as described previously (17, 18). Equivalent amounts were loaded for SDS-PAGE, and immunoblotting was done (17, 18). We confirmed that equal amounts of proteins were loaded by staining the transferred membranes with Ponceau S.
Apoptosis
Subconfluent MDA-MB-231 cells in six-well plates were treated with TOP3 (15 µg/mL) for 36 h. Apoptosis in MDA-MB-231 cells were determined using a fluorescence-activated cell sorting (FACS) technique as previously described (18). The percentages of sub-G1 nuclei in the population were determined as percentage apoptosis.
Transfection
The cDNAs encoding constitutively active (14) and dominant-negative (15) forms of HIF-1 ligated into pcDNA3 (Invitrogen) and p3XFLAG-CMV10 vector (Sigma) were transfected into MDA-MB-231 cells using FuGENE 6 Transfection Reagent (Roche Diagnostics Co.) according to the manufacturer's protocol (MDA/CA-HIF and MDA/DN-HIF). As a control, empty pcDNA3 vector was similarly transfected into MDA-MB-231 cells (MDA/EV). Colonies resistant to 1 mg/mL G418 (Sigma) were isolated and cloned.
ELISA
MDA-MB-231 cells (1 x 104) were plated in 48-well plates. When near confluence, the cells were rinsed with PBS and 250 µL of serum-free DMEM was added to each well. The conditioned medium was collected after 48 h. Concentrations of vascular endothelial growth factor (VEGF) in the conditioned medium were determined by ELISA (R&D Systems, Inc.) according to the manufacturer's instruction. Data are expressed as amount of VEGF produced (pmol/L/mL) per 105 cells.
Animal Experiments
Under the anesthesia with pentobarbital (0.05 mg/g body weight; Dainippon Pharmaceutical Co., Ltd.), parental MDA-MB-231, MDA/EV, MDA/CA-HIF, or MDA/DN-HIF cells (1 x 105/0.1 mL PBS) were injected into the left cardiac ventricle of nude mice (female, 4-week-old, SLC Japan Co., Ltd.) as previously described (18). TOP3 (2 or 20 mg/kg) was i.p. injected on days 14, 18, 22, and 26. YC-1 (30 mg/kg) was i.p. injected daily for 2 weeks from day 14 (16). In all experiments, mice were sacrificed at day 28. The number of mice used in each experiment was described in each figure. All animal experiments were reviewed by the Institutional Review Board of Animal Experiments in Osaka University Graduate School of Dentistry.
X-ray Analysis of Osteolytic Lesion Area
Areas of osteolytic lesions were determined on radiographs as described previously (18). Radiographs were analyzed carefully by two different individuals who had no prior knowledge of the experimental protocol. Data are shown as osteolytic lesion area (mm2)/mouse.
Histologic and Immunohistochemical Analysis
Paraffin sections of the femora and tibiae were made as previously described (18).
Detection of hypoxia. The hypoxic regions in the bone metastases were detected using Hypoxyprobe-1 kit (Chemicon International, Inc.) according to the manufacturer's protocol. Briefly, the tumor-bearing mice were i.p. injected with pimonidazole hydrochloride (60 mg/kg) and were sacrificed 2 h later. The accumulation of pimonidazole was visualized by the immunohistochemical technique.
Immunohistochemistry. Immunohistochemical staining of HIF-1 and CD31 was done using VECTASTAIN Elite ABC kit (Vector Laboratories, Inc.) according to the manufacturer's protocol. Chromogen was developed using 3,3'-diaminobenzidine substrate kit (Vector Laboratories). The slides were counterstained with hematoxylin.
Enzyme histochemistry. Tartrate-resistant acid phosphatase (TRAP) and alkaline phosphatase activities were detected by histochemical staining technique as described previously (18, 19).
Histomorphometric Analysis
Tumor burden. Histomorphometric analysis of tumor burden in bone was done as described previously (18). Data are shown as tumor area (mm2) / animal.
Microvessel density. CD31-positive microvessels were counted in five random fields at x200 magnification. Data are shown as the number of CD31-positive microvessels/mm2 tumor area.
All of the histomorphometric analyses were done extensively and carefully by two different individuals, all of whom were without knowledge of the experimental protocol.
Adenovirus
The recombinant adenovirus carrying CA-HIF-1 was constructed using Adenovirus Expression Vector Kit (TAKARA Bio, Inc.) according to the manufacturer's protocol. As a control, the adenovirus carrying enhanced green fluorescent protein (EGFP) was used. The viruses showed no proliferative activity due to a lack of E1A-E1B (20). Titers of the viruses were determined by a modified point assay (20).
