| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
Departments of 1 Medicine, 2 Pathology, 3 Surgery, and 4 Human Genetics, University of Chicago Cancer Research Center, University of Chicago Medical Center, Pritzker School of Medicine, Chicago, Illinois; 5 Department of Pharmacology, College of Medicine, National Cheng Kung University, Tainan, Taiwan, R.O.C.; 6 Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, Texas; and 7 Department of Surgery, Division of Thoracic Surgery, Brigham and Women's Hospital, and 8 Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts
Requests for reprints: Ravi Salgia, Department of Medicine, Division of Hematology/Oncology, University of Chicago, M255, 5841 South Maryland Avenue, Chicago, IL 60637. E-mail: rsalgia{at}medicine.bsd.uchicago.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
We have previously shown that the actin cytoskeleton is important in cell motility and migration of lung cancer cells (12). Lung cancer is characterized by a poor prognosis, early metastasis, and often refractoriness to cytotoxic chemotherapies. A number of oncogenes, including K-ras, Myc, ERBB gene family, and MET can be overexpressed or mutated in lung cancer, as well as a number of tumor suppressor genes, including RB and p53, can be altered or deleted (13). Although these oncogenes and tumor suppressor genes are unique to lung cancer, they may be necessary but not sufficient for oncogenesis, invasion, and metastasis.
Here, we show novel somatic mutations of paxillin that are unique to lung cancers compared with other tumors. Most frequently, an A127T substitution in paxillin was found and correlated with F-actin stress fiber formation, association with Bcl-2, and reduced requirement for serum-dependent cell growth. Forced expression of wild-type paxillin in paxillin null non–small cell lung cancer (NSCLC) H522 cells promoted a nodular tumor phenotype with increased cell proliferation and microvessel density. Of special interest here is that the expression of A127T paxillin promoted nodular, invasive, and proliferative tumor growth without increasing microvessel density or stroma formation. Overall, these results implicate paxillin as a central mediator of a number of biological processes in lung cancer.
| Materials and Methods |
|---|
|
|
|---|
DNA sequencing and mutational analysis. Eleven pairs of PCR primers to cover 11 exons spanning the entire coding region of paxillin were used (Supplementary Table S1) and sequenced (4). The adjacent "normal" tissues of the surgically resected tumor specimens was identified histopathologically and sequenced as well. The numbering of the nucleotide positions was relative to the first base of the translational initiation codon according to the full-length human
paxillin cDNA. All mutations were confirmed by sequencing in both directions.
Constructs of wild-type and mutant paxillin plasmids. Paxillin was subcloned into pcDNA3.1 DEST47 through Gateway cloning (Invitrogen). Briefly, primers 5'CACCATGGACGACCTCGACGCC 3' and 5'GCAGAAGAGCTTGAGGAAGCAGTTCTGAC 3' were used to PCR amplify the paxillin coding region, which was subsequently TOPO cloned into a pENTR/SD/D-TOPO entry vector using LR clonase II. The paxillin insert was transferred into the destination vector pcDNA3.1 DEST47 by a recombination reaction. The A127T (379G
A) mutation was independently introduced into paxillin in DEST47 using Quick-Change site-directed mutagenesis (Stratagene) using the primers 5'CCCCAACAAGCAGAAATCAACTGAGCCTTCACCCACCG 3', 5'CGGTGGGTGAAGGCTCAGTTGATTTCTGCTTGTTGGGG 3'. The insert alteration was confirmed by direct sequencing.
Immunoblotting and antibodies. Cell lysate preparation, SDS-PAGE, and immunoblot analysis was performed as previously described (5). Polyclonal phosphorylation site-specific paxillin antibodies were obtained from Biosource International. Paxillin monoclonal antibody was obtained from Neomarkers, Lab Vision Corp. (clone 5H11). Phosphorylated AKT (Ser473) was obtained from Cell Signaling Technology. c-Met (c-12), Bcl-2, and CD31 antibodies were obtained from Santa Cruz Biotechnology, and β-actin monoclonal antibody and all other chemicals were purchased from Sigma.
