Cancer Research Meeting Calendar Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Cancer Research 68, 4133, June 1, 2008. doi: 10.1158/0008-5472.CAN-08-0432
© 2008 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, J.
Right arrow Articles by Guo, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, J.
Right arrow Articles by Guo, Y.

Molecular Biology, Pathobiology, and Genetics

TIP30 Induces Apoptosis under Oxidative Stress through Stabilization of p53 Messenger RNA in Human Hepatocellular Carcinoma

Jian Zhao1,2, Jingjing Chen1, Bin Lu1, Li Dong1,3, Huajing Wang1, Chongshan Bi1, Guobin Wu1,4, Huaizu Guo1, Mengchao Wu1 and Yajun Guo1,2

1 International Joint Cancer Institute and Eastern Hospital of Hepatobiliary Surgery, The Second Military Medical University; 2 E-Institute of Universities, Immunology Division, Shanghai Jiao Tong University and Shanghai Center for Cell Engineering and Antibody; 3 Shanghai Institute of Applied Physics, China Academy of Sciences, Shanghai, P.R. China; and 4 Guangxi Cancer Hospital, Guangxi Medical University, Guangxi, P.R. China

Requests for reprints: Yajun Guo, International Joint Cancer Institute, Second Military Medical University, 800 Xiang Yin Road, New Building 10th-11th Floor, Shanghai 200433, P.R. China. Phone: 86-21-25070241; Fax: 86-21-25074349; E-mail: yjguo{at}smmu.edu.cn.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Reactive oxygen species (ROS) and cellular oxidant stress have long been associated with cancer. Here, we show that TIP30, also called CC3, regulates p53 mRNA stability and induces apoptosis by sensing of intracellular oxidative stress in human hepatocellular carcinoma (HCC) cells. Introduction of TIP30 induced more cell death in HepG2 cells with a high level of intracellular ROS than that in normal liver cell line, HL7702, which had low level of intracellular ROS. Treatment with an antioxidant agent attenuated TIP30-induced cell death in HepG2 cells, whereas oxidant H2O2 augmented TIP30-induced cell death in HL7702 cells. The conformation of TIP30 was altered with the formation of an intermolecular disulfide bridge under oxidative stress. TIP30 greatly enhanced p53 expression and its transcriptional activity under oxidative stress, which was probably through stabilization of p53 mRNA. TIP30 induced apoptosis and mitochondrial dysfunction were blocked by silencing of p53 expression. The nuclear import of mRNA-binding protein HuR was blocked upon TIP30 introduction, which might be due to the interruption of the association of HuR with importin β2. The elevated cytoplasmic HuR bound to p53 mRNA 3'-untranslated region, resulting in prolonged half-life of p53 mRNA. Our results suggest that TIP30 is involved in cellular oxidative stress surveillance and induces apoptosis through stabilization of p53 mRNA in HCC cells. [Cancer Res 2008;68(11):4133–41]


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Reactive oxygen species (ROS) and cellular oxidant stress have long been associated with cancer (1). Elevated ROS induced by hepatitis B virus and hepatitis C virus infection, aflatoxin B1 exposure, growth factor stimulation, and activation of oncogenes plays an important role in hepatocarcinogenesis (2). Robust ROS can induce direct damage to many important cellular constituents, such as DNA, lipids, and proteins, which results in activation of many cellular signaling cascades that regulate cell proliferation and apoptosis (2, 3). ROS-induced protein damages include conformational changes of redox-related proteins, such as transcription factors, kinases, and phosphatases, which result in alterations of enzymatic activities or protein-protein interactions (3, 4).

TIP30, also called CC3 or HTIP2, is a putative tumor suppressor. Recently, the decreased expression of TIP30 was observed in hepatocellular carcinoma (HCC) surgical specimens and cell lines (5, 6). Consistent with these observations, genetically engineered mice deficient in Tip30 gene had a high incidence of HCC and other tumors (5). These data suggest that TIP30 plays an important role in the suppression of hepatocarcinogenesis. The suppressive effects of TIP30 on tumor development could partially be ascribed to its proapoptotic property (7–9). A recent crystal structure analysis indicated the potential of TIP30 acting as a metabolic sensor linked to its proapoptotic property (10). The protein structures most closely related to TIP30 are members of the short-chain dehydrogenase reductase family. In addition, a TIP30 homodimer was present in the crystal across a 2-fold axis, which involved a disulfide bridge via Cys172 residues and a PEG 600 molecule shared between two TIP30 monomers. Because cysteine thiol-disulfide exchanges are crucial for sensing intracellular levels of ROS and signal transduction, TIP30 therefore might be oxidized with disulfide bridge formation under oxidative stress and executes its antitumor activities.

Although gene expression is crucially modulated by transcription, the essential contributions of posttranscriptional events are becoming increasingly recognized. Unlike transcription modulation that relied upon new molecular synthesis, mRNA turnover is primarily controlled as an early immediate response to various cellular stimuli through the association of RNA-binding proteins with specific RNA sequences (11, 12). The RNA-binding protein HuR prominently regulates gene expression through binding to mRNAs that contain AU-rich elements (ARE) located in the 3'-untranslated regions (3'-UTR; refs. 13, 14). HuR has emerged as a key regulator of genes that are central to the stress response, cell growth, and proliferation, such as p21, c-fos, c-myc, p53, cyclin A, and cyclin B1 (13, 14). HuR is shown to promote the stability of target transcripts and to enhance target mRNA translation in response to agents causing DNA damage (15, 16). HuR is predominantly nuclear in unstimulated cells and translocates to the cytoplasm in response to various stimuli, which are intimately linked to its effects on target mRNAs (14, 17). Importin β2, also known as transportin, was found to participate in the nuclear import of HuR (18, 19). TIP30 was recently found to form complex with multiple karyopherins of the importin β family in a RanGTP-insensitive manner, by which it inhibited nuclear import and induced apoptosis (9). Thus, TIP30 might regulate HuR distribution through interaction with importin β.

We have previously found that TIP30 might induce apoptosis through elevation of p53 protein expression, which was not due to stabilization of p53 protein (6). In this study, we show that TIP30 is oxidized with formation of intermolecular disulfide bridge under oxidative stress, resulting in cytoplasmic accumulation of HuR, stabilization of p53 mRNA, and induction of mitochondria-mediated apoptosis.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosure of Potential...
 References
 
Cell culture and chemicals. Human HCC cell lines HepG2 and Hep3B; three established HCC cell lines CH-Hep-1, CH-Hep-3, CH-Hep-4 (20); and a normal liver cell HL7702, were maintained in DMEM containing 10% fetal bovine serum, under an atmosphere of 5% CO2 at 37°C. N-acetyl-L-cysteine (NAC) and actinomycin D were purchased from Sigma-Aldrich.

Transfection of small interfering RNA. p53 short hairpin (shRNA; V2HS_93615) inserted in pSM2c retrovirus vector was purchased from Open Biosystems. p53 shRNA and control shRNA (not matching any known human gene) were transfected into HepG2 cells and screened under 3 µg/mL puromycin (Merck). The stably transfected cell clones were obtained by limiting dilution and confirmed by Western blot analysis using anti-p53 antibody (DO-1, Santa Cruz Biotechnology). HuR4 small interfering RNA (siRNA) AACACGCUGAACGGCUUGAGG (16), Tip30 siRNA CCGGCAGAGUGCUCUUAAA (21), and control siRNA AAGUAGCUUGGCCUUGA were transfected with Lipofectamine 2000 (Invitrogen).

Plasmid construction. The NH2-terminal His-tagged Tip30 cDNA was obtained by PCR amplification from pcDNA3-Tip30 construct and subcloned into pcDNA3 (Invitrogen) in BamHI-XhoI sites. The NH2-terminal His-tagged importin β2 cDNA was obtained by PCR amplification from the cDNA pool of normal liver cell line HL7702 and subcloned into pcDNA3 in KpnI-XhoI sites. An overlap extension PCR method was used to introduce site-specific substitutions within the Tip30 open reading frame. The Tip30F187A, F188A, G189A (Tip30M6) cDNA was subcloned into pcDNA3 in BamHI sites. The NH2-terminal His-tagged Tip30C80A, C81A, Tip30C124A, and Tip30C172A cDNA was subcloned into pcDNA3 in BamHI-XhoI sites. Construction of Ad-GFP and Ad-TIP30 adenovirus was carried out as described previously (6).

Intracellular ROS assay. ROS level was analyzed by flow cytometry using an H2O2-sensitive fluorescent dye, dichlorodihyrofluorescein diacetate (DCF-DA, Sigma-Aldrich), as described previously (22).

RNA extraction and real-time PCR. Total RNA was isolated from cells using an RNeasy Mini Kit (Qiagen). Genomic DNA was removed from total RNA before cDNA synthesis using the RNase-Free DNase Set for DNase digestion during RNA purification. First-strand cDNA synthesis was done using SuperScript RT Kit (Invitrogen). Expression of the indicated gene mRNA was determined by quantitative reverse transcription-PCR (RT-PCR) using the LightCycler system (Roche Diagnostics). Actin was used as an endogenous control to normalize for differences in the amount of total RNA in each sample. Relative expression of genes was calculated and expressed as 2–{Delta}{Delta}CT as described previously (23).

Subcellular fractionation and Western blotting analysis. Cytosol and mitochondria fractionation was performed by centrifugation technique as described previously (24). Nuclear and cytoplasmic extracts were made using NE-PER Nuclear and Cytoplasmic Extraction Reagent Kit (Pierce Biotechnology). Total cell lysate was prepared in radioimmunoprecipitation assay buffer [RIPA; 25 mmol/L Tris (pH 7.4), 150 mmol/L KCl, 5 mmol/L EDTA, 1% NP40, 0.5% sodium deoxycholate, and 0.1% SDS] with protease inhibitor cocktail (Sigma-Aldrich). Proteins at the same amount were separated by 10% to 15% SDS-PAGE and transferred onto polyvinylidene difluoride membranes. To monitor TIP30 redox state, protein extracts were separated by nonreducing SDS-PAGE without β-mercaptoethanol. After probing with individual antibodies, the antigen-antibody complex was visualized by the enhanced chemiluminescence reagent Supersignal (Pierce Biotechnology). The antibodies used were anti–cytochrome c (BioVision), anti-Smac (Chemicon), anti–caspase-9 (Trevigen), anti-Bax, anti-HuR, anti-His epitope, anti-CoxIV, anti-actin (Santa Cruz Biotechnology), and anti-TIP30 (kindly provided by Dr. Hua Xiao, University of Nebraska Medical Center, Omaha, NE).

Cell lysates for RNA-protein binding assays. For the RNA-protein binding assays, the cells were resuspended in approximately equal pellet volume of ice-cold polysome lysis buffer [100 mmol/L KCl, 5 mmol/L MgCl2, 10 mmol/L HEPES (pH 7.0), and 0.5% NP40] supplemented with RNase and protease inhibitors (25). The cell lysate was centrifuged at 14,000 x g in a tabletop microfuge for 10 min at 4°C and the supernatant cytoplasmic lysate was collected for biotin pull-down assays. The pelleted mRNA-protein mRNP cell lysate contained ~50 mg/mL total protein was prepared for endogenous HuR-mRNA complex assay.

In vitro transcription. Total RNA from normal liver cell HL7702 was reverse transcribed, and the cDNAs generated were used as templates for PCR amplification of the coding region and 3'-UTR of p53 mRNA as described previously (16). The 5' primers contained the T7 RNA polymerase promoter sequence (T7): CCAAGCTTCTAATACGACTCACTATAGGGAGA. To prepare the coding region (encompassing positions 252 to 1439), oligonucleotides (T7) ATGGAGGAGCCGCAGTCAGATCCTAGC and AGAATGTCAGTCTGAGTCAGGC were used. To prepare the 3'-UTR template (encompassing positions 1421 to 2629), oligonucleotides (T7) TGACTCAGACTGACATTCTCC and TGGCAGCAAAGTTTTATTGTAAAATAAGAGATCG were used. PCR-amplified products were resolved on agarose gels, purified, and used as templates to transcribe biotinylated RNA in vitro by using T7 RNA polymerase (Invitrogen) in the presence of biotin-cytidine 5'-triphosphate, and purified.

RNA-protein binding assays. Biotin pull-down assays were performed as described previously (16). Six micrograms of biotinylated transcripts were incubated with 120 µg of cytoplasmic lysate for 30 min at room temperature. Complexes were isolated with streptavidin agarose (Invitrogen), and pull-down material was analyzed by Western blotting with anti-HuR and anti-actin antibodies.

Immunoprecipitation of endogenous HuR-mRNA complexes, used to assess the association of endogenous HuR with endogenous p53 and p21 mRNA, was performed as described previously (16, 25). About 120 µg of mRNA-protein complex lysate were used for immunoprecipitation in the presence of excess (30 µg) immunoprecipitated antibody [either mouse monoclonal anti-HuR antibody 3A2 or IgG1] for 4 h at room temperature. RNA in immunoprecipitated material was used in RT-PCR reactions to detect the presence of p53 and p21 mRNA.

Coimmunoprecipitation assay. Cell extracts were prepared by sonicating in 25 mmol/L Tris Cl (pH 7.4), 100 mmol/L NaCl, 0.15% NP40, 0.25 mmol/L EDTA, and 10% glycerol, supplemented with protease inhibitor cocktail (Sigma-Aldrich; ref. 26). After centrifugation at 14,000 rpm for 20 min, either rabbit polyclonal anti-His antibody or IgG1 (1.5 mg antibody/mg extract) and protein A-agarose (Invitrogen) were added to the supernatant cytoplasmic lysates and incubated at 4°C overnight. The beads were washed thrice in the same lysis buffer and the proteins remaining on beads were analyzed by immunoblotting with relevant antibodies.

Microscopy and fluorescence resonance energy transfer analysis. The Tip30 cDNA was subcloned into pECFP-N1 and pEYFP-C1 (Clontech Laboratories) in EcoRI-BamHI sites, making the TIP30-CFP and YFP-TIP30 fusion construct, respectively. HepG2 cells were cotransfected with pECFP-N1-Tip30 and pEYFP-C1-Tip30 and imaged on a Zeiss LSM 510 confocal laser-scanning microscope (Carl Zeiss) as described previously (27, 28). Donor cyan fluorescent protein (CFP) was excited at 458 nm and fluorescence emission was detected in a bandwidth of 478 to 498 nm (CFP channel). Acceptor yellow fluorescent protein (YFP) was excited at 514 nm and fluorescence emission was detected in a bandwidth of 545 ± 15 nm (YFP channel). Fluorescence resonance energy transfer (FRET) excitation was conducted at 458 nm and fluorescence emission was detected in a bandwidth of 545 ± 15 nm (FRET channel). To correct for fluorescence bleed-through into the FRET channel, cells transfected with only pECFP-N1-Tip30 were used to determine the donor correction factor and cells transfected with only pEYFP-C1-Tip30 were used to determine the acceptor correction factor. Images of pECFP-N1-Tip30 and pEYFP-C1-Tip30 expression in cotransfected cells were sequentially acquired with the donor CFP channel, acceptor YFP channel, and FRET channel under identical conditions. The image obtained with the FRET channel was evaluated using Carl Zeiss AxioVision FRET software (Carl Zeiss) and FRET was calculated using the acceptor ratio correction method (27).

Detection and quantitation of apoptosis. Apoptosis was examined by assessing nuclear changes indicative of apoptosis using the DNA-binding dye Hoechst 33342 (Sigma-Aldrich) under an OLYMPUS IX71 fluorescence microscope (OLYMPUS). Apoptotic nuclei were identified by condensed chromatin, contiguous to the nuclear membrane, and nuclear fragmentation of condensed chromatin.

Measurement of mitochondrial membrane potential. Cells were incubated with tetramethylrhodamine ethylester (TMRE) by MitoShift Kit (Trevigen) and observed under fluorescence microscope.

Statistical analysis. Statistical analysis was performed using the Analysis ToolPack provided by Microsoft Excel. A Student's two-sample t test, assuming unequal variances, was used to determine the equality of the means of two samples. Results were considered statistically significant at P < 0.05.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosure of Potential...
 References
 
TIP30 induces cell death under oxidative stress. The intracellular ROS level was much higher in five HCC cells tested than that in normal liver cell HL7702 (Fig. 1A ). Infection of Ad-TIP30 caused significant increase of cell death in HepG2 cells, which had high intracellular ROS level compared with Ad-GFP infection (Fig. 1B). On the other hand, no obvious difference was found in HL7702 cells that had low intracellular ROS level (Fig. 1C). Treatment with the antioxidant NAC greatly suppressed TIP30-induced cell death in HepG2 cells (Fig. 1B). In contrast, TIP30-induced cell death significantly increased in HL7702 cells with the addition of H2O2 (Fig. 1C). These data suggest that TIP30-induced cell death might be triggered by oxidative stress.


Figure 1
View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. TIP30 induces cell death under oxidative stress. A, HCC cells and normal liver cell HL7702 were incubated with 10 µmol/L DCF-DA for 20 min at 37°C. Fluorescence was measured using flow cytometry (excitation at 488 nm, emission at 515–545 nm) and the mean fluorescence intensity was used to quantify the response. Columns, mean from three independent experiments; bars, SD. *, P < 0.05. HepG2 cells (B) or HL7702 cells (C; 2 x 105 per well in 24-well plates) were infected with Ad-TIP30 and Ad-GFP as the control at a multiplicity of infection (MOI) of 10 in the presence or absence of 75 µmol/L NAC (B) or 100 µmol/L H2O2 (C), in triplicate. The cell death was evaluated by trypan blue staining at the indicated time postinfection. Points, mean from three independent experiments; bars, SD. Expression of TIP30 was confirmed by Western blotting with anti-TIP30 antibody.

 
TIP30 is oxidized under oxidative stress. A recent crystal structure analysis indicated the potential of TIP30 acting as a metabolic sensor linked to its proapoptotic property (10). We then investigated the redox forms of the TIP30 in normal liver cell HL7702 using the cysteine-trapping method (29, 30). Inspection of the Western blotting under nonreducing conditions revealed a faint anti-TIP30 stained higher molecular weight band at various low doses of H2O2, whose presence correlated with TIP30 oxidation (Fig. 2A ). The absence of this band under reducing conditions indicated a probable intermolecular disulfide linkage of TIP30 and high molecular weight proteins (Fig. 2A). We further analyzed the redox forms of His-tagged TIP30 in HepG2 cells, in which TIP30 was almost undetectable (6), by immunoblotting with an anti-His antibody. Again, a distinct slower mobility band was found after exposure to various concentrations of H2O2 (Fig. 2B). To further investigate which cysteine(s) take part in the formation of intermolecular disulfide linkage(s) in response to ROS, three TIP30 mutants were constructed as shown in Fig. 2C. The mutant containing Cys172 substituted into alanine lost its ability to form oxidized TIP30 band. The data indicates the formation of a TIP30 mixed-disulfide, involving Cys172, under oxidative stress.


Figure 2
View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. TIP30 is oxidized under oxidative stress. A, HL7702 cells were exposed to various concentrations of H2O2 for 1 h. Equivalent amounts of total cell extracts in RIPA buffer were resolved under nonreducing or reducing conditions. Western blotting analysis of the TIP30 redox state was carried out by anti-TIP30 antibody. B, Tip30-deficient HepG2 cells were transfected with pcDNA3 or pc-his-Tip30, and 24 h later, the cells were exposed to various concentrations of H2O2 for 5 min. Equivalent amounts of total cell extract were resolved under nonreducing or reducing conditions. Western blotting analysis of the TIP30 redox state was carried out by anti-His antibody. C, schematics of TIP30 depicting its four cysteines residues. HepG2 cells were transfected with His-TIP30C80A, C81A, His-Tip30C124A, and His-Tip30C172A expression vectors and then exposed to 800 µmol/L H2O2 for 5 min. Equivalent amounts of cell extracts were resolved under nonreducing or reducing conditions. Effects of TIP30 cysteine mutations on mixed disulfide formation were carried out by Western blotting with anti-His antibody. D, HepG2 cells were cotransfected with TIP30-CFP and YFP-TIP30 fusion protein expression vectors and 20 h later, the cells were treated with 500 µmol/L H2O2 for 5 min followed by NAC (100 µmol/L) treatment for 30 min or no NAC treatment. Mock-treated cells served as controls. Fluorescence intensity images were taken in CFP, YFP, and FRET channels on a Zeiss LSM 510 confocal laser-scanning microscope, respectively. The fluorescence in FRET channel was corrected against bleed-through of the non-FRET CFP and YFP fluorescence excited at 458 nm.

 
To investigate whether TIP30 forms homodimer under oxidative stress in living cells, we conducted FRET assay (27, 28). The cells coexpressing TIP30-CFP and YFP-TIP30 were selected by double-colored fluorescence (Fig. 2D). Upon H2O2 exposure, the enhanced fluorescence from cytoplasm was clearly detected in the FRET channel after correction for bleed-through of CFP and YFP. Evaluation of FRET using acceptor ratio analysis depicted increased FRET efficiency (62.9%), indicating a direct interaction between two TIP30 monomers under oxidative stress. The interaction between TIP30-CFP and YFP-TIP30 was disrupted within 30 minutes upon antioxidant NAC treatment. Together, these data show the formation of intermolecular disulfide linkage and molecular conformation alteration of TIP30 under oxidative stress.

TIP30 enhances p53 expression and its transactivation activity under oxidative stress. Introduction of TIP30 resulted in 23.9% increases of p53 mRNA compared with mock treatment in HepG2 cells harboring wild-type p53 gene, which was augmented by the addition of H2O2 and attenuated by the addition of NAC (Fig. 3A ). Western blotting confirmed the regulatory effects of TIP30 on p53 (Fig. 3A). Moreover, treatment with H2O2 alone caused only slight increase of p53 mRNA in Tip30-deficient HepG2 cells, but a significant increase was found in Tip30 wild-type HL7702 cells (Fig. 3A and B). Depletion of Tip30 greatly attenuated H2O2-induced p53 up-regulation in HL7702 cells (Fig. 3B). Consistent with the expression of p53, the transactivation activity of p53, as detected by p21, puma, mdm2, and bax mRNA expression, was enhanced upon ectopic expression of TIP30 in HepG2 cells, which was significantly augmented by oxidant H2O2 and blocked by antioxidant NAC (Fig. 3C). The data suggest that oxidative stress promotes TIP30-induced p53 up-regulation, and Tip30 is required for p53 elevation under oxidative stress.


Figure 3
View larger version (43K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. TIP30 elevates p53 expression under oxidative stress. A, HepG2 cells with p53 wild-type were infected with Ad-TIP30 or Ad-GFP at MOI 10, or untreated as control, in the presence or absence of oxidant H2O2 (100 µmol/L) or antioxidant NAC (75 µmol/L). The cells were collected 12 h after treatments and the relative p53 mRNA expression was analyzed with quantitative RT-PCR. p53 protein expression was analyzed by Western blotting with anti-p53 monoclonal antibody (DO-1). B, normal liver cell HL7702 was transfected with siTip30 or siNon at 200 nmol/L, or untreated (UT) as control; 24 h later, the cells were treated with 100 µmol/L H2O2. The cells were collected 24 h after oxidant supplement and the relative p53 mRNA expression was analyzed with quantitative RT-PCR. p53 protein expression was analyzed by Western blotting with anti-p53 antibody. C, the relative p21, bax, puma, and mdm2 mRNA expression was analyzed with quantitative RT-PCR in HepG2 cells treated as in A. Columns, mean from three independent experiments; bars, SD. *, P < 0.05.

 
TIP30 induces a p53-dependent mitochondria-mediated apoptosis in HepG2 cells. To investigate whether TIP30-induced cell death was p53 dependent in HepG2 cells, we generated a HepG2 cell line stably expressing p53 shRNA. Depletion of p53 greatly attenuated TIP30-induced apoptosis (Fig. 4A ). Moreover, introduction of TIP30 resulted in a significant loss of mitochondrial membrane potential in HepG2 cells, but not in Hep3B cells harboring p53 gene null (ref. 6; Fig. 4B). Depletion of p53 blocked TIP30-induced mitochondrial membrane potential decrease in HepG2 cells (Fig. 4B).


Figure 4
View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. TIP30 induces a p53-dependent mitochondria-mediated apoptosis. A, HepG2 cells stably transfected with shp53 or shNon were infected with Ad-TIP30 or Ad-GFP at MOI 10. Apoptosis was determined with Hoechst staining. Photographs are representative images from each group as indicated under a fluorescence microscope. Columns, average number of Hoechst staining cells from five microscopic views. The expression of p53 was analyzed by Western blotting with anti-p53 antibody. B, HepG2 and Hep3B cells, as well as shRNA stably transfected HepG2 cells were infected with Ad-TIP30 or Ad-GFP at MOI 10. Mitochondrial potential was detected by a MitoShift kit 12 h after infection. In healthy cells, the TMRE dye accumulates in the mitochondria and appears bright red by fluorescence microscopy; however, in apoptotic cells, the mitochondrial membrane potential collapses and the TMRE dye cannot accumulate within the mitochondria. Adenovirus-infected cells (green, left) with the corresponding TMRE staining profile (red, middle) and phase-contrast images (right) were observed under a fluorescence microscope. Arrows, the corresponding TMRE staining of adenovirus-infected cells. C, cytosolic and mitochondrial subcellular fractions were isolated from HepG2 and Hep3B cells infected with Ad-TIP30 at various times after infection, and then subjected to SDS-PAGE and immunoblotted with the indicated antibodies. D, shRNA stably transfected HepG2 cells were infected with Ad-TIP30 or Ad-GFP, or untreated. The mitochondrial fractions were extracted 24 h postinfection and subjected to Western blotting with the indicated antibodies.

 
Bax is a direct transcription target of p53 and translocates to mitochondria when receiving death signals (31, 32). The mitochondrial fraction of Bax was significantly enhanced in HepG2 cells but not in Hep3B cells by TIP30 transduction (Fig. 4C). Consistent with this, release of cytochrome c and Smac from the mitochondria to the cytosol and the activation of procaspase-9 were detected in HepG2 cells but not in Hep3B cells (Fig. 4C). Moreover, TIP30-induced mitochondria accumulation of Bax and redistribution of cytochrome c and Smac were abolished by p53 depletion (Fig. 4D). These data show that TIP30 induces a p53-dependent mitochondria-mediated apoptosis.

TIP30 up-regulates p53 expression through stabilization of p53 mRNA. We have previously shown that elevation of p53 by TIP30 was not due to stabilization of the p53 protein (6). The transcriptional activities of p53 promoter did not change following TIP30 transduction in HepG2 and Chang liver cells (data not shown). Instead, assays were carried out to measure the stability of p53 mRNA by monitoring the rate of p53 mRNA clearance in HepG2 cells where transcription was halted by actinomycin D. Introduction of TIP30 significantly enhanced the stability of p53 mRNA from half-life of 6 to 7 hours in untreated or Ad-GFP–treated populations to over 10 hours in Ad-TIP30–treated cells (Fig. 5A ). Addition of H2O2 significantly enhanced TIP30-induced stabilization of p53 mRNA, whereas NAC treatment reduced the stabilization (Fig. 5A). Thus, TIP30 might enhance p53 expression through stabilization of p53 mRNA under oxidative stress.


Figure 5
View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. TIP30 enhances binding of HuR with p53 transcripts and p53 mRNA stability. A, HepG2 cells were either untreated or treated with Ad-TIP30 or Ad-GFP at MOI 10. Alternatively, HepG2 cells were infected with Ad-TIP30 in the presence or absence of H2O2 (100 µmol/L) or NAC (75 µmol/L). p53 mRNA stability was calculated 24 h later. RNA was prepared at the time indicated after actinomycin D (2 µg/mL) treatment and subjected to quantitative RT-PCR analysis. Points, mean of three independent experiments; bars, SD. B, cytoplasmic lysates prepared from HepG2 cells infected with either Ad-TIP30 or Ad-GFP were incubated with biotinylated p53 mRNA 3'-UTR or CR for 30 min at 25°C. The resulting complexes were pulled down using streptavidin-coated beads and immunoblotted with anti-HuR antibody. β-Actin, a protein lacking RNA-binding activity, served to verify the specificity of this assay. C, lysates from HepG2 cells infected with either Ad-TIP30 or Ad-GFP were used for immunoprecipitation in the presence of anti-HuR antibody or nonspecific IgG1. RNA in the immunoprecipitated material was used in RT-PCR reactions to detect the presence of p53 and p21 mRNA and the resulting PCR products were visualized in agarose gels. D, HepG2 cells were transfected with siHuR or siNon; 24 h later, the cells were infected with Ad-TIP30 or Ad-GFP at MOI 10. At 16 h postinfection, the expressions of p53 and HuR mRNA were analyzed by quantitative RT-PCR and cell death was evaluated by trypan blue staining.

 
Use of biotinylated p53 transcripts in RNA pull-down assays revealed an association of the p53 mRNA 3'-UTR with HuR in lysates prepared from Ad-GFP–infected cells (Fig. 5B). The association significantly increased when using lysates prepared from Ad-TIP30–infected cells (Fig. 5B). In contrast, no such complexes were found when using biotinylated p53 coding region transcript (devoid of AU-rich regions). The in vivo association of endogenous p53 mRNA and HuR in HepG2 cells was analyzed through immunoprecipitation of HuR under the conditions that preserved its association with target mRNAs (25). RT-PCR analysis revealed the presence of endogenous p53 mRNA in the material immunoprecipitated with anti-HuR antibodies, but not with nonspecific antibodies (IgG1; Fig. 5C). The p53 mRNA was more abundant in Ad-TIP30–infected cell lysates (Fig. 5C). The association of HuR with p21 mRNA, which also contains ARE in its 3'-UTR, was also enhanced upon introduction of TIP30 (Fig. 5C). These findings show that TIP30 promotes the interaction of HuR with p53 and p21 mRNA 3'-UTR.

We then used a siRNA targeting the HuR mRNA, which caused >50% decreased expression of HuR mRNA (Fig. 5D), to examine the role of HuR in regulation of p53 mRNA expression following TIP30 transduction. TIP30-induced p53 up-regulation and cell death was greatly attenuated by HuR depletion in HepG2 cells (Fig. 5D). These findings reveal that HuR contributes to the increased stability of p53 mRNA and cell death upon TIP30 introduction.

TIP30 induces cytoplasmic accumulation of HuR through interaction with importin β2 under oxidative stress. To further investigate the mechanism by which TIP30 promotes the association of HuR with p53 mRNA 3'-UTR, the expression of HuR was examined. Whole-cell HuR levels did not change with ectopic TIP30 expression in HepG2 cells. In contrast, its cytoplasmic presence significantly increased upon TIP30 introduction (Fig. 6A ). This cytoplasmic accumulation of HuR was enhanced by addition of H2O2 and blocked by NAC treatment (Fig. 6B).


Figure 6
View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 6. TIP30 induces HuR cytoplasmic accumulation through interaction with importin β2. A, HepG2 cells were infected with Ad-TIP30 or Ad-GFP, or untreated as control. Cytoplasmic and nuclear fractions were prepared 16 h postinfection and subjected to Western blotting with anti-HuR antibody. B, HepG2 cells were infected with Ad-TIP30 or Ad-GFP in the presence or absence of H2O2 (100 µmol/L) or NAC (75 µmol/L). Cytoplasmic fractions were prepared 16 h later and subjected to Western blotting with anti-HuR antibody. C, HepG2 cells were transfected with pcTip30, pcTip30M6 (containing mutations of F187A, F188A, G189A), or pcDNA3 vector. Cytoplasmic and nuclear fractions were prepared 48 h after transfection and subjected to Western blotting with anti-HuR antibody. D, HepG2 cells were cotransfected with pc-his-importin β2 together with pcTip30, or pcTip30M6, or pcDNA3, in the presence or absence of NAC (75 µmol/L). The anti-His rabbit polyclonal antibody was used to immunoprecipitate (IP) components of cytoplasmic lysates from indicated HepG2 cells. The immune complexes were analyzed by Western blotting with antibodies against HuR or TIP30 (left). Immunoblotting (IB) of aliquots of cytoplasmic lysates was performed by antibodies against HuR, TIP30, His-epitope, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; right).

 
To investigate whether TIP30 competes with HuR for forming complex with importin β2, we constructed a TIP30 mutant (TIP30F187A, F188A, G189A), named TIP30M6, in which the amino acids (residues 95-98, 141-142, and 187-189 of TIP30) predicted to interact with importin β2 were substituted into alanine (10). As shown in Fig. 6C, TIP30M6 lost the capability to induce cytoplasmic HuR accumulation. Coimmunoprecipitation analysis showed that HuR interacted with His-importin β2 by immunoprecipitation with anti-His antibody in the cytoplasmic extracts of HepG2 cells. When TIP30 was introduced, accompanying with the interaction of TIP30 with importin β2, the interaction of importin β2 with HuR was decreased (Fig. 6D). On the other hand, TIP30M6, which was unable to form complex with importin β2, did not block the interaction of importin β2 with HuR (Fig. 6D). Moreover, treatment with NAC blocked the interaction of TIP30 with importin β2 (Fig. 6D). Thus, TIP30 competes with HuR for the formation of complex with importin β2 and causes the cytoplasmic accumulation of HuR under oxidative stress.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosure of Potential...
 References
 
We have previously reported that introduction of TIP30 into TIP30-decreased HCC cells inhibited cell growth and sensitized HCC cells to chemotherapy drugs (6). In this study, we show that TIP30-induced cell death is triggered by oxidative stress. TIP30-induced cell death was more effective in ROS-increased HCC cells than that in ROS-low normal liver cells. Treatment with antioxidant NAC attenuated TIP30-induced cell death in HCC cells. Thus, TIP30 may act as a ROS sensor and plays an important role for elimination of ROS-increased cells. Given that most cancer cells produce more ROS than do normal cells (33, 34), the selective killing of ROS-increased HCC cells by TIP30 highlights its potential in the treatment of cancer.

The mechanism for activation of TIP30 under oxidative stress is probably through conformation change of TIP30 by the formation of intermolecular disulfide linkage. A higher molecular weight band stained by anti-TIP30 antibody was found in both endogenous TIP30 protein and ectopically expressed TIP30 under oxidative stress in the nonreduced condition. A directed intermolecular interaction between two TIP30 proteins was confirmed by the FRET assay. The formation of intermolecular disulfide linkage of TIP30 under oxidative stress might be crucial for sensing the cellular redox state and contribute to its proapoptotic effects.

The p53 tumor suppressor regulates cellular homeostasis through induction of cell cycle arrest, apoptosis, and cell senescence in response to various types of stress. A previous study showed that p53 was activated under oxidative stress, inducing either antioxidant genes or pro-oxidant gene expression depending on the severity of stresses (22). The precise mechanism by which p53 is activated by oxidative stress is unknown. Oxidative stress could cause p53 protein oxidation directly with a conformation modulation (35), or p53 protein deacetylation by interaction with the human orthologue of yeast Sir2, which is a NAD+-dependent histone deacetylase (36). The relatively low frequency of p53 gene mutation in HCC (~30%) indicates that defects in the p53 pathway also play important roles in hepatocarcinogenesis.

Here, we show evidences that TIP30 may be another regulator involved in p53 pathway. First, introduction of TIP30 into Tip30-deficient HepG2 cells promoted endogenous p53 expression and enhanced transactivation activities of p53 on its target genes. This effect was enhanced by oxidant and attenuated by antioxidant. Second, knockdown of Tip30 by siRNA blocked H2O2-induced p53 up-regulation. Finally, TIP30-induced mitochondria damage was p53 dependent.

Recently, evidence has emerged revealing that p53 mRNA stability and translation are also strong regulators of p53 expression (16, 37–39). Here, we show that TIP30 enhances p53 expression through stabilization of p53 mRNA under oxidative stress. Given the existence of AREs located in the 3'-UTR of p53 mRNA and affinity of RNA binding protein HuR for the p53 mRNA (16), we found that TIP30 induced cytoplasmic accumulation of HuR and enhanced the interaction of HuR with p53 3'-UTR. TIP30 was previously found to form a complex with karyopherins of the importin β family, by which TIP30 inhibited nuclear transport and induced apoptosis (9). Interestingly, the members of importin family were identified as mediators for HuR nuclear import (18, 19). Structure docking study and coimmunoprecipitation analysis presented that TIP30 was located toward the COOH terminus of importin β2, acting as an antagonist for cargo proteins binding to importin βs (9, 10). In the present study, we showed evidences that TIP30 competed with HuR to interact with importin β2 under oxidative stress and caused cytoplasmic accumulation of HuR. Besides p53 mRNA, HuR was found to interact with another ARE-containing mRNA, p21 mRNA, and elevate its expression upon TIP30 induction. However, no obvious differences were found in the binding of HuR with cyclin A, cyclin B1, c-myc, and c-fos mRNA after TIP30 induction (data not shown). Several recent reports have suggested that ARE-binding proteins may be modulated to recognize only a subset of AREs in given physiologic conditions or in a given cell type. H2O2 treatment decreased HuR binding to several target mRNAs (those encoding SIRT1, cyclin D1, cytochrome c, and cyclin A) but increased binding to other targets (ProTa and p21) in human diploid fibroblasts (40). However, irradiation with UVC (short-wavelength UV light) promoted HuR binding to several target transcripts such as p53, p21, and ProT{alpha} mRNAs (15, 16, 41) but decreased binding to the cyclin D1 mRNA (42). The selectivity of HuR binding with target mRNAs after TIP30 induction still needs to be investigated.

In summary, we show that TIP30 plays an essential role in sensing increases of ROS and translating ROS signals into p53-dependent apoptosis pathway. The proapoptosis properties of TIP30 under oxidative stress might be critical for eliminating ROS-increased cells, avoiding the further DNA damage and the risk of transformation and cancer development.


   Disclosure of Potential Conflicts of Interest
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
References
 
No potential conflicts of interest were disclosed.


   Acknowledgments
 
Grant support: National Nature Science Foundation of China, Ministry of Science and Technology of China (973 and 863 projects), Shanghai Commission of Science and Technology, National Foundation for Excellence Doctoral Project, and Shanghai Municipal Education Commission for Shuguang Project.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Xiao Hua for providing the Tip30 gene and anti-TIP30 antibody, and Yunchao Ma, Qirui Liu, and Yan Huang for technical support.


   Footnotes
 
Note: Jian Zhao and Jingjing Chen contributed equally to this work.

Received 2/ 4/08. Revised 3/18/08. Accepted 3/22/08.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Ames BN. Dietary carcinogens and anticarcinogens. Oxygen radicals and degenerative diseases. Science 1983;221:1256–64.[Abstract/Free Full Text]
  2. Tien Kuo M, Savaraj N. Roles of reactive oxygen species in hepatocarcinogenesis and drug resistance gene expression in liver cancers. Mol Carcinog 2006;45:701–9.[CrossRef][Medline]
  3. Veal EA, Day AM, Morgan BA. Hydrogen peroxide sensing and signaling. Mol Cell 2007;26:1–14.[CrossRef][Medline]
  4. Itoh K, Wakabayashi N, Katoh Y, et al. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev 1999;13:76–86.[Abstract/Free Full Text]
  5. Ito MJC, Krumm K, Zhang X, et al. TIP30 deficiency increases susceptibility to tumorigenesis. Cancer Res 2003;63:8763–7.[Abstract/Free Full Text]
  6. Zhao J, Zhang X, Shi M, et al. TIP30 inhibits growth of HCC cell lines and inhibits HCC xenografts in mice in combination with 5-FU. Hepatology 2006;44:205–15.[CrossRef][Medline]
  7. Shtivelman E. A link between metastasis and resistance to apoptosis of variant small cell lung carcinoma. Oncogene 1997;14:2167–73.[CrossRef][Medline]
  8. Xiao H, Palhan V, Yang Y, Roeder RG. TIP30 has an intrinsic kinase activity required for up-regulation of a subset of apoptotic genes. EMBO J 2000;19:956–63.[CrossRef][Medline]
  9. King FW, Shtivelman E. Inhibition of nuclear import by the proapoptotic protein CC3. Mol Cell Biol 2004;24:7091–101.[Abstract/Free Full Text]
  10. El Omari K, Bird LE, Nichols CE, Ren J, Stammers DK. Crystal structure of CC3 (TIP30): implications for its role as a tumor suppressor. J Biol Chem 2005;280:18229–36.[Abstract/Free Full Text]
  11. Bashirullah A, Cooperstock RL, Lipshitz HD. Spatial and temporal control of RNA stability. Proc Natl Acad Sci U S A 2001;98:7025–8.[Abstract/Free Full Text]
  12. Fan J, Yang X, Wang W, Wood WH III, Becker KG, Gorospe M. Global analysis of stress-regulated mRNA turnover by using cDNA arrays. Proc Natl Acad Sci U S A 2002;99:10611–6.[Abstract/Free Full Text]
  13. Gorospe M. HuR in the mammalian genotoxic response: post-transcriptional multitasking. Cell Cycle 2003;2:412–4.[Medline]
  14. Brennan CM, Steitz JA. HuR and mRNA stability. Cell Mol Life Sci 2001;58:266–77.[CrossRef][Medline]
  15. Wang W, Furneaux H, Cheng H, et al. HuR regulates p21 mRNA stabilization by UV light. Mol Cell Biol 2000;20:760–9.[Abstract/Free Full Text]
  16. Mazan-Mamczarz K, Galban S, Lopez de Silanes I, et al. RNA-binding protein HuR enhances p53 translation in response to ultraviolet light irradiation. Proc Natl Acad Sci U S A 2003;100:8354–9.[Abstract/Free Full Text]
  17. Keene JD. Why is Hu where? Shuttling of early-response-gene messenger RNA subsets. Proc Natl Acad Sci U S A 1999;96:5–7.[Free Full Text]
  18. Guttinger S, Muhlhausser P, Koller-Eichhorn R, Brennecke J, Kutay U. Transportin2 functions as importin and mediates nuclear import of HuR. Proc Natl Acad Sci U S A 2004;101:2918–23.[Abstract/Free Full Text]
  19. Rebane A, Aab A, Steitz JA. Transportins 1 and 2 are redundant nuclear import factors for hnRNP A1 and HuR. RNA 2004;10:590–9.[Abstract/Free Full Text]
  20. Zhao J, Wang H, Wei L, et al. The cytotoxic effect of E1B 55-kDa mutant adenovirus on human hepatocellular carcinoma cell lines. Cancer Gene Ther 2001;8:333–41.[CrossRef][Medline]
  21. Zhao J, Ni H, Ma Y, et al. TIP30/CC3 expression in breast carcinoma: relation to metastasis, clinicopathologic parameters, and P53 expression. Hum Pathol 2007;38:293–8.[CrossRef][Medline]
  22. Sablina AA, Budanov AV, Ilyinskaya GV, Agapova LS, Kravchenko JE, Chumakov PM. The antioxidant function of the p53 tumor suppressor. Nat Med 2005;11:1306–13.[CrossRef][Medline]
  23. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(–{Delta}{Delta}C(T)) method. Methods 2001;25:402–8.[CrossRef][Medline]
  24. Yang J, Liu X, Bhalla K, et al. Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked. Science 1997;275:1129–32.[Abstract/Free Full Text]
  25. Tenenbaum SA, Lager PJ, Carson CC, Keene JD. Ribonomics: identifying mRNA subsets in mRNP complexes using antibodies to RNA-binding proteins and genomic arrays. Methods 2002;26:191–8.[CrossRef][Medline]
  26. Xu L, Kang Y, Col S, Massague J. Smad2 nucleocytoplasmic shuttling by nucleoporins CAN/Nup214 and Nup153 feeds TGFβ signaling complexes in the cytoplasm and nucleus. Mol Cell 2002;10:271–82.[CrossRef][Medline]
  27. Youvan DC, Silva CM, Bylina J, Coleman WJ, Dilworth MR, Yang MM. Calibration of fluorescence resonance energy transfer in microscopy using genetically engineered GFP derivatives on nichel bands. Biotechnol Alia 1997;3:1–18.
  28. Miyawaki A, Tsien RY. Monitoring protein conformations and interactions by fluorescence resonance energy transfer between mutants of green fluorescent protein. Methods Enzymol 2000;327:472–500.[Medline]
  29. Delaunay A, Isnard AD, Toledano MB. H2O2 sensing through oxidation of the Yap1 transcription factor. EMBO J 2000;19:5157–66.[CrossRef][Medline]
  30. Delaunay A, Pflieger D, Barrault MB, Vinh J, Toledano MB. A thiol peroxidase is an H2O2 receptor and redox-transducer in gene activation. Cell 2002;111:471–81.[CrossRef][Medline]
  31. Miyashita T, Reed JC. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 1995;80:293–9.[CrossRef][Medline]
  32. Wolter KG, Hsu YT, Smith CL, Nechushtan A, Xi XG, Youle RJ. Movement of Bax from the cytosol to mitochondria during apoptosis. J Cell Biol 1997;139:1281–92.[Abstract/Free Full Text]
  33. Szatrowski TP, Nathan CF. Production of large amounts of hydrogen peroxide by human tumor cells. Cancer Res 1991;51:794–8.[Abstract/Free Full Text]
  34. Trachootham D, Zhou Y, Zhang H, et al. Selective killing of oncogenically transformed cells through a ROS-mediated mechanism by β-phenylethyl isothiocyanate. Cancer Cell 2006;10:241–52.[CrossRef][Medline]
  35. Hainaut P, Milner J. Redox modulation of p53 conformation and sequence-specific DNA binding in vitro. Cancer Res 1993;53:4469–73.[Abstract/Free Full Text]
  36. Luo J, Nikolaev AY, Imai S, et al. Negative control of p53 by Sir2{alpha} promotes cell survival under stress. Cell 2001;107:137–48.[CrossRef][Medline]
  37. Giaccia AJ, Kastan MB. The complexity of p53 modulation: emerging patterns from divergent signals. Genes Dev 1998;12:2973–83.[Free Full Text]
  38. Kim H, You S, Foster LK, Farris J, Foster DN. The rapid destabilization of p53 mRNA in immortal chicken embryo fibroblast cells. Oncogene 2001;20:5118–23.[CrossRef][Medline]
  39. Kim H, You S, Farris J, Foster LK, Foster DN. Post-transcriptional inactivation of p53 in immortalized murine embryo fibroblast cells. Oncogene 2001;20:3306–10.[CrossRef][Medline]
  40. Abdelmohsen K, Pullmann R, Jr., Lal A, et al. Phosphorylation of HuR by Chk2 regulates SIRT1 expression. Mol Cell 2007;25:543–57.[CrossRef][Medline]
  41. Lal A, Kawai T, Yang X, Mazan-Mamczarz K, Gorospe M. Antiapoptotic function of RNA-binding protein HuR effected through prothymosin {alpha}. EMBO J 2005;24:1852–62.[CrossRef][Medline]
  42. Lal A, Mazan-Mamczarz K, Kawai T, Yang X, Martindale JL, Gorospe M. Concurrent versus individual binding of HuR and AUF1 to common labile target mRNAs. EMBO J 2004;23:3092–102.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, J.
Right arrow Articles by Guo, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, J.
Right arrow Articles by Guo, Y.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online