Cancer Research AACR Membership  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 68, 3618, May 15, 2008. doi: 10.1158/0008-5472.CAN-07-6497
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Svenson, U.
Right arrow Articles by Roos, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Svenson, U.
Right arrow Articles by Roos, G.

Molecular Biology, Pathobiology, and Genetics

Breast Cancer Survival Is Associated with Telomere Length in Peripheral Blood Cells

Ulrika Svenson1, Katarina Nordfjäll1, Birgitta Stegmayr2, Jonas Manjer4, Peter Nilsson5, Björn Tavelin3, Roger Henriksson3, Per Lenner3 and Göran Roos1

1 Department of Medical Biosciences/Pathology, 2 Department of Public Health and Clinical Medicine, and 3 Department of Radiological Sciences, Oncology, Umeå University, Umeå, Sweden; and 4 Department of Surgery and 5 Department of Clinical Sciences Medicine, Malmö University Hospital, Malmö, Sweden

Requests for reprints: Göran Roos, Department of Medical Biosciences, Umeå University, S-90187, Umeå, Sweden. Phone: 469-0785-1801; Fax: 46-90-7852889; E-mail: goran.roos{at}medbio.umu.se.


    Abstract
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Telomeres are essential for maintaining chromosomal stability. Previous studies have indicated that individuals with shorter blood telomeres may be at higher risk of developing various types of cancer, such as in lung, bladder, and kidney. We have analyzed relative telomere length (RTL) of peripheral blood cells in relation to breast cancer incidence and prognosis. The study included 265 newly diagnosed breast cancer patients and 446 female controls. RTL was measured by real-time PCR, and our results show that the patient group displayed significantly longer telomeres compared with controls (P < 0.001). Age-adjusted odds ratios (OR) for breast cancer risk increased with increasing telomere length, with a maximal OR of 5.17 [95% confidence interval (95% CI), 3.09–8.64] for the quartile with the longest telomeres. Furthermore, RTL carried prognostic information for patients with advanced disease. Node positive (N+) patients with short telomeres (≤median) showed an increased survival compared with N+ patients with long telomeres (P = 0.001). For patients with ages <50 years with tumors >16 mm (median tumor diameter), short telomeres were associated with a significantly better outcome than longer telomeres (P = 0.006). Cox regression analysis showed that long RTL was a significant independent negative prognostic factor (hazards ratio, 2.92; 95% CI, 1.33–6.39; P = 0.007). Our results indicate that blood RTL may serve as a prognostic indicator in breast cancer patients with advanced disease. [Cancer Res 2008;68(10):3618–23]


    Introduction
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Telomeres are capping end structures of eukaryotic chromosomes essential for protecting chromosomal integrity. Each telomere is composed of a noncoding sequence consisting of (TTAGGG)n repeats, in complex with specific proteins (1, 2). Normally, telomeres shorten with each cell division until a critical length is reached and the cell enters cell cycle arrest (3). Permanent cell growth requires telomere maintenance, and certain human cell populations, along with most malignant cells, possess activity of telomerase for telomere elongation (4). Despite telomerase activity, the majority of tumor cells have shorter telomeres than the corresponding normal tissue and there is a relationship between short telomeres and genetic instability (5). Wu et al. previously reported an association between short telomeres in peripheral blood and increased risks for head and neck, bladder, lung, and renal cell cancers (6). In another study, telomere length was shorter in buccal cells from patients with bladder cancer compared with controls (7). These data implicate that individuals with shorter telomeres may be at higher risk of developing different forms of cancer.

Breast cancer is the most common cancer in women of the Western world, affecting ~1 in 10 women (8). In a previous study on blood cell telomere length in spontaneous breast cancers, no difference was seen compared with controls (9). Another report in sister sets has indicated an association between breast cancer risk and shorter telomeres in high-risk breast cancer families (10). In the present study, we evaluated blood telomere length as a possible biological marker for breast cancer risk and prognosis. Using real-time PCR, we measured relative telomere length (RTL) in peripheral blood cells of 265 newly diagnosed unselected breast cancer patients and 446 female controls. Interestingly, we observed longer blood telomeres in the patient group relative to controls. Furthermore, we found that blood RTL may serve as a predictor for survival in patients with advanced disease.


    Patients and Methods
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Study material. Samples were consecutively collected from breast cancer cases in Västerbotten county, Northern Sweden, referred to the Oncology Clinic, Umeå University Hospital. The majority of patients with newly diagnosed breast cancer within this area are referred to the clinic, with the exception of very old cases or subjects otherwise in bad general condition. Thus, the degree of selection in the enrollment of cases could be considered to be very small in this study. The study material originally consisted of 272 unselected breast cancer patients diagnosed between 1990 and 2006. Seven patients were excluded from the study because they, before blood sampling, had received chemotherapy or hormone therapy or, earlier, had been diagnosed with another cancer form. Hence, 265 patients, untreated except for surgical removal of their tumor, were included in the analysis. Buffy coats from all patients were collected at the Oncology Clinic within 3 mo after morphologic diagnosis.

Data regarding tumor size, nodal status, and estrogen receptor (ER) expression were collected from the clinical charts at the Oncology Clinic, Umeå University Hospital. Two techniques for ER determination were used during the sample collection period. Before the year of 2000, ER expression was analyzed using an enzyme immunoassay, and samples with values of ≥0.1 fmol/µg DNA were classified as positive. After 2000, ER status has been determined by immunohistochemistry. Four patients were classified as "uncertain," and these patients were not included in the statistical analysis regarding ER. There was no difference in the intention to treat strategy, comparing patients with long versus short telomeres. The cause of death was obtained from clinical charts and death certificates with the last follow up in May 2007.

Two population-based control collections were used, one comprising buffy coat samples (n = 300) from the MONICA (Multinational Monitoring of Trends and Determinations in Cardiovascular Disease) study in Northern Sweden (11) and one comprising granulocyte preparations (n = 146) from the Malmö Diet and Cancer Cohort (ref. 12; Southern Sweden). The aim of the MONICA study is to monitor trends in cardiovascular diseases and to relate these to risk factor changes in the population. The Malmö Diet and Cancer Cohort became associated with European Prospective Investigation into Cancer and Nutrition in 1993 and is aimed at studying whether a diet, as part of a lifestyle pattern, leads to certain forms of cancer. The age range was 29 to 75 y for controls (median, 55 y) and 29 to 86 y for cases (median, 57 y). We consider that both cases and controls were representative for the general population of Sweden. Patient and control samples were obtained after informed consent and ethical approval (LU 51-90, 05-100M, 06-149M).

Telomere length by quantitative real-time PCR. Telomere length was measured on extracted DNA in triplicates using real-time PCR as described earlier (13, 14). Telomere and β-globin primer sequences written 5' to 3' were CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT (Tel 1b), GGCTTGCCTT-ACCCTTACCCTTACCCTTACCCTTACCCT (Tel 2b), TGTGCTGGCCCATCACTTTG (HBG3), ACCAGCCACCACTTTCTGATAGG (HBG4). Telomere/single copy gene (T/S) values were calculated by 2{Delta}Ct and relative T/S values (i.e., RTL values) were generated by dividing sample T/S values with the T/S value of a reference cell line DNA (CCRF-CEM). The mean interassay coefficiency of variance for this method was 3.96% in our laboratory when a separate series of blood samples was analyzed twice and by two of the authors (U.S. and K.N.).

Statistical analysis. SPSS version 15.0 was used for statistical analysis. Before performing the statistical calculations, RTL values were checked for normality. Because the RTL distribution was slightly skewed, the values were converted into their corresponding natural logarithm, thereby achieving a satisfactory normal distribution. Correlation between telomere length and age was examined using Pearson's correlation coefficient. Analysis of covariance (ANCOVA) with age adjustment was performed to compare mean RTL between cases and controls and between ER+ and ER– patients. Odds ratios (OR) for breast cancer risk were calculated by binary logistic regression, with patients and controls as a binary dependent variable, representing disease or no disease. To investigate telomere length as an explanatory variable, the whole material was subdivided into quartiles based on the RTL distribution among the controls, creating the variable "RTL quartiles." Age and RTL quartiles were then set as covariates in the logistic regression model. The prognostic significance of blood telomere length in breast cancer patients was investigated using Kaplan-Meier with the log-rank test. Survival was defined as the time (in months) between the date of diagnosis to breast cancer–related death or to the date of last follow-up (May 2007). Survival data were available for 258 of the 265 patients. Of these, only patients diagnosed before 2001 (n = 227) were included in the survival analysis to achieve adequate follow-up times. Hazard ratios (HR) were obtained by multivariate Cox regression analysis, including age, blood RTL, tumor size, and nodal status. Statistical significance refers to P ≤ 0.05 (two tailed).


    Results
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Blood cell telomeres are longer in breast cancer patients and associated with breast cancer risk. RTL was determined in 265 patients and 446 female controls. The two control cohorts did not differ regarding RTL (age-adjusted P = 0.219; not shown in figures). We observed an inverse correlation between telomere length and age in controls (r = –0.241, P < 0.001), as well as in patients (r = –0.307, P < 0.001; Fig. 1A ), demonstrating a significant age-related telomere loss in both groups. The patient group displayed longer blood telomeres compared with the controls [age-adjusted mean RTL with 95% confidence interval (95% CI) = 0.74 (0.71–0.77) and 0.65 (0.63–0.67), respectively; P < 0.001; not shown in figure]. Telomeres were found to be significantly longer for patients in all age groups (<45 years, P = 0.018; 45–54 years, P = 0.001; 55–64 years, P < 0.001; >64 years, P < 0.001; Fig. 1B). To examine whether blood RTL was associated with breast cancer risk, age-adjusted ORs were calculated after subdividing the whole material (n = 711) into quartiles based on the RTL distribution among controls. Breast cancer risk increased with increasing RTL (Ptrend < 0.001) with a maximal OR of 5.17 (95% CI, 3.09–8.64) for the quartile with the longest telomeres (Fig. 1C).


Figure 1
View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Telomere length comparisons (patients versus controls) and OR estimations. A, correlation between telomere length and age examined using Pearson's correlation coefficient. B, RTL in patients and controls categorized into four age groups. ANCOVA with age adjustment was performed to compare mean RTL between the groups. Age-adjusted mean RTL with 95% CI for controls and cases: <45 y, 0.71 (0.68–0.74) and 0.80 (0.73–0.88); 45 to 54 y, 0.65 (0.61–0.70) and 0.75 (0.71–0.80); 55 to 64 y, 0.64 (0.61–0.67) and 0.72 (0.68–0.76); >64 y, 0.56 (0.52–0.61) and 0.69 (0.64–0.75). The box plots show the minimum, lower quartile, median, upper quartile, and maximum value. Outliers (values between 1.5 and 3 box lengths from the edge of the box) are represented as circles. C, age-adjusted ORs for breast cancer risk after subdividing the whole material (n = 711) into quartiles according to telomere length among control subjects. ORs were calculated by logistic regression analysis, using patients and controls as a binary-dependent variable. OR for the quartiles (95% CI): 1st quartile (shortest telomeres), 1; 2nd quartile, 3.30 (1.96–5.56); 3rd quartile, 3.21 (1.91–5.38); 4th quartile, 5.17 (3.09–8.64).

 
Blood RTL predicts survival in patients with advanced disease. We also examined blood RTL as a potential predictive factor for cancer-specific death. Before performing survival analysis, the patients were dichotomized into two groups based on the median RTL value (0.73). Interestingly, blood RTL carried significant prognostic information (P = 0.006 for all patients; Fig. 2A–C ). Patients of ages <50 years (approximate menopausal age) with short telomeres (≤median value) had a significantly better outcome than patients with long telomeres (P = 0.024; Fig. 2B), and for patients of ages ≥50 years, a borderline value was achieved (P = 0.095; Fig. 2C).


Figure 2
View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Survival analysis for patients with long (RTL, >0.73) versus short (RTL, ≤0.73) blood telomeres using Kaplan-Meier with the log-rank test. The analysis included patients diagnosed from 1990 through 2000 (n = 227; seven cases missing due to no survival data). Patients diagnosed after 2000 were not included in the survival analysis (n = 31). A, all ages. B, patients of ages <50 y. C, patients of ages ≥50 y.

 
We next addressed whether blood RTL was of prognostic value for any patient subgroup. First, tumor size and nodal status were evaluated, two established prognostic indicators showing expected outcomes in our patient cohort (Table 1 ). For patients with tumors larger than 16 mm (median tumor diameter), a significant association was found between blood RTL and survival (P = 0.006; Fig. 3A ). This connection proved to be significant for patients of ages <50 years, for whom short telomeres were strongly related to an increased survival time (P = 0.006; Fig. 3B). The association could not be shown for patients of ages ≥50 years (P = 0.226; Fig. 3C) or for patients with a tumor size of ≤16 mm (P = 0.529; all ages; not shown in figure). Also for node-positive (N+) patients of all ages, of <50 years, and of ≥50 years, short RTL indicated a better prognosis (P = 0.001, 0.039, and 0.008, respectively; Fig. 4A–C ). Survival was not coupled to blood RTL in node-negative (N0) patients (P = 0.444; all ages; not shown in figure). However, the statistics for the ≤16 mm and N0 tumor groups should be taken with caution due to few events in these patient groups.


View this table:
[in this window]
[in a new window]

 
Table 1. Survival analysis in relation to tumor size and nodal status

 

Figure 3
View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Survival analysis (long versus short blood telomeres) restricted to patients with large tumors (tumor Ø, >16 mm; n = 95). A, all ages. B, patients of ages <50 y. C, patients of ages ≥50 y.

 

Figure 4
View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Survival analysis (long versus short blood telomeres) restricted to node-positive patients (n = 66). A, all ages. B, patients of ages <50 y. C, patients of ages ≥50 y.

 
To verify blood RTL as an independent prognostic indicator, multivariate Cox regression analysis was performed, including age, nodal status, tumor size, and blood RTL. The results revealed that long blood RTL (RTL, >0.73) was a significant independent negative factor for survival (HR, 2.92; 95% CI, 1.33–6.39; P = 0.007; Table 2 ). There were too few events to perform a Cox analysis restricted to patients of ages <50 or ≥50 years.


View this table:
[in this window]
[in a new window]

 
Table 2. Multivariate Cox regression survival analysis

 
Finally, blood RTL was evaluated in relation to ER status and survival. Data on ER expression were available for 200 of 265 patients, and the majority (78%) were ER+. After adjusting for age, no statistically significant difference in RTL was observed between ER+ and ER– patients (P = 0.191; not shown in figure), although mean RTL was slightly higher for ER+ (0.73; 95% CI, 0.70–0.75) compared with ER– patients (0.69; 95% CI, 0.65–0.74). There was no difference in survival for patients classified as ER+ versus ER– (P = 0.909; not shown in figure), but again short RTL was associated with a better prognosis in both ER+ and ER– patients (P = 0.005 and P = 0.025, respectively, all ages; not shown in figures). ER+ cases had significantly longer telomeres than controls (P < 0.001), whereas a nearly significant P value was achieved for the ER– cases (P = 0.055).


    Discussion
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
In the present study, we report novel findings showing that newly diagnosed breast cancer patients had longer blood telomeres compared with controls. Notably, blood RTL was found to represent a strong independent prognostic indicator in patients with advanced disease (>16 mm tumor diameter and/or N+).

The observation that telomeres shorten with age is consistent with previous studies (1518). Regarding blood telomere length in cancer patients, the findings in the present study were unexpected and in contrast with previous reports on head and neck, bladder, lung, and renal cell cancers (6). Concerning breast cancer, a report on sisters in high-risk breast cancer families showed a weak, nonsignificant association between breast cancer risk and shorter telomeres (10). Our study involved newly diagnosed, spontaneous tumors encompassing a wide age span and unrelated controls, which makes comparison between the studies difficult. No difference in blood telomere length between breast cancer patients, treated or untreated, and controls was shown in a study using Southern blotting for telomere length estimation (9). We and others have shown a good correlation comparing Southern blot data with PCR-based results (13, 19), but methodologic differences cannot be excluded as one reason for the discrepancies. In contrast to the PCR technique, which can amplify very short TTAGGG tracts, it is difficult to assess the sensitivity of Southern blotting at lower kilobase ranges. Recently, the existence of extremely short telomeres in human cancer cells, "t-stumps," was shown indicating that telomeres can vary considerably more in size than previously anticipated (20). The presence of such short telomeres can in theory differ between patients and controls, and if so, the methodology for telomere length estimation is likely of significance. Irrespective of the reasons for the conflicting data regarding blood RTL status in breast cancer patients, future confirmatory investigations are warranted.

In general, malignant tumors show shorter telomeres than corresponding normal tissues and telomere dysfunction has been indicated as a negative prognostic marker in solid tumors, including breast cancer (21, 22). Also, in situ telomere length assessments showed that telomere attrition occur early during breast carcinogenesis (23). In contrast, we surprisingly found longer blood telomeres in breast cancer patients compared with controls. More importantly, in our breast cancer cohort, longer telomeres were an independent negative prognostic marker. What are the potential explanations for these discrepancies with regard to most previous publications?

Telomere length maintenance is a complex process governed by a multitude of telomere elongating and shortening factors, many of which are differentially expressed in diverse cell types. It is not inconceivable that normal and malignant cells behave differently in this respect, as exemplified in the present study anticipating that the tumors of our patients exhibited shortened telomeres in line with other studies. It should be remembered that breast cancer is thought to develop in cells with shortened telomeres that thereafter are maintained through the action of telomerase. Normal hematopoietic cells differ from, e.g., epithelial cells in that they are telomerase competent upon mitogenic stimulation, a difference likely to be of biological importance in the present study.

It is well established that epigenetic alterations can modulate telomere length (24). CTCF (CCCTC-binding factor), a known chromatin insulator protein, is a negative regulator of human telomerase reverse transcriptase (hTERT) gene expression (25), whereas brother of the regulator of imprinted sites (BORIS), a protein activated in various cancers, can inhibit CTCF binding (26). BORIS may thus act as a positive regulator of hTERT transcription, and interestingly, high levels of BORIS have been detected in blood leukocytes from breast cancer patients compared with controls (27). Another observation is that the levels of a number of potentially telomerase activating cytokines, like interleukin 2 (IL-2), IL-4, IL-6, IL-7, IL-10, and IL13 (2832), were found at higher serum levels in breast cancer patients compared with controls (33).

In contrast to malignancies previously associated with shortened blood telomeres (6), breast cancer is generally classified as a hormone-related cancer. Prolonged estrogen exposure is a well-established risk factor for breast cancer (34). Estrogen can also influence telomere dynamics (35). A number of studies have reported that women have longer telomeres than men, and estrogen exposure has been suggested as the most likely reason for this gender difference (15, 16, 36, 37). In support of this hypothesis, postmenopausal women with a history of long-term hormone replacement therapy had longer blood telomeres than postmenopausal women without hormone replacement therapy (38). Influences on telomere length by estrogen can occur by activation of the hTERT gene promoter, which contains an estrogen-responsive element (39), and by posttranscriptional regulation of hTERT via Akt-dependent phosphorylation (40). Moreover, estrogen has antioxidative capacity (35), and because oxidative stress is known to increase telomere attrition (41), this property might be of relevance in telomere maintenance. Our findings may hence reflect a combined effect of epigenetic regulation, cytokine, and hormonal effects.

In conclusion, we here show that telomere length in peripheral blood cells differ between breast cancer patients and control subjects and may serve as a significant prognostic biological marker.


    Disclosure of Potential Conflicts of Interest
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
No potential conflicts of interest were disclosed.


    Acknowledgments
 
Grant support: Swedish Cancer Society (G. Roos), Swedish Research Council (G. Roos), Lion's Cancer Research Foundation at Umeå University (G. Roos, P. Lenner, and R. Henriksson), Kempe Foundation (G. Roos), Heart and Chest Fund (J. Manjer and P. Nilsson), Swedish Public Health Institute (J. Manjer and P. Nilsson), and European Union grant LSHC-CT-2004-502943 Mol Cancer Med (G. Roos).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    Footnotes
 
Note: U. Svenson and K. Nordfjäll contributed equally to this work.

Received 12/ 4/07. Revised 2/28/08. Accepted 3/17/08.


    References
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Blasco MA. Telomerase beyond telomeres. Nat Rev Cancer 2002;2:627–33.[CrossRef][Medline]
  2. Moyzis RK, Buckingham JM, Cram LS, et al. A highly conserved repetitive DNA sequence, (TTAGGG), present at the telomere of human chromosomes. Proc Natl Acad Sci U S A 1988;85:6622–6.[Abstract/Free Full Text]
  3. Mathon NF, Lloyd AC. Cell senescence and cancer. Nat Rev Cancer 2001;1:203–13.[CrossRef][Medline]
  4. Cong YS, Wright WE, Shay JW. Human telomerase and its regulation. Microbiol Mol Biol Rev 2002;66:407–25.[Abstract/Free Full Text]
  5. Hacket JA, Greider CW. Balancing instability: dual roles for telomerase and telomere dysfunction in tumorigenesis. Oncogene 2002;21:619–26.[CrossRef][Medline]
  6. Wu X, Amos CI, Zhu Y, et al. Telomere dysfunction: a potential cancer predisposition factor. J Natl Cancer Inst 2003;95:1211–8.[Abstract/Free Full Text]
  7. Broberg K, Björk J, Paulsson K, Höglund M, Albin M. Constitutional short telomeres are strong genetic susceptibility markers for bladder cancer. Carcinogenesis 2005;26:1263–71.[Abstract/Free Full Text]
  8. Sasco AJ. Breast cancer and the environment. Horm Res 2003;60 Suppl 3:50.[CrossRef][Medline]
  9. Barwell J, Pangon L, Georgiou A, et al. Is telomere length in peripheral blood lymphocytes correlated with cancer susceptibility or radiosensitivity? Br J Cancer 2007;97:1696–700.[CrossRef][Medline]
  10. Shen J, Terry MB, Gurvich I, Liao Y, Senie RT, Santella RM. Short telomere length and breast cancer risk: a study in sister sets. Cancer Res 2007;67:5538–44.[Abstract/Free Full Text]
  11. Stegmayr B, Lundberg V, Asplund K. The events registration and survey procedures in the Northern Sweden MONICA Project. Scand J Public Health Suppl 2003;61:9–17.[Medline]
  12. Berglund G, Elmstähl S, Janzon L, Larsson SA. The Malmo Diet and Cancer Study. Design and feasibility. J Intern Med 1993;233:45–51.[Medline]
  13. Cawthon RM. Telomere measurement by quantitative PCR. Nucleic Acids Res 2002;30:e47.[Abstract/Free Full Text]
  14. Nordfjäll K, Osterman P, Melander O, Nilsson P, Roos G. hTERT (-1327)T/C polymorphism is not associated with age-related telomere attrition in peripheral blood. Biochem Biophys Res Commun 2002;358:215–18.[CrossRef]
  15. Benetos A, Okuda K, Lajemi M, et al. Telomere length as an indicator of biological aging: the gender effect and relation with pulse pressure and pulse wave velocity. Hypertension 2001;37:381–5.[Abstract/Free Full Text]
  16. Unryn BM, Cook LS, Riabowol KT. Paternal age is positively linked to telomere length of children. Aging Cell 2005;4:97–101.[CrossRef][Medline]
  17. Iwama H, Ohyashiki K, Ohyashiki JH, et al. Telomeric length and telomerase activity vary with age in peripheral blood cells obtained from normal individuals. Hum Genet 1988;102:397–402.
  18. Nordfjäll K, Larefalk A, Lindgren P, Holmberg D, Roos G. Telomere length and heredity: indications of paternal inheritance. Proc Natl Acad Sci U S A 2005;102:16374–8.[Abstract/Free Full Text]
  19. Grabowski P, Hultdin M, Karlsson K, et al. Telomere length as a prognostic parameter in chronic lymphocytic leukemia with special reference to VH gene mutation status. Blood 2005;105:4807–12.[Abstract/Free Full Text]
  20. Xu L, Blackburn EH. Human cancer cells harbor T-stumps, a distinct class of extremely short telomeres. Mol Cell 2007;28:315–27.[CrossRef][Medline]
  21. Bisoffi M, Heaphy CM, Griffith JK. Telomeres: prognostic markers for solid tumors. Int J Cancer 2006;119:2255–60.[CrossRef][Medline]
  22. Heaphy CM, Baumgartner KB, Bisoffi M, Baumgartner RN, Griffith JK. Telomere DNA content predicts breast cancer-free survival interval. Clin Cancer Res 2007;13:7037–43.[Abstract/Free Full Text]
  23. Meeker AK, Argani P. Telomere shortening occurs early during breast tumorigenesis: a cause of chromosome destabilization underlying malignant transformation? J Mammary Gland Biol Neoplasia 2004;9:285–96.[CrossRef][Medline]
  24. Blasco MA. The epigenetic regulation of mammalian telomeres. Nat Rev Genet 2007;8:299–309.[CrossRef][Medline]
  25. Renaud S, Loukinov D, Bosman FT, Lobanenkov V, Benhattar J. CTCF binds the proximal exonic region of hTERT and inhibits its transcription. Nucleic Acids Res 2005;33:6850–60.[Abstract/Free Full Text]
  26. Klenova EM, Morse HC III, Ohlsson R, Lobanenkov VV. The novel BORIS + CTCF gene family is uniquely involved in the epigenetics of normal biology and cancer. Semin Cancer Biol 2002;12:399–414.[CrossRef][Medline]
  27. D'Arcy V, Abdullaev ZK, Pore N, et al. The potential of BORIS detected in the leukocytes of breast cancer patients as an early marker of tumorigenesis. Clin Cancer Res 2006;12:5978–86.[Abstract/Free Full Text]
  28. Akiyama M, Hideshima T, Hayashi T, et al. Cytokines modulate telomerase activity in a human multiple myeloma cell line. Cancer Res 2002;62:3876–82.[Abstract/Free Full Text]
  29. Hu BT, Insel RA. Up-regulation of telomerase in human B lymphocytes occurs independently of cellular proliferation and with expression of the telomerase catalytic subunit. Eur J Immunol 1999;29:3745–53.[CrossRef][Medline]
  30. Igarashi H, Sakaguchi N. Telomerase activity is induced in human peripheral B lymphocytes by the stimulation to antigen receptor. Blood 1997;89:1299–307.[Abstract/Free Full Text]
  31. Kawauchi K, Ihjima K, Yamada O. IL-2 increases human telomerase reverse transcriptase activity transcriptionally and posttranslationally through phosphatidylinositol 3'-kinase/Akt, heat shock protein 90, and mammalian target of rapamycin in transformed NK cells. J Immunol 2005;174:5261–9.[Abstract/Free Full Text]
  32. Wallace DL, Bérard M, Soares MV, et al. Prolonged exposure of naïve CD8+ T cells to interleukin-7 or interleukin-15 stimulates proliferation without differentiation or loss of telomere length. Immunology 2006;119:243–53.[CrossRef][Medline]
  33. Lyon DE, McCain NL, Walter J, Schubert C. Cytokine comparisons between women with breast cancer and women with a negative breast biopsy. Nurs Res 2008;57:51–8.[Medline]
  34. Clemons M, Goss P. Estrogen and the risk of breast cancer. N Engl J Med 2001;344:276–85.[Free Full Text]
  35. Aviv A. Telomeres, sex, reactive oxygen species, and human cardiovascular aging. J Mol Med 2002;80:689–95.[CrossRef][Medline]
  36. Jeanclos E, Schork NJ, Kyvik KO, Kimura M, Skurnick JH, Aviv A. Telomere length inversely correlates with pulse pressure and is highly familiar. Hypertension 2000;36:195–200.[Abstract/Free Full Text]
  37. Mayer S, Brüderlein S, Perner S, et al. Sex-specific telomere length profiles and age-dependent erosion dynamics of individual chromosome arms in humans. Cytogenet Genome Res 2006;112:194–201.[CrossRef][Medline]
  38. Lee DC, Im JA, Kim JH, Lee HR, Shim JY. Effect of long-term hormone therapy on telomere length in postmenopausal women. Yonsei Med J 2005;46:471–9.[Medline]
  39. Kyo S, Takakura M, Kanaya T, et al. Estrogen activates telomerase. Cancer Res 1999;59:5917–21.[Abstract/Free Full Text]
  40. Kimura A, Ohmichi M, Kawagoe J, et al. Induction of hTERT expression and phosphorylation by estrogen via Akt cascade in human ovarian cancer cell lines. Oncogene 2005;23:4505–15.[CrossRef]
  41. Saretzki G, Von Zglinicki T. Replicative ageing, telomeres, and oxidative stress. Ann NY Acad Sci 2002;959:24–9.[Medline]



This article has been cited by other articles:


Home page
J. Nutr.Home page
L. Paul, M. Cattaneo, A. D'Angelo, F. Sampietro, I. Fermo, C. Razzari, G. Fontana, N. Eugene, P. F. Jacques, and J. Selhub
Telomere Length in Peripheral Blood Mononuclear Cells Is Associated with Folate Status in Men
J. Nutr., July 1, 2009; 139(7): 1273 - 1278.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
I. De Vivo, J. Prescott, J. Y.Y. Wong, P. Kraft, S. E. Hankinson, and D. J. Hunter
A Prospective Study of Relative Telomere Length and Postmenopausal Breast Cancer Risk
Cancer Epidemiol. Biomarkers Prev., April 1, 2009; 18(4): 1152 - 1156.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
U. Svenson, B. Ljungberg, and G. Roos
Telomere Length in Peripheral Blood Predicts Survival in Clear Cell Renal Cell Carcinoma
Cancer Res., April 1, 2009; 69(7): 2896 - 2901.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
S. Kim, C. G. Parks, L. A. DeRoo, H. Chen, J. A. Taylor, R. M. Cawthon, and D. P. Sandler
Obesity and Weight Gain in Adulthood and Telomere Length
Cancer Epidemiol. Biomarkers Prev., March 1, 2009; 18(3): 816 - 820.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Svenson, U.
Right arrow Articles by Roos, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Svenson, U.
Right arrow Articles by Roos, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online