Alkaline Phosphatase Staining
C3H10T1/2 cells (1 x 104 per well/48-well plate) were cultured in the presence of 100 ng/mL BMP2 for 7 days under 20% or 1% O2. The cells were stained with a mixture of 330 µg/mL nitroblue tetrazolium, 165 µg/mL bromochoroindoylphosphate, 100 mmol/L NaCl, 5 mmol/L MgCl2, and 100 mmol/L Tris (pH 9.5).
Alizarin Red Staining
Mouse primary osteoblasts (1 x 104 per well/48-well plate) were cultured in the presence of 100 ng/mL BMP2, 5 mmol/L ß-glycerophosphate, and 100 µg/mL ascorbic acid for 14 days under 20% or 1% O2. The cells were rinsed twice with PBS, fixed in 10% buffered formalin, and stained with 1% alizarin red solution for 5 min.
Reverse Transcription PCR
Total RNA was isolated using TRI Reagent (Sigma) and single-strand cDNA was synthesized using BD PowerScript Reverse Transcriptase (BD Biosciences). The primer sets used for PCR were as follows: mouse Runx2, GCCGGGAATGATGAGAACTA/GGACCGTCCACTGTCACTTT; mouse osteocalcin, AAGCAGGAGGGCAATAAGGT/ACTTGCAGGGCAGAGAGAGA; mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH), TTGAAGGGTGGAGCCAAACG/ACACATTGGGGGTAGGAACACG. PCR products were separated on 2% agarose gels containing ethidium bromide and visualized under UV light. The size of the fragments was confirmed by reference to 100-bp DNA ladder. Quantification of amplified mRNA was done by densitometry assisted by the image analysis software Scion Image (Scion Corporation).
Osteoclast Differentiation In vitro
Spleen cells were isolated from ddY mice (male, 4-week-old, SLC Japan) and cultured in MEM supplemented with 10% FCS, 30 ng/mL recombinant human macrophage colony-stimulating factor (M-CSF; Peprotech EC, Ltd.), and 50 ng/mL recombinant human soluble receptor activator of nuclear factor-
B ligand (sRANKL; Peprotech EC) for 6 days under normoxia or hypoxia. At the end of the culture, the cells were stained with TRAP, a marker enzyme of osteoclasts using a commercially available kit (Sigma). TRAP-positive multinucleated (three or more nuclei) cells in each well were counted under light microscope. Data are shown as number of TRAP-positive multinucleated cells per well.
Statistical Analysis
Data are expressed as the mean ± SE and were analyzed by one-way ANOVA followed by Fisher's protected least-significant differences post hoc test (StatView; SAS Institute, Inc.) for determination of differences between groups. Student's t test or Welch's t test was conducted when two groups were compared. P values of <0.05 were considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1.3% O2 in the gas phase (2), the result suggests that the bone metastases in this animal model include equivalent levels of hypoxic regions to human breast cancers (4).
|
|
accumulation in MDA-MB-231 cells in vitro (data not shown). Immunohistochemical study showed that the tumor cells with nuclear HIF-1 expression colocalized or surrounded the pimonidazole-positive cells in the bone metastases of MDA-MB-231 cells in nude mice (Fig. 1C). To examine the role of HIF-1 in bone metastases in vivo, we established MDA-MB-231 cells stably transfected with CA-HIF-1 cDNA (MDA/CA-HIF). Because CA-HIF-1 lacks the ODD domain (14), it is not degraded even under normoxic condition. Two clones of MDA/CA-HIF with low and high expression levels of CA-HIF-1 were used in the following experiments (Fig. 3A
). ELISA showed that VEGF production was significantly increased in MDA/CA-HIF cells in a CA-HIF-1 expression–dependent manner (Fig. 3B). Radiological and histomorphometric analyses showed that osteolytic lesion area and tumor burden in bone were significantly increased in the high expression clone of MDA/CA-HIF (clone 2) compared with MDA/EV, whereas they were not changed in the low expression clone (clone 1; Fig. 3C and Supplementary Fig. S2). Blood vessel density determined by CD31 immunohistochemistry was significantly increased in the bone metastases of the MDA/CA-HIF (Fig. 3D).
|
(MDA/DN-HIF; Supplementary Fig. S3) to develop bone metastases in nude mice. Western blot showed that nuclear HIF-1 accumulation was reduced in MDA/DN-HIF under both normoxic and hypoxic conditions (Fig. 4A
). Histomorphometric examination showed that bone metastases were significantly reduced in MDA/DN-HIF (Fig. 4B). We also studied the effects of YC-1, which was shown to have inhibitory effects on the expression of HIF-1 and the induction of HIF-1 target genes, including VEGF (16), on bone metastases of MDA-MB-231 cells. YC-1 reduced nuclear HIF-1 expression also in MDA-MB-231 cells in a dose-dependent manner (Fig. 4C). Furthermore, YC-1 significantly decreased metastatic tumor burden of MDA-MB-231 cells in bone (Fig. 4D).
|
by adenovirus inhibited BMP2-induced osteoblast differentiation and osteocalcin mRNA expression in C3H10T1/2 cells (Fig. 5B). In contrast, hypoxia increased TRAP-positive osteoclast-like cell formation in spleen cell cultures in the presence of sRANKL and M-CSF (Fig. 6A
).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To study the role of hypoxia in bone metastases, we tested the effects of TOP3 in our animal model. When used in vivo, the HIV-TAT fusion protein has been shown to be delivered to the entire body, including brain (13). The fusion protein is able to freely diffuse through cell membranes, and therefore through layers of tumor cells. Thus, HIV-TAT fusion proteins can be delivered to tissues where blood vessels are shut down, such as in ischemic brain (21). Consistent with the previous reports (12), our results showed that TOP3 was stabilized and caused caspase-3–induced apoptosis selectively in hypoxic MDA-MB-231 cells. Furthermore, animal experiments showed that the i.p. administration of TOP3 reduced the bone metastases as well as the orthotopic tumors of MDA-MB-231 cells. These results support the notion that hypoxia makes a substantial contribution to the development of bone metastases of breast cancer.
Hypoxia causes a variety of biological responses in tumor cells. The transcription factor HIF-1 is a master mediator of the hypoxic response of tumor cells and controls the up-regulation of a number of factors vital for tumor expansion, including angiogenic factors such as VEGF. Western blot analysis showed that hypoxia induced HIF-1 accumulation in MDA-MB-231 cells and immunohistochemical study revealed the hypoxia-associated nuclear HIF-1 expression in MDA-MB-231 cells colonized in bone. The localization of the HIF-1–positive cells and the pimonidazole-incorporated cells was not identical (Fig. 1). However, according to the recent report by Sobhanifer et al. (22), HIF-1 expression is decreased in perinecrotic regions of solid tumors. In addition, pimonidazole accumulates in the cells only below 1.3% O2. These may account for the discrepancy.
The overexpression of CA-HIF-1 in MDA-MB-231 cells increased the production of one of the HIF-1 target gene product VEGF. Furthermore, CA-HIF-1 enhanced the progression of bone metastases of MDA-MB-231 cells accompanied with the increased number of CD31-positive microvessels. It is well known that angiogenesis is critical to tumor growth, survival, and metastasis (23). The previous reports showed that the inhibitors of angiogenesis reduced bone metastases in animal models (24, 25). These results collectively suggest that the promoted angiogenesis by the elevated VEGF production might play a causative role in the increased tumor burden in MDA/CA-HIF.
Breast cancer frequently causes osteolysis in bone metastases (11). Osteolysis in bone metastasis is thought to be due to the uncoupling between osteoclastic bone resorption and osteoblastic bone formation. It is widely recognized that osteolysis is caused by the production of osteoclast-activating factors such as parathyroid hormone-related protein (11). In addition, recent studies showed that the Wnt signal inhibitors, dickkopf-1 and secreted Frizzled-related protein-2, also play roles in the development of osteolytic lesions in multiple myeloma by inhibiting bone formation (26, 27). Consistent with the previous reports (28, 29), our results showed that hypoxia inhibited osteoblast differentiation of the multipotent mesenchymal cells C3H10T1/2 and mouse primary calvarial osteoblasts in vitro. In addition, we showed that the introduction of CA-HIF-1 inhibited osteoblast differentiation of C3H10T1/2 cells, suggesting that hypoxia-induced inhibition of osteoblast differentiation is, at least in part, dependent on HIF-1. We also found that acidosis, which is frequently caused by hypoxia, has a negative effect on osteoblast differentiation as well as osteoblast function (30, 31). The result suggests that hypoxia-induced acidic microenvironment contributes to the inhibition of osteoblast differentiation. In contrast to the effects on osteoblast differentiation, hypoxia stimulated osteoclast-like cell formation in mouse spleen cell culture. Arnett et al. (32) and Fukuoka et al. (33) showed similar results. Furthermore, acidosis also enhanced osteoclast differentiation in a pH-dependent manner. As the molecular mechanisms of the acidosis-increased osteoclast formation, Frick et al. (34) reported that metabolic acidosis stimulates mRNA expression of RANKL in bone cells. Komarova et al. (35) showed that acidosis directly acts on osteoclasts to activate nuclear factor of activated T cells c1, the critical transcription factor to osteoclast differentiation (36). These results collectively suggest that hypoxia and HIF-1 are involved in the formation of osteolytic bone metastases by suppressing osteoblast differentiation and stimulating osteoclast differentiation.
Bone metastasis is often classified as either osteolytic or osteoblastic. Osteoblastic metastases are frequently seen in prostate cancer patients. However, oxygen levels in prostate cancer are comparable or even lower than that in breast cancer (37, 38). Osteoblastic metastasis is believed to be caused by the cancer cell production of factors that stimulate osteoblast proliferation, differentiation, and bone formation. Several lines of experimental evidence have shown that prostate cancer cells promote osteoblastic activity by secreting osteoblast-stimulating factors, including BMPs (39, 40). These results suggest that, in the bone metastases of prostate cancer, these osteoblastic factors may play a dominant role in the formation of osteoblastic metastases even in the hypoxic condition.
In conclusion, the results suggest that tumor-associated hypoxia and HIF-1 expression promote the progression of bone metastases in breast cancer. Our results also suggest that hypoxia and HIF-1 also play a role in the induction of osteolytic change in bone metastases through causing an uncoupling between bone resorption and formation. Hypoxia and HIF-1 may be potential therapeutic targets for bone metastases in breast cancer.
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
Footnotes |
|---|
Received 6/28/06. Revised 1/11/07. Accepted 2/12/07.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
during breast carcinogenesis. J Natl Cancer Inst 2001;93:309–14. in common human cancers and their metastases. Cancer Res 1999;59:5830–5. in high-risk breast cancer: an independent prognostic parameter? Breast Cancer Res 2004;6:R191–8.[CrossRef][Medline] is associated with and unfavorable prognosis in lymph node-positive breast cancer. Clin Cancer Res 2002;8:1831–7.B ligand (RANKL) on the calcium/calcineurin/NFAT pathway in osteoclasts. Proc Natl Acad Sci U S A 2005;102:2643–8.This article has been cited by other articles:
|
|
 |
|
  D. Chanda, T. Isayeva, S. Kumar, J. A. Hensel, A. Sawant, G. Ramaswamy, G. P. Siegal, M. S. Beatty, and S. Ponnazhagan Therapeutic Potential of Adult Bone Marrow-Derived Mesenchymal Stem Cells in Prostate Cancer Bone Metastasis Clin. Cancer Res., December 1, 2009; 15(23): 7175 - 7185. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Jung, Y. Shiozawa, J. Wang, J. Wang, Z. Wang, E. A. Pedersen, C. H. Lee, C. L. Hall, P. J. Hogg, P. H. Krebsbach, et al. Expression of PGK1 by Prostate Cancer Cells Induces Bone Formation Mol. Cancer Res., October 1, 2009; 7(10): 1595 - 1604. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Bendinelli, E. Matteucci, P. Maroni, and M. A. Desiderio NF-{kappa}B Activation, Dependent on Acetylation/Deacetylation, Contributes to HIF-1 Activity and Migration of Bone Metastatic Breast Carcinoma Cells Mol. Cancer Res., August 1, 2009; 7(8): 1328 - 1341. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Thangasamy, J. Rogge, and S. Ammanamanchi Recepteur d'Origine Nantais Tyrosine Kinase Is a Direct Target of Hypoxia-inducible Factor-1{alpha}-mediated Invasion of Breast Carcinoma Cells J. Biol. Chem., May 22, 2009; 284(21): 14001 - 14010. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kizaka-Kondoh, S. Itasaka, L. Zeng, S. Tanaka, T. Zhao, Y. Takahashi, K. Shibuya, K. Hirota, G. L. Semenza, and M. Hiraoka Selective Killing of Hypoxia-Inducible Factor-1-Active Cells Improves Survival in a Mouse Model of Invasive and Metastatic Pancreatic Cancer Clin. Cancer Res., May 15, 2009; 15(10): 3433 - 3441. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Amir, R. Wang, J. W. Simons, and N. J. Mabjeesh SEPT9_v1 Up-regulates Hypoxia-inducible Factor 1 by Preventing Its RACK1-mediated Degradation J. Biol. Chem., April 24, 2009; 284(17): 11142 - 11151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. L. Semenza Does Loss of CD151 Expression Promote the Metastasis of Hypoxic Colon Cancer Cells? Clin. Cancer Res., December 15, 2008; 14(24): 7969 - 7970. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Clines and L. A. Kingsley Novel Targets for and Mechanisms of Bone Metastasis: Meeting Report from Skeletal Complications of Malignancy V: October 25-27, 2007 in Philadelphia, Pennsylvania, USA IBMS BoneKEy, August 1, 2008; 5(8): 297 - 301. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Smid, Y. Wang, Y. Zhang, A. M. Sieuwerts, J. Yu, J. G.M. Klijn, J. A. Foekens, and J. W.M. Martens Subtypes of Breast Cancer Show Preferential Site of Relapse Cancer Res., May 1, 2008; 68(9): 3108 - 3114. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Li and H. E. Schellhorn New Developments and Novel Therapeutic Perspectives for Vitamin C J. Nutr., October 1, 2007; 137(10): 2171 - 2184. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