Confocal microscopy and immunohistochemistry. Cells were grown on glass coverslips, and immunofluorescence was procedure performed as previously described (15). Images were captured using a confocal microscope and saved as digital images. For immunohistochemistry, we analyzed paraffin-embedded, formalin-fixed tissue slides and tissue microarrays with institutional review board–approved protocols. Expression of paxillin was quantified manually in each core at 400x magnification by pathologists and with automated cellular imaging system (ACIS). Two independent pathologists reviewed all of the staining, and immunoscoring was confirmed.
Fluorescent in situ hybridization. Fluorescence in situ hybridization (FISH) analysis was done using three different BAC probes: RP11-144B2, localized to 12q24.23, contains the full-length paxillin gene; RP11-433C10, localized to 7p11.2, contains the full-length epidermal growth factor receptor (EGFR) gene; and RP11-163C9, localized to 7q31.2, contains the c-Met gene. Two color FISH was done for NSCLC cell lines, using RP11-144B2 (labeled in red) together with RP11-163C9 (labeled in green) and RP11-433C10 together with RP11-163C9. Probes were labeled, and FISH was done as previously described (16). At least 10 metaphase cells were analyzed for each cell line.
Quantitative real-time PCR. Quantitative real-time PCR for gene copy number measurement for DNA samples obtained from tumors of patients with NSCLC was done as described before (17) using the Stratagene Mx3000P system and the iQ SYBR green PCR kit (Bio-Rad Laboratories). Relative gene copy number was calculated from the real-time PCR efficiencies, which were determined for each individual run, and the crossing point deviations of the target and reference genes in a test sample versus a control. Long interspersed element-1 (LINE-1) served as reference gene, which is a repetitive element for which copy numbers per diploid genome are similar in healthy or malignant human cells (18). Primer sets used for PXN, MET, EGFR, and LINE-1 were listed in Supplementary Table S1. Reactions were done in triplicate under standard thermocycling conditions (one cycle of 95°C for 12 min, followed by 45 cycles of 95°C for 20 s and 58°C for 1 min), and the mean threshold cycle number was used.
Transfection and serum starvation assays. For paxillin transient transfection, H522 cells were plated the day before in six-well plates and transfected in duplicate with 2 µg total plasmid DNA and 5 µL of Lipofectamine PLUS (Invitrogen) according to manufacturer's instructions. Cells were serum starved and harvested 24 and 48 h later in lysis buffer. Paxillin levels were assessed by immunoblotting. Cell survival was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, as previously described (4). For colony survival (clonogenic) studies as described previously (4), transfected H522 cells were reseeded at 0.1 x 104 cells per well in six-well plates. After incubation for 4 weeks, the colonies were fixed and stained with methylene blue in 50% ethanol for 20 min and then rinsed with water and air-dried. Colonies were counted with a Gel Doc-XR Imager (Bio-Rad Laboratories) using the colony counting program.
Gene silencing assays. Small interfering RNA (siRNA) gene silencing studies were done using methods as previously described (15). siRNA oligonucleotides targeting paxillin mRNA were obtained from Dharmacon, Inc. and used according to the instructions of the manufacturer.
Xenograft assays in nude mice. We investigated the in vivo oncogenic properties of the mutated paxillin by studying the ability of A127T paxillin and wild-type paxillin–stably expressing H522 cells to induce tumor formation in nude mice. Cells expressing wild-type paxillin (H522-Wt paxillin) or A127T paxillin (H522-A127T paxillin) and control (H522 control vector) were injected s.c. into nude mouse flank region (5 x 106 cells per flank). Animal experiments were done according to institutional approved protocols (IACUC). The animals were monitored for tumor formation every week and sacrificed 8 to 12 weeks later. Tumor growth was measured every week over a 12-week period.
Tumor morphology, invasion, and immunohistochemistry were studied at the end of the experiment. Tumor tissues were fixed in 10% formalin and embedded in paraffin. Representative tumor sections were obtained from paraffin-embedded tumor tissue and stained with H&E, Masson's trichrome, and specific antibodies. Areas (n = 10) of immunohistochemistry staining with Ki67, Masson's trichrome, and CD31 were analyzed. Expression levels were quantified using the automated cellular imaging system (ACIS).
Statistical analyses. Data are expressed as the mean ± SE. Statistical significance was tested using statistics software 15.0. For comparison between means of two groups, Student's t test or
2 test was used. For comparing means between >2 groups, one-way ANOVA was used. For evaluation of correlations, Spearman's test was used. Unless otherwise stated, representative figures reflect the findings in a minimum of n = 3 evaluations, and mean values reflect data obtained in a minimum of n = 6 mice.
| Results |
|---|
|
|
|---|
|
|
62.5% (five of eight cell lines tested). H1993 cells had increased gene copy numbers of PXN (>4 copies) as well as clustered gene amplification of MET (>10 copies). H1838 cells had clustered gene amplification (>10 copies) of PXN and MET (Fig. 2B and C). There was association between paxillin and MET in terms of expression and copy number alterations in most of the NSCLC cell lines tested. We further quantitatively analyzed gene copy numbers of NSCLC tumor tissues from 66 patients for PXN, MET, and EGFR using quantitative real-time PCR method. Histologic cell types of these NSCLC tissues included adenocarcinoma (n = 26), large cell carcinoma (n = 24), and squamous-cell carcinoma (n = 16). Seventeen percent of large cell carcinoma exhibited increase in gene copy numbers of PXN, and those of positive samples also showed increase gene copy numbers of MET (>4 copies) and high copy numbers of EGFR (>10 copies). Eight percent of adenocarcinoma exhibited increase in gene copy numbers of PXN and those positive samples showed only high gene copy numbers of MET (>10) but not EGFR. Thirteen percent of squamous cell carcinoma exhibited increase in gene copy numbers of PXN and MET. Thirty-three percent of large cell carcinoma exhibited increase gene copy numbers of MET and EGFR (Fig. 2D).
PXN Mutations in Lung Cancer
We further examined the mutations of the PXN gene in lung cancer. The paxillin coding region (11 exons) was sequenced in cancer DNA specimens, cancer cell lines, and corresponding normal DNA. DNA samples obtained from corresponding normal tissues identified pathologically as distant normal tissues or adjacent normal tissues through laser capture microdissection (Supplementary Fig. S1) were sequenced for the paxillin gene. A total of 21 unique paxillin mutations were identified in lung cancer tissue specimens and cell lines (Fig. 3A
). The normal tissues showed a wild-type paxillin sequence, confirming that the mutations were somatic in origin.
|
The overall rate of paxillin mutations in lung cancer was 9.4% (18 of 191). The frequency of paxillin mutations was high in NSCLC, which included large cell carcinomas (18.4% or 7 of 38), adenocarcinomas (8.6% or 8 of 93), and squamous cell carcinomas (6% or 3 of 51). There were no paxillin mutations in the SCLC primary tissue samples examined (0 of 9). The A127T paxillin mutation, the most frequent mutation detected in NSCLC specimens, was also identified in H69 and H249 SCLC cell lines (2 of 36 cell lines tested). Overall, the paxillin mutation rate in the 71 lung cancer cell lines tested was 5.6% (4 of 71; Supplementary Table S2).
PXN Mutations in Malignancies Other than Lung Cancer
In contrast to lung cancer, paxillin mutations were infrequent in many other cancers, including mesothelioma (rate of 2 of 73), head and neck cancer (1 of 10), breast cancer (0 of 16), melanoma (0 of 4), cervical cancer (0 of 6), myelodysplastic syndrome (0 of 20), and chronic myelogenous leukemia (0 of 22). The overall mutational rate for these malignancies, not including lung cancer, was 2% (3 of 151; Supplementary Table S2).
Ethnic Variations and Nature of PXN Mutations
Most of the identified paxillin mutations (19 of 21) clustered in the region between LD motifs 1 and 2 (amino acid residues Pro30 to Gly139) and the region spanning the LIM domains (Supplementary Figs. S2–S5). In lung cancer tissues examined, the paxillin mutations were identified in samples from Caucasians and African-Americans, each with a unique mutational spectrum. However, there were no mutations for paxillin identified in Taiwanese samples (0 of 70). Figure 3B shows the differences between ethnic groups in paxillin mutations. The mutational spectrum of paxillin was characterized by a high proportion of GC to AT (97%) transitions (Fig. 3C). We have observed 3% of AT to GC, 97% of GC to AT transition, and 0% of AT to TA changes.
The paxillin mutations identified as shown in Supplementary Table 2 are new and unique, and none of the mutations identified have been reported previously or present in the National Center for Biotechnology Information–single-nucleotide polymorphism (SNP) database. In addition, we have identified synonymous SNPs apart from previously known synonymous SNPs and nonsynonymous SNPs, such as S73G, for paxillin and differences noticed in the various ethnic groups (Supplementary Tables S3 and S4).
A127T Paxillin Mutant Function In vitro for Lung Cancer
Increased cell growth and colony formation. To investigate the role of paxillin and its mutant form of paxillin (A127T) in lung cancer, we stably expressed wild-type and mutant enhanced green fluorescence protein (EGFP) fusion paxillin in the paxillin negative H522 cell line. Exogenous higher molecular weight (95 kDa) EGFP fusion paxillin was confirmed by immunoblotting. The viability of H522 cells expressing wild-type paxillin was comparable with that of control vector cells when subjected to starvation. H522 cells expressing A127T paxillin grew more rapidly (2-fold faster) than cells expressing wild-type paxillin or the control vector (Fig. 4A
). This was corroborated by the significantly higher number of colonies formed by H522 cells expressing A127T paxillin compared with cells expressing wild-type paxillin or control vector (Fig. 4B).
|
Redistribution of mutant PXN and association with Bcl-2. We examined paxillin localization using confocal microscopy. H522 cell line was chosen as a representative of NSCLC, with minimal to no paxillin expression. In H522 cells, localization of exogenous wild-type paxillin was diffused throughout the intracellular compartments in the cell. In contrast, A127T paxillin expression was localized toward the cell periphery and had the characteristic punctate appearance of focal adhesion points (Fig. 5A ). We further studied paxillin localization using nonimmortalized primary NHBE cells and compared with localization of A127T paxillin mutant SK-LU-1 cells. A well-defined actin cytoskeleton was observed in control NHBE cells and was found to be disrupted with reduced paxillin focal adhesion and F-actin fibers after starvation. In contrast, massive stress fiber formation with redistribution of paxillin to the ends of stress fibers occurred in SK-LU-1 cells (harboring the A127T paxillin mutant). Redistribution of paxillin and enhancement of the cortical actin ring were noticed predominantly in starved SK-LU-1 cells (Fig. 5B). Because mutant paxillin staining in the cytoplasm resembled the staining seen with mitochondria, we determined whether paxillin localized to the mitochondria and colocalized with Bcl-2 using Mitotracker red dye and antibody specific to Bcl-2, respectively. In SK-LU-1 cells, A127T mutant colocalized with Bcl-2 in the mitochondria and not in NHBE after starvation (Fig. 5C).
|
|
| Discussion |
|---|
|
|
|---|
Paxillin was initially discovered as a substrate for the nonreceptor tyrosine kinase oncogene pp 60v-Src in Rous sarcoma virus–transformed fibroblasts (22). The human paxillin gene was originally cloned via antibody expression cloning from a BCR/ABL-containing cell line (7). With its unique ability to act as an adaptor protein, paxillin has been known to bind to a number of proto-oncogenes, including BCR/ABL, v-Src, and E6 (23–25). We have identified that there can be amplification or increased copy numbers of paxillin gene in lung cancers, and it is therefore possible that the overexpressed amount of paxillin is available to bind further to oncogenes for transformation. It was also shown that a number of tumors could have combined PXN/MET gene amplification. This would be a therapeutic target approach, because MET inhibition has come to clinical fruition (26). We now have identified mutations between the LD motifs of paxillin. Because the LD motifs uniquely bind to various oncogenes, the mutations in this region of paxillin may alter the association with different proteins. The LIM domains of paxillin (especially LIM3) have been shown to be important for actin-localization (27). Mutations of the LIM domain may therefore be important in localization of paxillin, as well as signal transduction. Since the cloning of
-paxillin, a number of isoforms have been identified as β-paxillin,
-paxillin, and
-paxillin (28, 29). There are also homologous proteins with LIM domains, including Hic-5 and leupaxin (30, 31). Our studies focused only on
-paxillin, and in the future, it would be interesting to determine the role of these other proteins in the etiology and progression of lung cancer. In addition, it will be important to determine the frequency of paxillin mutations in a larger cohort, with verification from cDNA and genomic DNA sequencing, as well as analysis of germ-line DNA.
The pattern of paxillin mutations may provide insights into the development of lung cancer. The mutational spectrum of paxillin was characterized by a high proportion of GC to AT (97%) transitions. Recent mouse lung tumor studies showed that the distribution of nucleotide changes (AT to GC, GC to AT, and AT to TA) leading to a tobacco-specific carcinogen [4-(methylnitrosamino)-I-(3-pyridyl)-1-butanone (NNK)]–induced K-ras mutation (1%, 96%, and <1%, respectively) was uniquely specific compared with that of spontaneous mutations (24%, 29%, and 20%), as well as other carcinogens, such as ethyl carbamate (31%, 3%, and 64%; ref. 32). It is possible that a single carcinogen, such as NNK, could be the causative mutagen.
The mutations identified were of different frequencies in the various histologies for lung cancer. As has been shown recently, there are molecular differences between small cell cancer, large cell cancer, squamous cell cancer, and adenocarcinomas of the lung (33, 34). As an example, EGFR mutations are more common in adenocarcinomas than the other histologies of lung cancer (40% versus 3%; ref. 21). EGFR mutations and amplification in NSCLC can serve as a prognosticator as well as a predictive marker to therapeutic inhibition (35). Paxillin can also potentially serve as a molecular marker, with a large number of mutations occurring within large cell lung cancer. Currently, we are investigating if there are differences in expression, invasion, and metastases of large cell lung cancers with and without paxillin mutations. Interestingly, there is a subtype of large cell lung cancer with neuroendocrine features (36), and it is not known how paxillin is affected in these tumors. Ultimately, it would be useful to determine the role of paxillin in prognosis for NSCLC as well as predictive marker for therapeutic response.
Not only was there a difference in histology for paxillin mutations, but there was also a difference between various ethnic populations. Unlike the EGFR gene, which can frequently be mutated in Asians with lung cancer (21), paxillin was not mutated in Taiwanese lung cancer samples. That is, the frequency of paxillin mutations was higher in Caucasians and African-Americans and nonexistent in Asians. This could certainly be due to the intrinsic genetic differences, but could also be a result from environmental effects (such as the pattern or type of smoke) or a combination of both. As we have determined the relative rates of SNPs and mutations of paxillin in the Taiwanese, African-American, and Caucasian patients in our sample set, it would be important to determine the relative frequency of these SNPs/mutations in other populations. In terms of tumorigenesis, it is possible that, in the non-Asian population, there is more reliance on paxillin mutations to enhance tumorigenesis, especially because the frequency of EGFR mutations is quite low compared with the Asian population. There is also considerable evidence that EGFR mutations are mutually exclusive of K-ras mutations in lung cancer (21, 37). It is not known at this time how the paxillin mutations correlate with other mutations in lung cancer, such as p53, K-ras, EGFR, and MET. Ultimately, in lung cancer, one can envision having molecular profiling of individual tumors and thereafter therapeutic decision making.
Paxillin was shown to be essential in actin filament assembly, as well as in the focal adhesion formation, migration, association with extracellular signal-regulated kinase in DNA synthesis (38), survival, motility (39), and in morphogenesis (40). As has been shown recently, paxillin is phosphorylated in response to reactive oxygen species and c-Met activation (41).Therefore, it is reasonable to consider that paxillin plays an essential role in the increased growth and invasion in lung cancer. We have shown that forced expression of A127T paxillin mutant enhanced in vitro cell growth, oncogenic transformation (colony formation), tumor growth, and invasion in a nude mouse model.
A127T paxillin also colocalized with the antiapoptotic Bcl-2 protein. Because it is known that paxillin interacts with Bcl-2 and promotes the survival and morphogenesis of kidney cells (42, 43), the colocalization between A127T paxillin and Bcl-2 is very likely to promote lung cancer cell survival. Here, we discovered the enhanced survival of cells harboring A127T mutant paxillin specifically after serum starvation. Our confocal microscopy results further show that there was increased expression and colocalization of Bcl-2 and paxillin (A127T) in the SK-LU-1 cells. It would now be very interesting to pursue this further, and this would become a study in itself. Expression and starvation experiments further showed the ability of A127T paxillin to support the growth and cell survival of lung cancer cells, particularly in the absence of growth factor. Although we have determined the functionality of one of the frequently occurring mutations, it would be useful to test out the relative biological and biochemical significance of other somatic mutations identified for paxillin.
In vivo modeling of wild-type paxillin and A127T paxillin lead to a number of interesting results. We identified that there was increased tumor growth over time, enhanced nodularity, increased invasion into the muscle, and decrease in stroma for mutant paxillin (compared with both control and wild-type paxillin). There was some nodularity of wild-type paxillin when compared with the control vector, but less so than the mutant paxillin. This would implicate the mutant paxillin in the aggressive growth of some lung cancers and could potentially be a mechanism of early metastasis. Also, in quantification of mean-vessel density in the center of the tumor, there were fewer vessels in mutant paxillin compared with wild-type paxillin. We have observed that, because the mutant paxillin tumors grow more rapidly, there was more necrosis in the center of tumor, thus fewer vessels. However, at the edge of the tumor for the mutant paxillin, there were much more vessels compared with wild-type paxillin or control vector.
Overexpression of paxillin in xenografts correlated with angiogenesis. The wild-type paxillin lead to increased nodularity, as well as increased blood vessel formation. It is currently not known if this is an early event in the pathogenesis of lung cancer (especially occurring in metaplasia and dysplasia). Because several direct and indirect treatment strategies are under clinical investigation for treatment of solid tumors, inhibition of tumor angiogenesis through targeting paxillin could also be a promising indirect strategy. As a direct strategy, we have been able to show that small interference targeting of A127T lead to decreased cell viability. It would now be useful to determine the role of inhibition of paxillin in lung cancer and other tumors.
In conclusion, our results indicate that paxillin is a key molecule in tumor growth and metastasis. These findings are particularly interesting in light of recent evidence implicating paxillin in cancer aggressiveness (44), and it will be important to assess the relevance of these alterations in metastasis and understand the types of mutations involved in tobacco-related carcinogenesis. Further experiments will be required to establish the relative structure-function relevance of altered forms of paxillin and potential development of new targeted therapeutics for lung and other cancers showing such alterations.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| Footnotes |
|---|
Received 5/30/07. Revised 9/26/07. Accepted 10/17/07.
| References |
|---|
|
|
|---|
. J Cell Sci 2005;118:4849–63.This article has been cited by other articles:
![]() |
T. Y. Seiwert, R. Jagadeeswaran, L. Faoro, V. Janamanchi, V. Nallasura, M. El Dinali, S. Yala, R. Kanteti, E. E.W. Cohen, M. W. Lingen, et al. The MET Receptor Tyrosine Kinase Is a Potential Novel Therapeutic Target for Head and Neck Squamous Cell Carcinoma Cancer Res., April 1, 2009; 69(7): 3021 - 3031. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Salgia c-Met Receptor Tyrosine Kinase as a Therapeutic Target in Cancer ASCO Educational Book, January 1, 2008; 2008(1): 113 - 118. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |