Cancer Research Grants  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 68, 4783, June 15, 2008. doi: 10.1158/0008-5472.CAN-07-6483
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carew, J. S.
Right arrow Articles by Cleveland, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carew, J. S.
Right arrow Articles by Cleveland, J. L.

Experimental Therapeutics, Molecular Targets, and Chemical Biology

The Novel Polyamine Analogue CGC-11093 Enhances the Antimyeloma Activity of Bortezomib

Jennifer S. Carew1,8, Steffan T. Nawrocki2,8, Venudhar K. Reddy4, Dorothy Bush3, Jerold E. Rehg3, Andrew Goodwin5, Janet A. Houghton2,9, Robert A. Casero, Jr5, Laurence J. Marton6 and John L. Cleveland1,7

Departments of 1 Biochemistry, 2 Oncology, and 3 Pathology, St. Jude Children's Research Hospital, Memphis, Tennessee; 4 Medigen Biosciences, Madison, Wisconsin; 5 Department of Oncology, The Johns Hopkins University School of Medicine, Baltimore, Maryland; 6 Progen Pharmaceuticals, Inc., Redwood City, California; 7 Department of Cancer Biology, The Scripps Research Institute, Jupiter, Florida; 8 The Cancer Therapy and Research Center Institute for Drug Development, San Antonio, Texas; and 9 The Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, Ohio

Requests for reprints: John L. Cleveland, Department of Cancer Biology, The Scripps Research Institute, Scripps-Florida, 5353 Parkside Drive, RE-1, Jupiter, FL 33458. Phone: 561-799-8775; Fax: 561-799-8957; E-mail: jcleve{at}scripps.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Multiple myeloma (MM) is an incurable plasma cell malignancy. The recent successes of the proteasome inhibitor bortezomib in MM therapy have prompted investigations of its efficacy in combination with other anticancer agents. Polyamines play important roles in regulating tumor cell proliferation and angiogenesis and represent an important therapeutic target. CGC-11093 is a novel polyamine analogue that has completed a phase I clinical trial for the treatment of cancer. Here, we report that CGC-11093 selectively augments the in vitro and in vivo antimyeloma activity of bortezomib. Specifically, the combination of CGC-11093 and bortezomib compromised MM viability and clonogenic survival, and increased drug-induced apoptosis over that achieved by either single agent. Xenografts of MM tumors treated with this combination had marked increases in phospho-c-Jun-NH2-kinase (JNK)-positive cells and apoptosis, and corresponding reductions in tumor burden, tumor vasculature, and the expression of proliferating cell nuclear antigen and the proangiogenic cytokine vascular endothelial growth factor. Furthermore, inhibition of JNK with a pharmacologic inhibitor or by selective knockdown blunted the efficacy of CGC-11093 and bortezomib. Therefore, CGC-11093 enhances the anticancer activity of bortezomib by augmenting JNK-mediated apoptosis and blocking angiogenesis. These findings support the study of the use of the combination of bortezomib and CGC-11093 in MM patients that fail to respond to frontline therapy. [Cancer Res 2008;68(12):4783–90]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
The polyamines putrescine, spermidine, and spermine are small-chained, cationic molecules present in all organisms that play essential roles in many biological processes, including cell proliferation and angiogenesis. Polyamine homeostasis is frequently disrupted during malignant transformation, and this augments intracellular polyamine levels. Precisely how this response occurs is not resolved, but it often involves increased expression or activity of polyamine biosynthetic enzymes and suppression of catabolic enzymes in the pathway. Augmented polyamine levels in cancer has served as a longstanding platform for the design of targeted agents for the prevention and treatment of cancer (1, 2). Indeed, agents such as difluoromethylornithine (DFMO), a suicide inhibitor of ornithine decarboxylase (ODC), a rate-limiting enzyme in polyamine biosynthesis, have shown potent in vivo chemopreventative activity (3). However, DFMO, with one exception, has failed to show anticancer activity in clinical trials, and this is likely due to marked increases in polyamine transport by malignant cells (4, 5). Several polyamine analogues have been generated that can modulate the biosynthetic or catabolic enzymes of the pathway, and those that induce polyamine catabolism can generate hydrogen peroxide and aminoaldehyde byproducts that are toxic to the tumor cell (610). However, some polyamine analogues can have significant anticancer effects without affecting polyamine catabolism.

Multiple myeloma (MM) remains an incurable plasma cell malignancy, and this has spurred tremendous efforts toward developing novel therapeutic strategies to improve outcome. The proteasome inhibitor bortezomib (Velcade) has made great strides in the clinic in treatment of MM and earned fast-track Food and Drug Administration approval in 2003 (1113). Based on this success, novel combination therapies with bortezomib are being tested for efficacy and for their potential in circumventing drug resistance in MM. CGC-11093 is a novel polyamine analogue that has completed a phase I trial for the treatment of cancer (14, 15). Given the important role of polyamines in pathways targeted by the mechanism of action of bortezomib, we hypothesized that CGC-11093 may enhance its therapeutic efficacy. Here, we report that in cell line and xenograft models of MM, CGC-11093 increases the antiangiogenic properties of bortezomib and augments bortezomib-mediated apoptosis via a c-Jun-NH2-kinase (JNK)-dependent mechanism. This study provides a basis for the further evaluation of this combination in the clinical setting for chemorefractory MM.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Cells and cell culture. NCI-H929 and U266 human MM cells, and H157 and A549 human lung cancer cells (from American Type Culture Collection) were maintained in RPMI 1640 with 10% fetal bovine serum at 37°C with 5% CO2 as previously described (7, 1618). Primary human peripheral blood mononuclear cells (PBMC) were obtained from healthy individuals after informed consent.

Drugs. CGC-11093 was provided by Cellgate, Inc. Bortezomib was purchased from the St. Jude Children's Research Hospital Pharmacy. The JNK inhibitor SP600125 was obtained from EMD Biosciences. N1, N11-bis(ethyl)norspermine (DENSPM) was obtained from Genzyme.

Quantifying drug-induced cytotoxicity. Drug-related effects on cell viability were assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay as described (16). Proapoptotic effects of in vitro drug exposure were quantified by propidium iodide/fluorescence-activated cell sorting (PI/FACS) analysis of sub–G0-G1 DNA content as described (16, 19).

Colony assays. Cells were treated for 24 h with the indicated concentrations of bortezomib and CGC-11093. Drug-treated cells were washed twice in PBS and seeded in Methocult methylcellulose medium (Stem Cell Technologies) and incubated for 10 d in a humidified incubator at 37°C with 5% CO2. Colonies were stained with 0.5% 2,3,5-triphenyltetrazolium chloride (Sigma) and were scored manually (20).

Xenograft studies. Logarithmically growing U266 and NCI-H929 MM cells were centrifuged, washed twice in PBS, and counted. Immunodeficient Scid mice (Jackson Labs) were inoculated s.c. with 3 x 107 cells suspended in a 200-µL mixture of 100 µL of HBSS and 100 µL of phenol red–free Matrigel (BD Biosciences). Ten mice bearing tumors from each cell line xenograft were randomized into different treatment groups when tumors became palpable. Tumor-bearing mice were either treated with vehicle (PBS, control) or with therapeutic agents with the following schedule and dose: CGC-11093 at 50 mg/kg once weekly, Bortezomib at 1 mg/kg twice weekly, or the combination of CGC-11093 (50 mg/kg once weekly) and Bortezomib (1 mg/kg twice weekly). Mice were monitored daily throughout the 21-d treatment schedule. All mice were humanely euthanized at the end of the experiment. Tumors were immediately excised from euthanized mice, weighed, measured with digital calipers, and snap-frozen in liquid nitrogen.

Terminal deoxynucleotidyl-transferase–mediated dUTP nick-end assay. Terminal deoxynucleotidyl-transferase–mediated dUTP nick-end assay (TUNEL) was performed to quantify apoptotic cells in xenograft tumor sections using the Dead End kit (Promega) with the assistance of an autostainer (DAKO). The assay was carried out according to the manufacturer's instructions with the following modifications: TBS containing Tween 20 (TBS-T) buffer was used for all washes, DAKO proteinase K was substituted for the proteinase K included in the kit, and endogenous peroxidases were blocked for 5 min with 3% H2O2. Slides were counterstained 3 min with 1:10 dilution of hematoxylin (DAKO), dehydrated, and coverslipped. Apoptotic cells were scored manually under x20 magnification.

Immunohistochemistry. The following reagents were obtained from commercial sources: rat anti-mouse CD34 antibody (PharMingen), mouse anti-human proliferating cell nuclear antigen (PCNA) antibody, ARK biotinylation kit, Target Retrieval buffer, 3,3'-diaminobenzidine (DAB), horseradish peroxidase–conjugated streptavidin (SA-HRP), TBS-T buffer (all from DAKO), and biotinylated rabbit anti-rat antibody (Vector). Slides of 5 to 6 µm sections cut from formalin-fixed paraffin-embedded tissues were deparaffinized in xylene and rehydrated. Heat-induced epitope retrieval in target retrieval buffer was performed in a steamer at >96°C for 30 min. The slides were allowed to cool for 30 min and were placed in TBS-T before assay. Immunohistochemistry assays for PCNA and CD34 were performed at room temperature using a DAKO autostainer. Endogenous peroxidase activity was blocked by incubation with 3% H2O2 for 5 min. Slides were then incubated 30 min with anti-CD34 (6.7 µg/mL) or biotinylated PCNA (0.4 µg/mL). Slides for CD34 were then incubated 30 min with rabbit anti-rat (2.5 µg/mL). All slides were incubated 10 min with SA-HRP (DAKO). CD34 slides were incubated 5 min with DAB. PCNA slides were incubated 10 min with DAB. All slides were counterstained for 3 min with a 1:2 dilution of hematoxylin (DAKO), dehydrated, and coverslipped. Slides were stained manually with antibodies against vascular endothelial growth factor (VEGF), phospho-JNK, and JNK as previously described (2123).

High performance liquid chromatography analyses. Intracellular levels of polyamines present in xenograft tumors were quantified by high performance liquid chromatography (HPLC) analysis of dansylated derivatives as previously described (24).

Immunoblot analyses. Protein extracts were subjected to SDS-PAGE electrophoresis and transferred to nitrocellulose membranes as described previously (16, 19). The antibodies used were as follows: anti–phospho-JNK (Biosource), anti-JNK (Cell Signaling), and anti-actin (Sigma). The anti–phospho-JNK and anti-JNK antibodies detect both JNK1 and JNK2 (23).

RNA interference. A custom siRNA sequence (AGAAUGUCCUACCUUCUUUUU) that simultaneously targets JNK1 and JNK2 and a control siRNA targeting luciferase were both synthesized by Dharmacon. NCI-H929 and U266 cells were transfected with JNK1/2 siRNA or control siRNA with the Nucleofector II device (Amaxa Biosystems) as described (20). After 24 h, cells were treated with bortezomib and CGC-11093 as indicated. Drug-induced apoptosis was quantified by PI/FACS. The efficiency of JNK1/2 knockdown was confirmed by immunoblotting.

Statistical analyses. All analyses were performed with the assistance of GraphPad Prism software version 4.0a (GraphPad Software) as described (16). A P value of <0.05 was considered statistically significant.

Spermidine/spermine N-acetyltransferase and spermine oxidase enzyme assays. NCI-H929 or U266 MM cells, or H157 or A549 lung cancer cells, were treated with DENSPM (10 µmol/L), CGC-11093 (10 µmol/L), bortezomib (2 nmol/L), or CGC-11093 plus bortezomib for 48 h. Cells were harvested, washed in ice-cold PBS, resuspended in buffer containing 5 mmol/L HEPES and 1 mmol/L DTT [for spermidine/spermine N1-acetyltransferase (SSAT) assays] or in buffer containing 0.083 mol/L glycine [pH 8.0; for spermine oxidase (SMO) assays], and frozen at –80°C. Protein concentration was determined by Bradford assays, and SSAT or SMO enzyme assays were performed as described (7, 17, 18).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
CGC-11093 enhances the antimyeloma activity of bortezomib. Manipulating polyamine levels regulates pathways controlling cell proliferation and angiogenesis, which are also modulated by bortezomib (1, 2). Therefore, we hypothesized that the novel polyamine analogue CGC-11093 would augment the anticancer effects of bortezomib. To test this, the human U266 and NCI-H929 MM cells, well-established models of human MM, were treated with 10 µmol/L CGC-11093, 2 nmol/L bortezomib, or the combination of these agents for 48 hours. The cytotoxic effects of drug treatment were determined by MTT assay. In both MM cells, CGC-11093 produced only a modest cytotoxic response compared with bortezomib, which significantly reduced viability, especially of NCI-H929 cells. However, CGC-11093 significantly enhanced the antimyeloma activity of bortezomib in both cell lines (Fig. 1A ). Bortezomib is preferentially toxic to malignant cells (19, 25), and to address whether the same property held for this combination, we exposed PBMC from two healthy donors to both agents. Importantly, the cytotoxic effects of both agents were minimal in normal PBMC and significantly less than that observed for MM cells (Fig. 1A); therefore, this combination has a favorable therapeutic index, at least in vitro.


Figure 1
View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. The novel polyamine analogue CGC-11093 selectively enhances the in vitro anticancer activity of bortezomib (BZ). A, CGC-11093 potentiates bortezomib-induced cytotoxicity. NCI-H929 and U266 human MM cells and PBMCs from 2 healthy donors were treated with 2 nmol/L bortezomib, 10 µmol/L CGC-11093, or the combination for 48 h. Drug-induced cytotoxicity was determined by MTT assay. Columns, mean; bars, SE; n = 3; *, P < 0.05. B, CGC-11093 augments bortezomib-induced apoptosis. NCI-H929 and U266 cells were treated with 2 nmol/L bortezomib, 10 µmol/L CGC-11093, or the combination for 48 h. Drug-induced apoptosis was quantified by PI/FACS analyses of sub–G0-G1 cells. Columns, mean; bars, SE; n = 3; *, P < 0.05. C, CGC-11093 and bortezomib cooperate to impair the clonogenic potential of MM cells. NCI-H929 and U266 cells were treated with 2 nmol/L bortezomib, 10 µmol/L CGC-11093, or the combination for 24 h. After drug exposure, cells were washed twice in PBS and plated in Methocult methylcellulose–containing medium. Colonies were scored manually after 10 d. Columns, mean; bars, SE; n = 3; *, P < 0.05.

 
To assess whether the effects of the combination of CGC-11093 and bortezomib were due to the induction of MM cell apoptosis, PI/FACS analyses were performed. In MM cells treated with CGC-11093 and bortezomib, there were significant increases in the percentages of apoptotic cells over that achieved by exposure to either single agent (Fig. 1B). Finally, clonogenic assays were performed to evaluate the prolonged in vitro effects of CGC-11093 and bortezomib on the growth and survival of MM cells. Again, CGC-11093 enhanced the ability of bortezomib to inhibit the clonogenic survival of both NCI-H929 and U266 MM cells (Fig. 1C). Collectively, these data suggest that CGC-11093 enhances the anticancer activity of bortezomib.

CGC-11093 cooperates with bortezomib to reduce tumor burden in MM xenografts. To investigate the potential in vivo benefit of combining CGC-11093 with bortezomib, xenograft studies were performed. NCI-H929 and U266 MM cells were implanted s.c. into the flanks of Scid mice. Tumor-bearing mice were randomized into groups of 10, and treatment was initiated with the following schedule for 21 days: bortezomib at a dose of 1 mg/kg twice weekly, CGC-11093 at a dose of 50 mg/kg once weekly, or both agents for the combination treatment groups. As seen in vitro, CGC-11093 had only modest effects on tumor burden as a single agent but significantly enhanced the efficacy of bortezomib in both xenograft models (Fig. 2A ). However, in vivo the combination of bortezomib and CGC-11093 was considerably more effective against U266 xenografts than NCI-H929 tumors. The reasons for this differential potency in vitro versus in vivo are not clear, but may reflect the more accelerated in vivo growth rate of NCI-H929 tumors versus U266 tumors. Regardless, CGC-11093 augmented the antimyeloma activity of bortezomib in both xenograft models. Further, both agents were very well-tolerated in vivo, where the only significant side effects observed were mild gastrointestinal irregularities (loose stools) and modest losses in body weight (Fig. 2B). These effects have been previously reported in other in vivo investigations with bortezomib in mice, as well as in humans in the clinic (21, 26, 27).


Figure 2
View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Bortezomib and CGC-11093 reduce tumor burden in MM xenografts. A, NCI-H929 and U266 human MM cells were injected s.c. into the flanks of Scid mice. Mice with palpable tumors were randomized into groups of 10 and were treated for 21 d as described in the Materials and Methods. Mice were humanely euthanized at the end of the study, and tumors were excised and weighed. Columns, mean; bars, SD; n = 10 per group; *, P < 0.05. B, bortezomib and CGC-11093 are well-tolerated in vivo. Xenograft studies were carried out as described in the Materials and Methods. Body weight was determined immediately after euthanasia at the end of the study to quantify drug-induced weight loss. Columns, mean; bars, SD; n = 10 per group. C, effects of bortezomib and CGC-11093 on polyamine pools in MM tumors. Tumor tissue was snap frozen in liquid nitrogen immediately after euthanasia. Tissue was processed and HPLC analyses were performed to determine the intratumoral levels of spermidine, spermine, and putrescine. Columns, mean; bars, SE; n = 3; *, P < 0.05.

 
Bortezomib and CGC-11093 disrupt polyamine homeostasis in vivo. Polyamines play key roles in controlling tumor cell proliferation, angiogenesis, and other signaling cascades (1, 2). Considering this, interfering with polyamine function is a highly attractive strategy for cancer therapy. To assess the effects of CGC-11093 and/or bortezomib on polyamine pools, HPLC analyses (24) of putrescine, spermidine, and spermine pools were performed on the tumor tissue from NCI-H929 and U266 xenografts. CGC-11093 and bortezomib treatment caused modest reductions in the levels of all three polyamines in NCI-H929 tumors. In contrast, both agents stimulated significant reductions in polyamine pools in U266 tumors, which are more sensitive to these agents in vivo. Interestingly, bortezomib treatment led to more dramatic reductions in polyamine pools than CGC-11093 in U266 xenografts, and the combination of these agents resulted in lower levels of each individual polyamine than that achieved by either single agent (Fig. 2C).

Polyamine analogues can often induce two key catabolic enzymes of the polyamine pathway, SSAT or SMO (7, 17, 18). Given the effects of the CGC-11093 plus bortezomib combination treatment on polyamine pools, we evaluated whether CGC-11093, bortezomib, or CGC-11093 plus bortezomib treatment of U266 or NCI-H929 MM cells affected the activity of SSAT or SMO. As controls, the effects of the well-characterized polyamine analogue DENSPM on the activity of SSAT and SMO in H157 and A549 cells lung cancer cells (7, 17, 18) were assessed in parallel, respectively. As expected, DENSPM led to marked induction in SSAT and SMO enzyme activity in lung cancer cells (Supplementary Fig. S1). By contrast, there was little to no effect of CGC-11093 on the activity or expression of either SSAT or SMO in U266 or NCI-H929 MM cells, and bortezomib or bortezomib plus CGC-11093 also had no effect on their activity or expression (Supplementary Fig. S1; data not shown). Therefore, polyamine depletion seen in the MM xenografts treated with the bortezomib plus CGC-11093 combination seems independent of the effects of these agents on SSAT or SMO.

CGC-11093 and bortezomib inhibit tumor cell proliferation and provoke apoptosis. Immunohistochemical analyses were then performed to determine the mechanism(s) by which CGC-11093 augmented the anticancer activity of bortezomib. Previous studies have established that bortezomib inhibits the proliferation of malignant cells and induces apoptosis in both tumor and endothelial cells (21, 22). To determine effects of these agents on tumor cell proliferation, paraffin-embedded tumor sections were stained with an anti-PCNA antibody. As expected, bortezomib reduced the percentage of PCNA-positive cells in both NCI-H929 and U266 tumors, whereas CGC-11093 alone only had modest antiproliferative effects. The combination of bortezomib and CGC-11093 further reduced proliferation over that observed in tumors from mice treated with bortezomib alone (Fig. 3A–B ). Similar effects were observed with respect to apoptosis, where bortezomib alone induced significant apoptosis in both NCI-H929 and U266 tumors and CGC-11093 treatment triggered low levels of apoptosis, and where the combination of CGC-11093 and bortezomib augmented apoptosis over either single agent (Fig. 3C–D). Therefore, both antiproliferative and proapoptotic effects contribute to the enhanced in vivo antimyeloma activity exhibited by these agents.


Figure 3
View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. CGC-11093 and bortezomib inhibit proliferation and induce apoptosis in vivo. A, PCNA expression. Tumor sections were stained with an anti-PCNA antibody as described in the Materials and Methods. B, quantification of PCNA-positive cells. Stained tumor sections were scored manually under x20 magnification; *, P < 0.05. C, TUNEL assays were carried out on xenograft tumor sections as detailed in the Materials and Methods. D, quantification of TUNEL-positive cells. Stained tumor sections were scored manually under x20 magnification; *, P < 0.05.

 
Angiogenesis is impaired in CGC-11093/Bortezomib-treated MM. Angiogenesis is essential for the development and progression of both hematologic and solid malignancies, where new vessels deliver oxygen and nutrients to the burgeoning tumor (28). As such, agents that block angiogenesis are highly desired in cancer therapy (29). Suppression of angiogenesis is an important component of the anticancer activity of bortezomib and is thought to largely occur via inhibition of nuclear factor-{kappa}B, which induces the expression of many proangiogenic factors, including VEGF (21, 22). Interestingly, several studies have reported that polyamines are essential for angiogenesis (3033), and we thus tested if CGC-11093 augmented the antivascular effects of bortezomib. To assess this, we quantified two variables of angiogenesis: intratumoral vasculature, as determined by CD34 expression, and VEGF expression. As expected, bortezomib reduced the size and number of vessels in both NCI-H929 and U266 tumors. Tumors from mice treated with CGC-11093 also displayed a marked decrease in vessel size, yet only had a modest reduction in overall vessel counts. Notably, the bortezomib/CGC-11093 combination further reduced vessel size and density over that achieved with either single agent (Fig. 4A–B ).


Figure 4
View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Bortezomib and CGC-11093 cooperate to impair tumor angiogenesis. A, CD34 immunohistochemistry. Tumors were stained with an anti-CD34 antibody as described in the Materials and Methods. B, quantification of mean vessel density. Vessels were counted manually under x20 magnification after CD34 staining; *, P < 0.05. C, VEGF expression. Tumor sections were stained with an anti-VEGF antibody as previously described (21, 22). D, quantification of VEGF expression in MM xenograft tumors. The relative intensity (rel. intensity) of VEGF expression was quantified with the assistance of ImageJ software; *, P < 0.05.

 
The effects of the bortezomib/CGC-11093 combination on vessel number and density could be due to effects on the expression of angiogenic cytokines. We therefore assessed the effects of this combination regimen on the expression of VEGF in xenograft tumors derived from both MM cell lines. Tumors from mice treated with CGC-11093 exhibited a modest reduction in VEGF content. In agreement with the findings of others (21, 22, 34), bortezomib treatment significantly reduced tumor VEGF expression. Again, the bortezomib/CGC-11093 combination further decreased VEGF levels over that achieved by single agent treatments (Fig. 4C–D). The ability of these agents to target two different aspects of angiogenesis, neovascularization and VEGF production, thus effectively cancels this important neoplastic process.

Bortezomib and CGC-11093 stimulate JNK activity in vivo. We and others have shown that JNK activation plays critical roles in mediating bortezomib-induced apoptosis (23, 3538). Because disruption of polyamine homeostasis augments JNK activity (3941), we hypothesized that JNK would also mediate the combination effects of bortezomib and CGC-11093. To test if CGC-11093 modulated bortezomib-stimulated JNK activity in vivo, immunohistochemistry was performed with antibodies that detect both phospho-JNK1 and phospho-JNK2 (active JNK) or total JNK1/2 in tumor tissue from NCI-H929 and U266 xenografts. Total JNK1/2 levels in NCI-H929 and U266 tumors were not affected by treatment with bortezomib and/or CGC-11093. In contrast, phospho-JNK1/2 was modestly increased in CGC-11093–treated tumors, was augmented 2.5- to 3-fold in bortezomib-treated xenografts, and was induced ~3.5-fold in bortezomib/CGC-11093–treated MM tumors (Fig. 5A–B ). Therefore, increased JNK1/2 phosphorylation is associated with the proapoptotic effects of the bortezomib/CGC-11093 combination treatment.


Figure 5
View larger version (87K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. CGC-11093 augments bortezomib-induced JNK1/2 phosphorylation. A, phospho- and total JNK immunohistochemistry on MM xenograft tumor sections was carried out as previously described (23). The antibodies used detect both JNK1 and JNK2 (23). B, quantification of phospho-JNK1/2 expression in MM xenograft tumors. The relative intensity of phospho-JNK1/2 expression was quantified using ImageJ software; *, P < 0.05.

 
JNK contributes to the proapoptotic effects of bortezomib and CGC-11093 in MM cells. Our xenograft studies showed that CGC-11093 augments bortezomib-induced JNK activity in vivo. As expected, in vitro treatment of NCI-H929 and U266 MM cells with CGC-11093 also led to weak phosphorylation of JNK1/2, and this response was more robust in bortezomib-treated cells, and was greatly augmented by the bortezomib/CGC-11093 combination treatment (Fig. 6A ). To assess whether JNK contributed to cell death induced by these agents, we first tested if the pan-JNK inhibitor SP600125 impaired bortezomib/CGC-11093–induced apoptosis. Indeed, SP600125 suppressed bortezomib- and bortezomib/CGC-11093–induced apoptosis of NCI-H929 cells (Fig. 6B). Bortezomib activates both JNK1 and JNK2, and we therefore tested whether simultaneously knockdown of JNK1 and JNK2 using a siRNA that targets a homologous region present in both kinases affected the apoptotic response (Fig. 6C). NCI-H929 cells were treated with bortezomib, CGC-11093, or the bortezomib/CGC-11093 combination after transfection with a nontargeted control siRNA or JNK1/2 siRNA, and PI/FACS was used to quantify the apoptosis. Knockdown of JNK1/2 expression dramatically reduced the ability of bortezomib and bortezomib/CGC-11093 to stimulate apoptosis in MM cells (Fig. 6D). Thus, bortezomib/CGC-11093 promotes JNK activation in vitro and in vivo, and JNK plays a critical role in their ability to induce MM cell apoptosis.


Figure 6
View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. JNK contributes to bortezomib/CGC-11093–induced apoptosis. A, CGC-11093 augments bortezomib-induced JNK1/2 phosphorylation in NCI-H929 and U266 MM cells in vitro. Immunoblotting with antibodies that detect both JNK1 and JNK2 (23) was used to detect the expression levels of phospho- and total JNK1/2 as described in the Materials and Methods. B, the pan-JNK inhibitor SP600125 significantly impairs bortezomib/CGC-11093–induced apoptosis. NCI-H929 cells were treated with 2 nmol/L bortezomib, 10 µmol/L CGC-11093, or the combination in the presence and absence of 25 µmol/L SP600125 for 48 h. Drug-induced apoptosis was quantified by PI/FACS; n = 3; *, P < 0.05. C, knockdown of JNK1/2 with siRNA. A dual-targeting siRNA sequence was used to simultaneously knockdown JNK1 and JNK2 expression in NCI-H929 and U266 cells as described in the Materials and Methods. Immunoblotting confirmed efficient knockdown of JNK1 and JNK2. D, knockdown of JNK1/2 compromises bortezomib/CGC-11093–induced apoptosis. NCI-H929 and U266 cells were transfected with JNK1/2 siRNA or nontargeted control siRNA as described in the Materials and Methods. Transfected cells were treated with 2 nmol/L bortezomib, 10 µmol/L CGC-11093, or the combination for 48 h. Drug-induced apoptosis was quantified by PI/FACS; n = 3; *, P < 0.05; con, control.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
MM has long been considered an incurable malignancy with an extremely poor clinical prognosis. Concerted efforts in the field of MM therapy over the last decade are now, however, changing outcome. In particular, the proteasome inhibitor bortezomib (Velcade) has made a major mark in MM treatment (1113). Bortezomib has also showed promising preclinical and clinical activity in a number of other cancer models (19, 21, 4244), and its success is likely linked to its multifaceted mechanisms of action, where it inhibits tumor cell proliferation and angiogenesis, stimulates the death of malignant and endothelial cells, and disrupts several prosurvival signaling cascades. The utility of bortezomib is further enhanced by the virtue that it can be effectively combined with other classes of anticancer agents, including histone deacetylase inhibitors, death ligands such as TRAIL, topoisomerase inhibitors, alkylating agents, and several others (19, 22, 23, 42, 44, 45).

Dysregulation of the polyamine pathway has been known for several decades to be involved in transformation and malignant progression. DFMO was developed as a suicide inhibitor of a rate-limiting enzyme in polyamine biosynthesis (ODC) as a cancer therapeutic. However, DFMO largely failed in this arena, due to the ability of malignant cells to maintain polyamines by increasing polyamine uptake from the microenvironment (1, 2). However, lessons learned from the DFMO experience have been used to generate novel agents targeting the polyamine pathway (2). Theoretically, such agents should effectively lower intracellular polyamine levels, but these can also be active even without affecting the pools of endogenous natural polyamines. CGC-11093 is a member of this latter class of novel polyamine analogues and has completed a phase I clinical trial for cancer therapy.

Based on the regulatory role of polyamines in pathways and processes that are targeted by bortezomib, we hypothesized that CGC-11093 would enhance the anticancer activity of bortezomib. In support of this notion, our in vitro assays showed efficacy of this combination in impairing the clonogenic potential of MM cells, and that this was due to the ability of CGC-11093 to augment bortezomib-induced apoptosis. Finally, the ability of CGC-11093 to augment the antimyeloma activity of bortezomib was validated in two different MM xenograft models.

Rather unexpectedly, our analyses showed that bortezomib alone reduced the levels of polyamines in U266 xenograft tumors. Disruption of polyamine homeostasis after bortezomib treatment has not been previously reported. Indeed, bortezomib diminished polyamine pools much more effectively than CGC-11093, an agent that was designed specifically for this purpose. The combined ability of these agents to decrease polyamines in vivo directly correlated with sensitivity, where effects were more pronounced in the U266 xenografts, which responded more dramatically to drug treatment than NCI-H929 tumors. The mechanism(s) by which bortezomib modulates polyamine pools is presently not clear, but this is not associated with the induction of the polyamine catabolic enzymes SSAT or SMO. Similarly, the CGC-11093 polyamine analogue alone does not overtly affect the expression or activity of SSAT or SMO, so its combined effects with bortezomib in decreasing polyamines must occur through other means. Regardless, future studies are warranted to address whether polyamine-related effects represent an important component of the anticancer mechanism of action of bortezomib.

Our xenograft analyses and in vitro studies established that bortezomib and CGC-11093 cooperate to inhibit MM cell proliferation and to induce cell death. Furthermore, CGC-11093 also had moderate antiangiogenic properties alone and augmented this aspect of the mechanism of action of bortezomib. The inhibitory effect of CGC-11093 on such a fundamental process in tumor biology suggests that it may also combine effectively with other classes of anticancer agents. Interestingly, the antiangiogenic effects of CGC-11093 have also been shown in a model of macular degeneration (46). Indeed, CGC-11093 and other structurally related compounds have entered clinical trials as potential therapeutics for this disease.

We focused on the role of JNK as a potential regulator of cell death induced by the CGC-11093/bortezomib combination as we and others have shown that JNK activation contributes to bortezomib-induced apoptosis (23, 3538). Furthermore, polyamines have been reported to control JNK activity (3941), and thus, we hypothesized that CGC-11093 would augment JNK activity stimulated by bortezomib. Indeed, analyses of phospho-JNK expression in xenograft MM tumors revealed that CGC-11093 augmented activation of JNK by bortezomib, and similar effects were also manifest in vitro. Finally, pharmacologic and siRNA-mediated inhibition of JNK significantly impaired bortezomib/CGC-11093–induced apoptosis, establishing that JNK is indeed a critical regulator of the anticancer activity of these agents.

Collectively, these findings show that the CGC-11093 polyamine analogue enhances the antimyeloma activity of bortezomib, and that this occurs by augmenting its ability to inhibit tumor cell proliferation and angiogenesis and to stimulate cell death via a JNK-mediated mechanism. Notably, both agents displayed minimal toxicity to normal human PBMCs in vitro and were well-tolerated in vivo; i.e., there seems to be a therapeutic index for this combination. These findings thus provide a platform for the design of a clinical trial to evaluate the efficacy of CGC-11093 in combination with bortezomib for MM patients that are refractory to conventional agents.


    Disclosure of Potential Conflicts of Interest
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
R.A. Casero: Commerical research support, Cellgate, Inc.; consultant, Cellgate, Inc. L.J. Marton: Employee, Progen Pharmaceuticals; ownership interest, Wisconsin Alumni Research Foundation. The other authors disclosed no potential conflicts of interest.


    Acknowledgments
 
Grant support: NIH grants R01 CA100603 (J. L. Cleveland) and R01 CA98454 and R01 CA51085 (R. A. Casero, Jr.), the Cancer Center support grant CA21765, and by the American Lebanese Syrian Associated Charities of St. Jude Children's Research Hospital.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Chunying Yang, Linda Chung, and Elsie White for excellent technical assistance, and the FACS Core and Animal Resource Core facilities of St. Jude Children's Research Hospital.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 12/ 3/07. Revised 4/ 7/08. Accepted 4/ 8/08.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Gerner EW, Meyskens FL, Jr. Polyamines and cancer: old molecules, new understanding. Nat Rev Cancer 2004;4:781–92.[CrossRef][Medline]
  2. Casero RA, Jr., Marton LJ. Targeting polyamine metabolism and function in cancer and other hyperproliferative diseases. Nat Rev Drug Discov 2007;6:373–90.[CrossRef][Medline]
  3. Nilsson JA, Keller UB, Baudino TA, et al. Targeting ornithine decarboxylase in Myc-induced lymphomagenesis prevents tumor formation. Cancer Cell 2005;7:433–44.[CrossRef][Medline]
  4. Horn Y, Schechter PJ, Marton LJ. Phase I-II clinical trial with {alpha}-difluoromethylornithine-an inhibitor of polyamine biosynthesis. Eur J Cancer Clin Oncol 1987;23:1103–7.[CrossRef][Medline]
  5. