Cancer Research AACR Membership  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 68, 3733, May 15, 2008. doi: 10.1158/0008-5472.CAN-07-2509
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Si, J.
Right arrow Articles by Collins, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Si, J.
Right arrow Articles by Collins, S. J.

Cell, Tumor, and Stem Cell Biology

Activated Ca2+/Calmodulin-Dependent Protein Kinase II{gamma} Is a Critical Regulator of Myeloid Leukemia Cell Proliferation

Jutong Si and Steven J. Collins

Human Biology Division, Fred Hutchinson Cancer Research Center, Seattle, Washington

Requests for reprints: Steven J. Collins, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue North, Seattle, WA 98109. Phone: 206-667-4389; Fax: 206-667-6523; E-mail: scollins{at}fhcrc.org.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ca2+ signaling is an important component of signal transduction pathways regulating B and T lymphocyte proliferation, but the functional role of Ca2+ signaling in regulating myeloid leukemia cell proliferation has been largely unexplored. We observe that the activated (autophosphorylated) Ca2+/calmodulin-dependent protein kinase II{gamma} (CaMKII{gamma}) is invariably present in myeloid leukemia cell lines as well as in the majority of primary acute myelogenous leukemia patient samples. In contrast, myeloid leukemia cells induced to terminally differentiate or undergo growth arrest display a marked reduction in this CaMKII{gamma} autophosphorylation. In cells harboring the bcr-abl oncogene, the activation (autophosphorylation) of CaMKII{gamma} is regulated by this oncogene. Moreover, inhibition of CaMKII{gamma} activity with pharmacologic agents, dominant-negative constructs, or short hairpin RNAs inhibits the proliferation of myeloid leukemia cells, and this is associated with the inactivation/down-regulation of multiple critical signal transduction networks involving the mitogen-activated protein kinase, Janus-activated kinase/signal transducers and activators of transcription (Jak/Stat), and glycogen synthase kinase (GSK3β)/β-catenin pathways. In myeloid leukemia cells, CaMKII{gamma} directly phosphorylates Stat3 and enhances its transcriptional activity. Thus, CaMKII{gamma} is a critical regulator of multiple signaling networks regulating the proliferation of myeloid leukemia cells. Inhibiting CaMKII{gamma} may represent a novel approach in the targeted therapy of myeloid leukemia. [Cancer Res 2008;68(10):3733–42]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The myeloid leukemias, including acute myelogenous leukemia (AML) and chronic myelogenous leukemia (CML), are neoplastic disorders characterized by the aberrant proliferation and differentiation of myeloid precursor cells. AML is a remarkably heterogenous disease and is associated with multiple different types of genetic mutations. These mutations are generally of two functional types, including those which (1) interfere with the differentiation of myeloid precursors and (2) dysregulate the proliferation and viability of these myeloid precursors (1). For example, AML-specific chromosome translocations and mutations involving the retinoic acid receptor {alpha} (RAR{alpha}; ref. 2), AML-1 (3), and C/EBP{alpha} (4) genes interfere with the differentiation of myeloid precursors, whereas mutations involving tyrosine kinase receptors such as c-kit (5) and flt-3 (6) dysregulate their proliferation and viability. Other specific signal transduction pathways that are aberrantly activated in AML include those involving Ras/Raf/mitogen-activated protein kinase (MAPK; ref. 7), Stat 3 (8), SRC-related kinases (9), and phosphatidylinositol 3-kinase (PI3K)/Akt (10). Similarly, in CML, the oncogenic bcr-abl tyrosine kinase that is generated by the Philadelphia chromosome is associated with the activation of multiple downstream signal transduction pathways, including Stat5 (11), MAPK (12), PI3K (13), and SRC family kinases (14).

The Ca2+/calmodulin-dependent protein kinases (CaMK) are ubiquitously expressed multifunctional serine/threonine protein kinases that function through Ca2+ signaling to regulate the development and activity of many different cell types (15). CaMKs include CaMKI, CaMKII, and CaMKIV, each of which has multiple isoforms. A critical feature shared by members of the CaMK family involves the regulation of their enzymatic activity by changes in intracellular Ca2+ concentration. Ca2+ binding to the ubiquitously expressed calmodulin triggers a conformational change that enhances its binding to the different CaMKs. This binding of Ca2+/calmodulin in turn triggers a conformational change in the CaMKs leading to activation of these enzymes.

The most widely studied of these Ca2+-regulated enzymes is CaMKII, which consists of four homologous but distinct genes (CaMKII{alpha}, CaMKIIβ, CaMKII{gamma}, and CaMKII{delta}). One of the critical functional characteristics of CaMKII is its distinct holoenzyme structure consisting of 12 identical subunits (16). Activation of individual subunits of this dodecameric holoenzyme by Ca2+/calmodulin leads to the phosphorylation of adjacent enzyme subunits at Thr286 (for the {alpha} isoform) or at Thr287 (for the β, {gamma}, and {delta} isoforms; ref. 17). This CaMKII autophosphorylation leads to increased enzymatic activity and markedly diminishes the requirement for Ca2+/calmodulin binding to maintain enzymatic activity (18). Thus, the autophosphorylated CaMKII is autonomous and relatively independent of Ca2+ concentration and Ca2+/calmodulin regulation.

CaMKII comprises approximately 1% to 2% of total brain protein, and previous studies have identified an important role of this enzyme in regulating neuronal cell development and activity (19). Other studies using pharmacologic inhibitors of the CaMKs have indicated a role for CaMKII in regulating the cell cycle progression of cultured NIH3T3 fibroblasts (20, 21). In contrast, studies determining the role of CaMKII in regulating hematopoiesis have been relatively limited. In T lymphocytes, CaMKII is involved in regulating cytokine expression (22) and T-cell receptor–triggered cell proliferation (23) as well as the generation of memory T cells (24). In previous studies, we have observed that CaMKII{gamma} is the CaMKII isoform that is preferentially expressed in myeloid cells, and this enzyme inhibits the retinoic acid–induced differentiation of myeloid leukemia cell lines by phosphorylating and inhibiting the transcriptional activity of the RAR{alpha} (25). In these previous efforts, we observed that CaMKII inhibitors enhance the differentiation of certain myeloid leukemia cell lines, but this effect was only noted in leukemias that were responsive to retinoic acid (25). In the present study, we extend these studies beyond the retinoic acid–responsive myeloid leukemias and describe a critical and central role of CaMKII{gamma} in regulating the proliferation of a wide variety of myeloid leukemia cells. We observe that autophosphorylated CaMKII{gamma} is commonly present in myeloid leukemias. Inhibitors of CaMKII{gamma}, including pharmacologic agents and dominant-negative constructs, inhibit myeloid leukemia cell proliferation, and this is associated with the inactivation of multiple signal transduction pathways, including p44/42 MAPK, Stat3/Stat5, and glycogen synthase kinase 3β (GSK3β)/β-catenin. Moreover, we observe that Stat3 is directly phosphorylated by CaMKII at Ser727. These observations highlight the importance of CaMKII in regulating the proliferation of myeloid leukemia cells and suggest that inhibiting CaMKII{gamma} activity may be of significant value in the targeted therapy of myeloid leukemia.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines. All leukemia cell lines are cultured at 37°C in RPMI 1640 supplemented with 5% heat-inactivated FCS.

Antibodies and Western blots. Protein extracts, immunoprecipitations, and Western blots were performed as previously detailed (26). Antibodies against CaMKI, CaMKII{gamma}, CaMKIV, c-myc, Stat3, Stat5, and calmodulin as well as the phosphospecific CaMKII (Thr286 and Thr287) and phosphospecific CaMKI (Thr177) antibodies were from Santa Cruz Biotechnology. Antibodies against phosphorylated Stat1 (Ser727), phosphorylated Stat3 (Ser727 and Tyr705), phosphorylated Stat5 (Tyr694), phosphorylated p44/42 MAPK (Thr202/Tyr204), p44/42 MAPK, phosphorylated p38 MAPK (Thr180/Tyr182), and phosphorylated GSK3β (Ser9) were from Cell Signaling Technology. Antibodies against Stat1, GSK3β, β-catenin, protein phosphatase 2A catalytic subunit (PP2Ac), and cyclin D1 were from BD Biosciences.

Chemicals. Different inhibitors of specific signal transduction pathways, including AG490, JAK 3 inhibitor II, PP1, PD98059, UO 126, SB 203580, wortmannin, LY 294002, c-Jun NH2-terminal kinase (JNK) inhibitor II, Raf kinase inhibitor I, pho kinase inhibitor, RO-31-8220, GÖ 6983, cucurbitacin I, AMP kinase inhibitor compound C, KN62, KN93, and STO609 were all from Calbiochem. All-trans retinoic acid (ATRA), 12-O-tetradecanoylphorbol-13-acetate (TPA), arsenic trioxide, and SB216367 were from Sigma.

Patient AML and normal CD34+ samples. Patient AML samples were obtained from the Children's Oncology Group bank of AML cells. Ficoll gradient centrifugation was used to isolate mononuclear cells from bone marrow aspirates from newly diagnosed patients with AML. These cells consisted of >80% blasts by morphology and were stored frozen under liquid nitrogen. Normal CD34+ cells were immunopurified from granulocyte colony-stimulating factor–mobilized, leukophoresed peripheral blood stem cell donors. Appropriate Institutional Review Board approval was obtained for using these patient and normal donor samples, which are anonymized such that individuals cannot be identified.

Glutathione S-transferase fusion proteins. The coding region of the human Stat3{alpha} gene was amplified by reverse transcription-PCR (RT-PCR) and subcloned into the glutathione S-transferase (GST) fusion protein expression vector pGEX5x.1. The GST-Stat3 fusion protein was purified from bacteria extracts using glutathione 4B-Sepharose (Amersham Biosciences).

Expression vectors. A cDNA harboring the coding sequence of amino acids 1 to 290 of CaMKII{gamma} was cloned into the LXSN retroviral expression vector (M28248). Using site-directed mutagenesis, we mutated Lys43 of this construct to methionine to generate a kinase-deficient CaMKII mutant labeled kdCaMKII.

CaMKII{gamma} cDNA amplification and sequencing. Total cellular RNA from the leukemia cell lines and normal tissue was isolated by Trizol reagent (Invitrogen). First-strand cDNA was made by the superscript amplification system (Invitrogen) with the oligo(dT)12-18 primer. To determine the expression of the different CaMKII{gamma} isoforms, we performed RT-PCR using primers flanking the variable region of CaMKII{gamma}, including 5'-CGTCAGGAGACTGTGGAGTGT (sense) and 5'-TCACTGCAGCGGTGCGGCAGG (antisense).

To amplify and sequence the complete CaMKII{gamma} coding sequence, the cDNA from the HL60 and NB4 cell lines was amplified in separate reactions with two different primer pairs flanking the NH2-terminal and COOH-terminal regions of the CaMKII{gamma} coding sequence. The sequence of these primers as well as the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) control primers are available on request. The PCR products were isolated and subcloned into the TA cloning vector for DNA sequencing.

Transient transfections and luciferase assays. K562 cells were transiently transfected using electroporation. Cells (5 x 106) were electroporated at 500 µF, 250 V, and cultured for 24 h under standard conditions. NIH3T3 cells were transiently transfected using Lipofectamine 2000 (Invitrogen). Stat3 transcriptional activity was determined in K562 cells transfected with the pSIE-tk-LUC luciferase reporter, which harbors a Stat3-binding site (CCTTAATCCTTCTGGGAATTCTGGCT). The β-gal reporter driven by the β-actin promoter was used as an internal control for transfection efficiency.

CaMKII{gamma} RNA interference constructs. Three LXSN-based plasmids harboring three different synthetic human CaMKII{gamma} oligos designed to generate short hairpin RNA (shRNA) hairpins were constructed as previously detailed (25). We synthesized and inserted an additional oligo generating a shRNA corresponding to human CaMKII{gamma} (NM_172171) coding region (954–976) into the pLL3.7 lentiviral vector plasmid, which harbors a green fluorescent protein (GFP) marker (27). These four plasmids were simultaneously electroporated into K562 cells, which were selected in G418 (800 µg/mL) for 10 d. GFP+ cells from this culture were then fluorescence-activated cell sorting enriched and cell lysates were subjected to Western blot analysis.

Construction and use of doxycycline-inducible expression vectors. A full-length CaMKII{gamma} cDNA was mutated at Lys43 to methionine to render it kinase deficient. It was then FLAG tagged at the NH2 terminus and cloned into the pTRE-Tight expression vector, which harbors a tet-responsive element.1 This plasmid was electroporated into K562 cells together with the Clontech pTet-On Advanced plasmid, which codes for a doxycycline-regulated transactivator protein. The electroporated cells were selected in G418 (800 µg/mL) for 10 d. Cell lysates for Western blot analysis were obtained from these transfected cells as well as from the same cells treated for 2 d with doxycycline (1 µg/mL).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activated CaMKII{gamma} is frequently present in myeloid leukemia cell lines and primary AML cells. We previously observed that CaMKII{gamma} is the CaMKII isoform that is predominantly expressed in myeloid cells (25). The binding of Ca2+/calmodulin to the inactive CaMKII{gamma} triggers autophosphorylation of this enzyme at Thr287, leading to autonomous enzyme activity that is relatively independent of further Ca2+/calmodulin regulation (17, 28, 29). This autophosphorylated CaMKII{gamma} can be detected using a CaMKII Thr287 phosphospecific antibody. Using this antibody on Western blots, we observed that the autophosphorylated (activated) CaMKII{gamma} was invariably present in different human leukemia cell lines (Fig. 1A ). To further investigate the role of CaMKII{gamma} in the pathogenesis of human leukemia, the present study focuses on the myeloid leukemias, and we observe that the activated, autophosphorylated CaMKII{gamma} is also present at varying levels in the majority (11 of 16) of primary patient AML samples (Fig. 1B). In contrast, Western blots did not reveal any detectable autophosphorylated CaMKII{gamma} in three different normal peripheral WBC samples (data not shown).


Figure 1
View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. CaMKII{gamma} activation in myeloid leukemia cells. A, cell lysates from the indicated human leukemia cell lines were subjected to Western blots using the indicated CaMKII antibodies. Antibodies to PP2Ac serve as a loading control. B, cell lysates from primary AML samples were subjected to Western blots using the indicated CaMKII antibodies. Antibodies to PP2Ac serve as a loading control. C, RT-PCR was performed on RNA extracted from the indicated leukemia cell lines and normal CD34+ cells and the products were displayed on an agarose gel. The location of the sense (S) and antisense (AS) primers in relationship to the catalytic, regulatory (Reg), variable (Var), and association (Assoc) domains of the human CaMKII{gamma} coding sequence is indicated. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

 
Because alternative splicing within a variable region of CaMKII{gamma} generates several different isoforms (30), we determined whether the myeloid leukemia cells exhibiting CaMKII{gamma} autophosphorylation expressed any unusual CaMKII{gamma} isoform(s). A RT-PCR analysis using primers flanking this alternatively spliced CaMKII{gamma} variable region (Fig. 1C) indicated that, in normal CD34+ cells as well as in leukemia cells, the previously described CaMKII{gamma}1 and CaMKII{gamma}3 isoforms were predominantly and commonly expressed (Fig. 1C). In addition, we determined whether the activation (autophosphorylation) of CaMKII{gamma} observed in the myeloid leukemia cell lines was associated with any particular mutations within the CaMKII{gamma} coding region in these cells. We PCR amplified and sequenced the entire CaMKII{gamma} coding region cDNA from the HL60 and NB4 myeloid cell lines. The CaMKII{gamma} cDNA coding sequence from both these cell lines matched the Genbank CaMKII{gamma}1 and CaMKII{gamma}3 sequences. Thus, the CaMKII{gamma} activation exhibited by the myeloid leukemia cells is not associated with the expression of any aberrantly spliced CaMKII{gamma} isoform(s) nor with any particular CaMKII{gamma} coding region mutation(s).

Terminal differentiation/apoptosis of myeloid leukemia cell lines is associated with decreased CaMKII{gamma} activation. ATRA induces the terminal granulocytic differentiation of certain myeloid leukemia cell lines, including HL60 (31) and NB4 (32), and ATRA also induces terminal monocytic differentiation of the U937 cell line (33). We used Western blots to compare CaMKII{gamma} expression in these cells at different times after this ATRA-induced terminal differentiation. We observed in all three of these cell lines that ATRA-induced terminal differentiation was associated with a marked decrease in the levels of activated CaMKII{gamma}, whereas total CaMKII{gamma} levels remain essentially unchanged (Fig. 2A ). This decrease in activated CaMKII{gamma} was most prominent 3 to 5 days after differentiation induction, which, as previously observed (31, 32), is the time that these cells undergo terminal differentiation and cease to proliferate. This ATRA-induced decrease in activated CaMKII{gamma} was not associated with any decrease in cellular calmodulin levels (data not shown). This decreased CaMKII{gamma} activation was ATRA dose dependent (Fig. 2B, rows 1–3) and seemed to closely correlate with differentiation induction because a similar decrease was not observed in ATRA-treated HL60R cells, which harbor an inactivating point mutation in RAR{alpha} that renders them unresponsive to ATRA-induced granulocytic differentiation (Fig. 2B, row 4; ref. 34). Similarly, other myeloid leukemia cell lines that are insensitive to ATRA-induced differentiation, including K562, KG1, THP1, and KCL22, did not exhibit any decrease in activated CaMKII{gamma} expression following ATRA induction (Fig. 2B, rows 5–8). A similar marked decrease in activated CaMKII{gamma} was also observed in HL60 cells treated with TPA, which induces terminal macrophage-like differentiation of these cells (Fig. 2C; ref. 35). Similarly, we observe that the terminal differentiation/apoptosis induced by arsenic trioxide in promyelocytic leukemia cell lines, such as NB4 (36), is accompanied by a down-regulation in phosphorylated CaMKII (Fig. 2D). Thus, the terminal differentiation of myeloid leukemia cells is associated with a marked down-regulation of the autophosphorylated CaMKII{gamma}.


Figure 2
View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Terminal differentiation/apoptosis of myeloid leukemia cells is associated with decreased CaMKII{gamma} activation. A, lysates from the HL60, NB4, and U937 myeloid cell lines treated with ATRA (1 µmol/L) for the indicated time were subjected to Western blots. B, lysates from the indicated myeloid cell lines treated for 5 d with the indicated concentration of ATRA were subjected to Western blots. C, lysates from HL60 cells treated with TPA (0.1 µmol/L) for the indicated time were subjected to Western blots. D, lysates from NB4 cells treated with arsenic trioxide (1 µmol/L) for the indicated time were subjected to Western blots.

 
Oncogenic bcr-abl regulates CaMKII{gamma} activation. In contrast to its lack of response to ATRA, the K562 cell line, derived from a patient with CML, undergoes proliferative arrest following exposure to imatinib (Gleevec), which is a potent inhibitor of the tyrosine kinase activity of the bcr-abl oncogene. We observed that this imatinib-induced proliferation arrest is accompanied by a rapid, marked decrease in autophosphorylated CaMKII{gamma}, whereas there was no significant change in the total levels of CaMKII{gamma} following this imatinib exposure (Fig. 3A ).


Figure 3
View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Inhibiting bcr-abl activity/expression inhibits CaMKII{gamma} activation. A, lysates from K562 cells undergoing growth arrest following treatment with Gleevec (5 µmol/L) for the indicated times were subjected to Western blots. B, lysates from TonB210.1 cells depleted of doxycycline for the indicated time were subjected to Western blots. C, lane 1, IL-3–dependent TonB210.1 cells were deprived of IL-3 for 24 h; lanes 2 to 8, the cells were then treated with the indicated compounds simultaneously with the addition of doxycycline. After 24 h, cell lysates were harvested and subjected to Western blots with the indicated CaMKII antibodies. D, K562 cells were cultured for 48 h with the indicated chemical inhibitors of specific signal transduction pathways. Cell lysates were harvested and subjected to Western blot analysis.

 
The marked down-regulation of CaMKII activation (autophosphorylation) by the bcr-abl inhibitor imatinib observed in K562 cells suggests that the activation of CaMKII{gamma} in these CML cells requires bcr-abl activity. To confirm this, we used the TonB210.1 cell line, which is a Baf3-derived line whose proliferation/viability is dependent on either interleukin-3 (IL-3) alone or the tet-regulated expression of bcr-abl (tet-on; ref. 37). We observe in the TonB210.1 cells that the decreased bcr-abl expression associated with tet withdrawal is also accompanied by a marked and relatively rapid (within 4 h) reduction in the levels of activated (autophosphorylated) CaMKII, whereas total CaMKII{gamma} levels remain unchanged (Fig. 3B). To determine if enhanced bcr-abl expression can initiate CaMKII activation, we first deprived the IL-3–dependent TonB210.1 cells of IL-3 for 24 h, which induced cell proliferative arrest associated with decreased autophosphorylated CaMKII{gamma} (Fig. 3C, lane 1). Treatment of these cells with tet restores CaMKII autophosphorylation (Fig. 3C, compare lanes 1 and 2), and this phosphorylation was inhibited in a dose-dependent manner by the CaMK chemical inhibitors KN62 and KN93 (Fig. 3C, lanes 3–6), which interfere with the binding of the Ca2+/calmodulin complex to the CaMKs (38). In contrast, this bcr-abl–mediated enhancement of CaMKII{gamma} phosphorylation was not inhibited by the CaMK kinase (CaMKK) chemical inhibitor STO609 (Fig. 3C, lanes 7 and 8). Taken together, these observations with the K562 and TonB210.1 cells indicate that oncogenic bcr-abl directly or indirectly activates CaMKII{gamma} and that this bcr-abl–induced CaMKII{gamma} activation is dependent on Ca2+/calmodulin binding to CaMKII{gamma}.

Effect of inhibitors of different signal transduction pathways on CaMKII{gamma} activation. The above observations indicate that CaMKII activation is downstream of bcr-abl, but we do not know whether this oncogene directly or indirectly (through one or more of its downstream effectors) mediates this activation. The molecular basis for bcr-abl–mediated cell transformation is complex and involves several specific downstream signal transduction pathways activated by bcr-abl, including Stat5 (11), Ras/Raf1/MAPK (12), PI3K (13), and SRC family kinases (14). Indeed, the cooperative activation of these pathways may be necessary for full bcr-abl–mediated transformation (39). We used specific chemical inhibitors to determine whether any of these signal transduction pathways downstream of bcr-abl might be involved in the bcr-abl–mediated activation of CaMKII{gamma} in K562 cells. In contrast with the Gleevec-induced down-regulation of CaMKII{gamma} activation (Fig. 3D, lane 17), none of these chemical inhibitors reduced CaMKII{gamma} activation, including those that target JAK/Stat (Fig. 3D, lanes 3, 4, and 16), PI3K (lanes 9 and 10), p38 (lane 8), JNK (lane 11), Ras/Raf/MAPK/extracellular signal-regulated kinase (ERK) kinase/ERK (lanes 6, 7, and 12), protein kinase C (lanes 14 and 15), AMP kinase (lane 18), and SRC family kinases (lane 5). Thus, the bcr-abl–mediated activation of CaMKII{gamma} does not seem to involve any of the signal transduction pathways that are known downstream effectors of bcr-abl.

Inhibitors of CaMKII inhibit the proliferation of myeloid leukemia cell lines. To determine whether inhibiting CaMKII{gamma} activity might have any effect on myeloid leukemia cell proliferation/viability, we treated K562 cells with the CaMK inhibitor KN93. We found that KN93 inhibited the proliferation of K562 cells in a dose-dependent manner (Fig. 4A, i ). In contrast, STO609, a potent small-molecule inhibitor of CaMKK (40), did not significantly inhibit K562 proliferation nor did KN92, an inactive structural analogue of KN62 (Fig. 4A, ii). The KN93-induced inhibition of K562 cell proliferation was accompanied by a reduction in the levels of the activated (autophosphorylated) CaMKII{gamma} (Fig. 5A, row 1 ). KN93 did not affect K562 viability, and no effect on the morphologic differentiation of these cells was observed. A similar KN93-mediated inhibition of cell proliferation without any significant effect on cell viability or morphologic differentiation was also noted in other cultured myeloid leukemia cell lines, including KG1, KCL22, THP1, and Kasumi (Fig. 4B).


Figure 4
View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. CaMKII inhibitors inhibit myeloid leukemia cell proliferation. A, K562 cells were seeded in liquid suspension culture at 5 x 104/mL in the presence or absence of the indicated concentration of compounds, and cell counts were obtained at the indicated time. B, the indicated myeloid leukemia cell lines were seeded in liquid suspension culture at 5 x 104/mL in the presence or absence of KN93, and cell counts were obtained at the indicated time. C, K562 cells were electroporated with the LXSN expression vector harboring the kinase-dead, Lys43-mutated, truncated CaMKII construct (kdCaMKII) as well as with the control (empty) LXSN vector. The electroporated cells were diluted into 96-well plates in liquid suspension culture in the presence of G418 (1 mg/mL). Following 8 d of culture, the total number of discrete, actively proliferating G418-resistant colonies within individual wells was determined.

 

Figure 5
View larger version (64K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. CaMKII regulates multiple signal transduction pathways in myeloid cells. A and B, lysates from K562 cells cultured for the indicated time in KN93 were subjected to Western blots. C, the K562 cells transduced as described in Materials and Methods with either (i) the doxycycline (DOX)-inducible expression vector/transactivator harboring the full-length, Lys43-mutated, kinase-dead CaMKII{gamma} [kdCaMKII{gamma} (tet-on)] or (ii) the CaMKII shRNA-generating plasmids were cultured in liquid suspension in the presence or absence of doxycycline as indicated, and cell counts were obtained after 48 h. D, lysates from K562 cells transduced with the indicated vectors were subjected to Western blots using the indicated antibodies. Lanes 2 and 4, doxycycline treatment was for 2 d.

 
To further assess the role of CaMKII{gamma} in regulating myeloid leukemia cell proliferation, we transiently transfected K562 cells with an expression vector harboring a truncated CaMKII{gamma} construct mutated at Lys43, a conserved residue near the ATP-binding site of this enzyme. This mutation results in a "kinase-dead" enzyme (41), and expression of this mutant inhibits endogenous CaMKII activity in a dominant-negative manner (42). We observed a marked reduction in K562 colony formation in cells transfected with this mutated CaMKII{gamma} compared with cells transfected with vector alone (Fig. 4C). Thus, both pharmacologic and dominant-negative construct inhibition of CaMKII results in inhibition of myeloid leukemia cell proliferation.

Pharmacologic, dominant-negative or shRNA-mediated inhibition of CaMKII{gamma} is associated with the down-regulation of multiple signal transduction pathways. We used phosphospecific antibodies to determine whether the KN93-induced inhibition of K562 cell proliferation (Fig. 4A, i) was associated with any changes in specific phosphoprotein signal transduction pathways. As noted above, KN93 treatment of K562 cells is associated with a time-dependent reduction in CaMKII{gamma} phosphorylation (Fig. 5A, row 1). This reduction was associated with a decrease in the activation (phosphorylation) of several different critical components of signal transduction pathways, including phosphorylated p44/42 MAPK (Fig. 5A, row 3), p38 (row 5), phosphorylated Stat3 (Tyr705 and Ser727; rows 10 and 11), and phosphorylated Stat5 (Tyr694; row 13). These changes induced by KN93 were not accompanied by any change in the total levels of these phosphorylated proteins (Fig. 5A). These observations indicate that, in K562 myeloid cells, activated CaMKII{gamma} is involved in regulating the activation (phosphorylation) of p44/42 MAPK, Stat3/Stat5, and p38.

We also observe that the KN93-induced down-regulation of CaMKII activation is associated with a marked reduction in GSK3β Ser9 phosphorylation (Fig. 5A, row 6). This is of particular interest because GSK3β, a serine/threonine kinase, phosphorylates and promotes the degradation of β-catenin, a key component of the Wnt signaling pathway, which is frequently activated in myeloid leukemia (43, 44). Because phosphorylation of GSK3β at Ser9 inhibits the activity of this enzyme (45), we would predict that the KN93-induced reduction in GSK3β Ser9 phosphorylation would lead to enhanced GSK3β enzyme activity associated with enhanced degradation of β-catenin. Indeed, a marked reduction in the expression of β-catenin is observed in the KN93-treated K562 cells (Fig. 5B, row 3). Consistent with this, in the KN93-induced cells, we also observe a reduction of c-myc and cyclin D1 protein levels, both of whose expression is normally up-regulated by β-catenin (Fig. 5B, rows 4 and 5; refs. 46, 47).

KN93 inhibits CaMKII activity by blocking its interaction with the Ca2+/calmodulin complex. However, this compound can potentially inhibit other enzymes activated by Ca2+/calmodulin, including CaMKI, CaMKIV, CKLiK, as well as the CaMKKs. Nevertheless, several lines of evidence indicate that the effects of KN93 are mediated through CaMKII inhibition rather than through inhibiting any of these other CaMKs. First, CaMKIV is not expressed in K562 cells (Supplementary Fig. S1A), and the CaMKI expressed by K562 is primarily in the inactive (unphosphorylated) form (Supplementary Fig. S1B). Second, there is little if any CKLiK (CaMKI{delta}) expression in K562 cells compared with other cell types (Supplementary Fig. S1C). Moreover, STO609, a potent small-molecule inhibitor of the CaMKKs, exhibits minimal effects on K562 proliferation (Fig. 4A, ii), indicating that neither the CaMKKs nor their downstream substrate CaMKI is the target of KN93. In addition, we transduced a FLAG-tagged, Lys43-mutated, dominant-negative CaMKII{gamma} under control of a doxycycline-inducible promoter [designated kdCaMKII{gamma} (tet-on)] into K562 cells. Treatment of these cells with doxycycline up-regulated expression of this construct (Fig. 5D, row 1, lane 4), and this induced expression was temporally associated with inhibition of K562 proliferation (Fig. 5C, i) together with down-regulation of the activation (phosphorylation) of the MAPK, Stat3/Stat5, and β-catenin pathways (Fig. 5D, compare lanes 3 and 4). Finally, we used a small interfering RNA approach to knock down the expression of CaMKII{gamma} in K562 cells. The shRNA-transduced K562 cells with reduced expression of CaMKII{gamma} (Fig. 5D, row 2, compare lanes 5 and 6) exhibited reduced cell proliferation (Fig. 5C, ii), and this is associated with down-regulation of the MAPK, JAK/Stat, and GSK3β/β-catenin pathways (Fig. 5D, compare lanes 5 and 6). Thus, the effects of KN93 on K562 cells are likely mediated through its inhibitory activity on CaMKII{gamma} rather than through any of the other CaMKs.

CaMKII{gamma} directly phosphorylates and activates Stat3 in myeloid leukemia cells. In addition to tyrosine phosphorylation of Stat3 at Tyr705, Stat3 Ser727 phosphorylation is required for full Stat3 transcriptional activity (48). The activated Stat3 has oncogenic activity (49), and Stat3 activation is frequently observed in myeloid leukemia cell lines (Fig. 6A, i ) as well as in myeloid leukemia patient samples (Fig. 6A, ii; ref. 8). Our observation that the CaMKII inhibitor KN93 induces a decrease in Stat3 Ser727 phosphorylation (Fig. 5A, row 11) suggests that Stat3 may be a direct substrate of CaMKII{gamma} in myeloid leukemia cells. Consistent with this, we observe that 9 of 11 of the primary AML samples that exhibit CaMKII{gamma} activation (Fig. 1B) also exhibit Stat3 Ser727 phosphorylation, whereas none of the 5 primary AML samples that were negative for CaMKII{gamma} activation exhibits Stat3 Ser727 phosphorylation (Fig. 6A, ii). In addition, we observe in the TonB210 cells that the tet-induced bcr-abl induction is associated with a marked increase in Stat3 Ser727 phosphorylation without any change in total Stat3 levels (Fig. 6B, compare lanes 1 and 2). Moreover, this enhanced Stat3 Ser727 phosphorylation is blocked by KN62 or KN93 (Fig. 6B, lanes 3 and 4), indicating that a CaMK is involved in this bcr-abl–induced Stat3 Ser727 phosphorylation. We also observe that cucurbitacin I, a small-molecule Stat3 inhibitor, will, as expected, inhibit Stat3-responsive reporter activity, and this reporter activity is also inhibited by KN93 in a dose-dependent manner (Fig. 6C). These latter observations indicate a functional interaction between Stat3 and CaMKII in myeloid leukemia cells.


Figure 6
View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Stat3 is directly phosphorylated and activated by CaMKII{gamma} at Ser727. A, i, cell lysates from the indicated human leukemia cell lines were subjected to Western blots using the indicated Stat3 antibodies; ii, cell lysates from the same primary AML samples depicted in Fig. 1B were subjected to Western blots using the indicated Stat3 antibodies. B, the IL-3–dependent TonB210.1 cells were deprived of IL-3 for 24 h. The cells were then treated with the indicated compounds immediately before the addition of doxycycline. After an additional 24 h, cell lysates were harvested and subjected to Western blots with the indicated Stat3 antibodies. C, K562 cells were electroporated with a luciferase reporter driven by a Stat3 response element. The indicated concentrations of KN93 and the Stat3 inhibitor cucurbitacin I were added and relative luciferase activity was determined on cell lysates following 48 h of culture. D, i, K562 cell lysates were immunoprecipitated with control IgG or a Stat3 antibody. The immunoprecipitates were then subjected to Western blot analysis with the indicated antibodies. ii, a bacterial-expressed GST-Stat3 fusion protein was incubated in vitro with CaMKII{gamma} that had been immunoprecipitated from HL60 cells. Western blots were then performed on the reaction mixtures using the indicated Stat3 antibodies. iii, NIH3T3 cells were transfected with the empty LXSN expression vector (lane 1), the same vector harboring the coding sequences of a constitutively active CaMKII{gamma} (caCaMKII{gamma}; lane 2), or vector harboring the kinase-dead CaMKII{gamma} (kdCaMKII{gamma}; lane 3). After 48 h, Western blots were performed on cell lysates using the indicated Stat3 antibodies.

 
To further assess the CaMKII{gamma}/Stat3 interaction, we observed that in K562 cells Stat3 coimmunoprecipitates with CaMKII{gamma} (Fig. 6D, i). Moreover, CaMKII{gamma} phosphorylates Stat3 at Ser727 both in vitro (Fig. 6D, ii) and in vivo (Fig. 6D, iii). Together, these observations suggest that Stat3 is likely a direct substrate of CaMKII{gamma} in myeloid leukemia cells and that the KN93-induced inhibition of K562 cell proliferation (Fig. 4A) may be mediated, at least in part, through its inhibition of Stat3 Ser727 phosphorylation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The CaMKs are major targets of Ca2+-regulated physiologic events, and the role of a particular CaMK (i.e., CaMKII) in regulating both neuronal and cardiac muscle cell development and activity has been well established. Our present study defines a novel and critical role for the activated (autophosphorylated) CaMKII (CaMKII{gamma}) in regulating the proliferation of myeloid leukemia cells. Indeed, we observe that relatively high amounts of the autophosphorylated CaMKII{gamma} are invariably present in myeloid leukemia cell lines, and this activation is also observed in the majority of primary patient AML samples. In different in vitro models of myeloid leukemia cell terminal differentiation/growth arrest including those triggered by ATRA, TPA, arsenic trioxide, or Gleevec, the loss of proliferation of the induced leukemia cells is accompanied by a marked reduction in CaMKII{gamma} activation. This marked down-regulation of CaMKII{gamma} activation likely directly contributes to the loss of leukemia cell proliferative capacity because we observe that both pharmacologic, dominant negative and shRNA-mediated inhibition of CaMKII expression/activity inhibits myeloid leukemia cell proliferation. Moreover, we observe that CaMKII{gamma} directly or indirectly regulates multiple signaling pathways previously implicated in leukemia cell proliferation, including the MAPK, JAK/Stat, and GSK3β/β-catenin pathways.

What are the molecular events that trigger and maintain CaMKII{gamma} constitutive activation (autophosphorylation) in the myeloid leukemia cell lines and primary patient AML samples? The myeloid leukemias are remarkably heterogenous, and diverse molecular events may trigger CaMKII{gamma} activation in these leukemias. Our observations in cell lines driven by oncogenic bcr-abl indicate that CaMKII activation is downstream of bcr-abl but is not regulated by other bcr-abl–activated signal transduction events involving the MAPK, JAK/Stat, SRC-related kinase, or PI3K pathways (Fig. 3D). The primary trigger of CaMKII activation is its binding to Ca2+/calmodulin, whose levels are regulated by intracellular Ca2+ concentration. Our observations in TonB210.1 cells suggest that the bcr-abl–mediated CaMKII activation is dependent, at least in part, on Ca2+/calmodulin binding to CaMKII because this bcr-abl–induced activation is inhibited by KN62 or KN93, which blocks Ca2+/calmodulin binding to CaMKII (Fig. 3C). This suggests that bcr-abl might regulate intracellular Ca2+/calmodulin levels, and this would likely involve the regulation by this oncogene of intracellular Ca2+ concentration. Nevertheless, how bcr-abl might regulate intracellular Ca2+ levels and Ca2+/calmodulin activity is currently unknown.

Closely related to the question of how CaMKII{gamma} is activated in myeloid leukemia cells is how this enzyme becomes inactivated (dephosphorylated) during terminal myeloid differentiation/growth arrest (Fig. 2). Indeed, we observe a prominent decrease in CaMKII{gamma} activation during ATRA-induced terminal granulocytic differentiation of myeloid leukemia cells and also note that normal granulocytes harbor relatively low levels of the activated CaMKII{gamma}. This terminal myeloid differentiation is not associated with any decrease in total cell calmodulin concentration to account for the reduced CaMKII{gamma} activity. One possibility to explain this down-regulation of CaMKII{gamma} autophosphorylation is that myeloid differentiation is accompanied by changes in Ca2+ channel activity with an associated decrease in intracellular Ca2+ concentration that reduces the Ca2+/calmodulin activation of CaMKII. Another possibility is that an increase in phosphatase activity that targets the activated (autophosphorylated) CaMKII{gamma} accompanies myeloid differentiation. Consistent with this latter possibility, we have observed that PP2A, a phosphatase known to dephosphorylate CaMKII in neuronal cells (50), coimmunoprecipitates with CaMKII{gamma} in myeloid cells (data not shown). However, the levels of PP2A do not seem to change during myeloid leukemia cell differentiation (data not shown), and whether the phosphatase activity that specifically targets the activated (autophosphorylated) CaMKII{gamma} is developmentally regulated during myeloid differentiation is presently unknown.

What are the critical substrates of CaMKII{gamma} that are involved in regulating myeloid leukemia cell proliferation? In HeLa cells, CaMKII phosphorylation of the cdc25 phosphatase is associated with cdc2 activation and enhanced G2-M transition (51). Moreover, the localization of CaMKII to the mammalian midbody also suggests a role for this enzyme in regulating cytokinesis (52). We have previously observed that CaMKII{gamma} directly phosphorylates and inhibits the transcriptional activity of RAR{alpha}, which is an important regulator of the terminal differentiation of certain myeloid leukemia cells (25). Our present study indicates that Stat3, which exhibits oncogenic activity (49), is directly phosphorylated by CaMKII{gamma}, and this phosphorylation enhances Stat3 transcriptional activity (Fig. 6). We also observe that CaMKII{gamma} directly or indirectly promotes the inhibitory phosphorylation of GSK3β, an enzyme that normally down-regulates the expression of cell growth/proliferation factors, including β-catenin, c-myc, and cyclin D1 (Fig. 5B). Thus, CaMKII activity seems to orchestrate a complex interacting network of molecular events that are involved in regulating the proliferation of myeloid leukemia cells.

Our observation that CaMKII{gamma} is an important regulator of multiple phosphoprotein signaling networks regulating myeloid leukemia cell proliferation suggests that targeting this enzyme might be of therapeutic benefit in human myeloid leukemia. Indeed, we reproducibly observe an inhibition of myeloid leukemia cell proliferation triggered by KN93, a small-molecule inhibitor of CaMKII. However, the CaMKII pharmacologic inhibitors have significant limitations. These compounds inhibit CaMKII activity by interfering with their binding to the Ca2+/calmodulin complex. However, once CaMKII has become activated (autophosphorylated), its dependence on further Ca2+/calmodulin binding is markedly diminished (18). Thus, these compounds exert considerably less inhibition on CaMKII once it has become activated (autophosphorylated). An "ideal" CaMKII{gamma} inhibitor would be a small molecule, which would directly inhibit the activated CaMKII{gamma} by directly targeting its ATP-binding pocket. Such a CaMKII{gamma} inhibitor has not been identified, but we would predict that it would exert much greater activity in inhibiting leukemia cell proliferation than KN93 and might be of significant value in the targeted therapy of myeloid leukemia.


    Acknowledgments
 
Grant support: NIH grant RO1 CA118971 (S.J. Collins) and Leukemia and Lymphoma Society grant 6144.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank LeMoyne Mueller for excellent technical assistance.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

1 http://www.clontech.com Back

Received 7/ 3/07. Revised 1/28/08. Accepted 3/13/08.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gilliland DG. Molecular genetics of human leukemias: new insights into therapy. Semin Hematol 2002;39:6–11.[CrossRef][Medline]
  2. Melnick A, Licht JD. Deconstructing a disease: RAR{alpha}, its fusion partners, and their roles in the pathogenesis of acute promyelocytic leukemia. Blood 1999;93:3167–215.[Free Full Text]
  3. Meyers S, Lenny N, Hiebert SW. The t(8;21) fusion protein interferes with AML-1B-dependent transcriptional activation. Mol Cell Biol 1995;15:1974–82.[Abstract]
  4. Pabst T, Mueller BU, Zhang P, et al. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-{alpha} (C/EBP{alpha}), in acute myeloid leukemia. Nat Genet 2001;27:263–70.[CrossRef][Medline]
  5. Beghini A, Ripamonti CB, Cairoli R, et al. KIT activating mutations: incidence in adult and pediatric acute myeloid leukemia, and identification of an internal tandem duplication. Haematologica 2004;89:920–5.[Abstract/Free Full Text]
  6. Stirewalt DL, Radich JP. The role of FLT3 in haematopoietic malignancies. Nat Rev Cancer 2003;3:650–65.[CrossRef][Medline]
  7. Radich JP, Kopecky KJ, Willman CL, et al. N-ras mutations in adult de novo acute myelogenous leukemia: prevalence and clinical significance. Blood 1990;76:801–7.[Abstract/Free Full Text]
  8. Steensma DP, McClure RF, Karp JE, et al. JAK2 V617F is a rare finding in de novo acute myeloid leukemia, but STAT3 activation is common and remains unexplained. Leukemia 2006;20:971–8.[CrossRef][Medline]
  9. Robinson LJ, Xue J, Corey SJ. Src family tyrosine kinases are activated by Flt3 and are involved in the proliferative effects of leukemia-associated Flt3 mutations. Exp Hematol 2005;33:469–79.[CrossRef][Medline]
  10. Xu Q, Simpson SE, Scialla TJ, Bagg A, Carroll M. Survival of acute myeloid leukemia cells requires PI3 kinase activation. Blood 2003;102:972–80.[Abstract/Free Full Text]
  11. de Groot RP, Raaijmakers JA, Lammers JW, Jove R, Koenderman L. STAT5 activation by BCR-Abl contributes to transformation of K562 leukemia cells. Blood 1999;94:1108–12.[Abstract/Free Full Text]
  12. Cortez D, Stoica G, Pierce JH, Pendergast AM. The BCR-ABL tyrosine kinase inhibits apoptosis by activating a Ras-dependent signaling pathway. Oncogene 1996;13:2589–94.[Medline]
  13. Skorski T, Bellacosa A, Nieborowska-Skorska M, et al. Transformation of hematopoietic cells by BCR/ABL requires activation of a PI-3k/Akt-dependent pathway. EMBO J 1997;16:6151–61.[CrossRef][Medline]
  14. Hu Y, Liu Y, Pelletier S, et al. Requirement of Src kinases Lyn, Hck and Fgr for BCR-ABL1-induced B-lymphoblastic leukemia but not chronic myeloid leukemia. Nat Genet 2004;36:453–61.[CrossRef][Medline]
  15. Hook SS, Means AR. Ca(2+)/CaM-dependent kinases: from activation to function. Annu Rev Pharmacol Toxicol 2001;41:471–505.[CrossRef][Medline]
  16. Hoelz A, Nairn AC, Kuriyan J. Crystal structure of a tetradecameric assembly of the association domain of Ca2+/calmodulin-dependent kinase II. Mol Cell 2003;11:1241–51.[CrossRef][Medline]
  17. Fong YL, Taylor WL, Means AR, Soderling TR. Studies of the regulatory mechanism of Ca2+/calmodulin-dependent protein kinase II. Mutation of threonine 286 to alanine and aspartate. J Biol Chem 1989;264:16759–63.[Abstract/Free Full Text]
  18. Meyer T, Hanson PI, Stryer L, Schulman H. Calmodulin trapping by calcium-calmodulin-dependent protein kinase. Science 1992;256:1199–202.[Abstract/Free Full Text]
  19. Lisman J, Schulman H, Cline H. The molecular basis of CaMKII function in synaptic and behavioural memory. Nat Rev Neurosci 2002;3:175–90.[CrossRef][Medline]
  20. Tombes RM, Grant S, Westin EH, Krystal G. G1 cell cycle arrest and apoptosis are induced in NIH 3T3 cells by KN-93, an inhibitor of CaMK-II (the multifunctional Ca2+/CaM kinase). Cell Growth Differ 1995;6:1063–70.[Abstract]
  21. Morris TA, DeLorenzo RJ, Tombes RM. CaMK-II inhibition reduces cyclin D1 levels and enhances the association of p27kip1 with Cdk2 to cause G1 arrest in NIH 3T3 cells. Exp Cell Res 1998;240:218–27.[CrossRef][Medline]
  22. Nghiem P, Ollick T, Gardner P, Schulman H. Interleukin-2 transcriptional block by multifunctional Ca2+/calmodulin kinase. Nature 1994;371:347–50.[CrossRef][Medline]
  23. Lin MY, Zal T, Ch'en IL, Gascoigne NR, Hedrick SM. A pivotal role for the multifunctional calcium/calmodulin-dependent protein kinase II in T cells: from activation to unresponsiveness. J Immunol 2005;174:5583–92.[Abstract/Free Full Text]
  24. Bui JD, Calbo S, Hayden-Martinez K, Kane LP, Gardner P, Hedrick SM. A role for CaMKII in T cell memory. Cell 2000;100:457–67.[Medline]
  25. Si J, Mueller L, Collins SJ. CaMKII regulates retinoic acid receptor transcriptional activity and the differentiation of myeloid leukemia cells. J Clin Invest 2007;117:1412–21.[CrossRef][Medline]
  26. Si J, Collins SJ. IL-3-induced enhancement of retinoic acid receptor activity is mediated through Stat5, which physically associates with retinoic acid receptors in an IL-3-dependent manner. Blood 2002;100:4401–9.[Abstract/Free Full Text]
  27. Rubinson DA, Dillon CP, Kwiatkowski AV, et al. A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat Genet 2003;33:401–6.[CrossRef][Medline]
  28. Miller SG, Patton BL, Kennedy MB. Sequences of autophosphorylation sites in neuronal type II CaM kinase that control Ca2(+)-independent activity. Neuron 1988;1:593–604.[CrossRef][Medline]
  29. Lou LL, Schulman H. Distinct autophosphorylation sites sequentially produce autonomy and inhibition of the multifunctional Ca2+/calmodulin-dependent protein kinase. J Neurosci 1989;9:2020–32.[Abstract]
  30. Tombes RM, Faison MO, Turbeville JM. Organization and evolution of multifunctional Ca(2+)/CaM-dependent protein kinase genes. Gene 2003;322:17–31.[CrossRef][Medline]
  31. Breitman T, Selonick S, Collins S. Induction of differentiation of the human promyelocytic leukemia cell line (HL-60) by retinoic acid. Proc Natl Acad Sci U S A 1980;77:2936–40.[Abstract/Free Full Text]
  32. Lanotte M, Martin-Thouvenin V, Najman S, Balerini P, Valensi F, Berger R. NB4, a maturation inducible cell line with t(15;17) marker isolated from a human acute promyelocytic leukemia (M3). Blood 1991;77:1080–6.[Abstract/Free Full Text]
  33. Olsson IL, Breitman TR. Induction of differentiation of the human histiocytic lymphoma cell line U-937 by retinoic acid and cyclic adenosine 3':5'-monophosphate-inducing agents. Cancer Res 1982;42:3924–7.[Abstract/Free Full Text]
  34. Robertson K, Emami B, Collins S. Retinoic acid-resistant HL-60R cells harbor a point mutation in the RA receptor ligand binding domain that confers dominant negative activity. Blood 1992;80:1885–9.[Abstract/Free Full Text]
  35. Rovera G, Santoli D, Damsky C. Human promyelocytic leukemia cells in culture differentiate into macrophage-like cells when treated with a phorbol diester. Proc Natl Acad Sci U S A 1979;76:2779–83.[Abstract/Free Full Text]
  36. Chen GQ, Zhu J, Shi XG, et al. In vitro studies on cellular and molecular mechanisms of arsenic trioxide (As2O3) in the treatment of acute promyelocytic leukemia: As2O3 induces NB4 cell apoptosis with downregulation of Bcl-2 expression and modulation of PML-RAR{alpha}/PML proteins. Blood 1996;88:1052–61.[Abstract/Free Full Text]
  37. Klucher KM, Lopez DV, Daley GQ. Secondary mutation maintains the transformed state in BaF3 cells with inducible BCR/ABL expression. Blood 1998;91:3927–34.[Abstract/Free Full Text]
  38. Sumi M, Kiuchi K, Ishikawa T, et al. The newly synthesized selective Ca2+/calmodulin dependent protein kinase II inhibitor KN-93 reduces dopamine contents in PC12h cells. Biochem Biophys Res Commun 1991;181:968–75.[CrossRef][Medline]
  39. Sonoyama J, Matsumura I, Ezoe S, et al. Functional cooperation among Ras, STAT5, and phosphatidylinositol 3-kinase is required for full oncogenic activities of BCR/ABL in K562 cells. J Biol Chem 2002;277:8076–82.[Abstract/Free Full Text]
  40. Tokumitsu H, Inuzuka H, Ishikawa Y, Ikeda M, Saji I, Kobayashi R. STO-609, a specific inhibitor of the Ca(2+)/calmodulin-dependent protein kinase kinase. J Biol Chem 2002;277:15813–8.[Abstract/Free Full Text]
  41. Hanson PI, Meyer T, Stryer L, Schulman H. Dual role of calmodulin in autophosphorylation of multifunctional CaM kinase may underlie decoding of calcium signals. Neuron 1994;12:943–56.[CrossRef][Medline]
  42. Kuhl M, Sheldahl LC, Malbon CC, Moon RT. Ca(2+)/calmodulin-dependent protein kinase II is stimulated by Wnt and Frizzled homologs and promotes ventral cell fates in Xenopus. J Biol Chem 2000;275:12701–11.[Abstract/Free Full Text]
  43. Cohen P, Frame S. The renaissance of GSK3. Nat Rev Mol Cell Biol 2001;2:769–76.[CrossRef][Medline]
  44. Simon M, Grandage VL, Linch DC, Khwaja A. Constitutive activation of the Wnt/β-catenin signalling pathway in acute myeloid leukaemia. Oncogene 2005;24:2410–20.[CrossRef][Medline]
  45. Eldar-Finkelman H, Argast GM, Foord O, Fischer EH, Krebs EG. Expression and characterization of glycogen synthase kinase-3 mutants and their effect on glycogen synthase activity in intact cells. Proc Natl Acad Sci U S A 1996;93:10228–33.[Abstract/Free Full Text]
  46. He TC, Sparks AB, Rago C, et al. Identification of c-MYC as a target of the APC pathway. Science 1998;281:1509–12.[Abstract/Free Full Text]
  47. Tetsu O, McCormick F. β-Catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 1999;398:422–6.[CrossRef][Medline]
  48. Shen Y, Schlessinger K, Zhu X, et al. Essential role of STAT3 in postnatal survival and growth revealed by mice lacking STAT3 serine 727 phosphorylation. Mol Cell Biol 2004;24:407–19.[Abstract/Free Full Text]
  49. Bromberg JF, Wrzeszczynska MH, Devgan G, et al. Stat3 as an oncogene. Cell 1999;98:295–303.[CrossRef][Medline]
  50. Strack S, Barban MA, Wadzinski BE, Colbran RJ. Differential inactivation of postsynaptic density-associated and soluble Ca2+/calmodulin-dependent protein kinase II by protein phosphatases 1 and 2A. J Neurochem 1997;68:2119–28.[Medline]
  51. Patel R, Holt M, Philipova R, et al. Calcium/calmodulin-dependent phosphorylation and activation of human Cdc25-C at the G2/M phase transition in HeLa cells. J Biol Chem 1999;274:7958–68.[Abstract/Free Full Text]
  52. Skop AR, Liu H, Yates J III, Meyer BJ, Heald R. Dissection of the mammalian midbody proteome reveals conserved cytokinesis mechanisms. Science 2004;305:61–6.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Si, J.
Right arrow Articles by Collins, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Si, J.
Right arrow Articles by Collins, S. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online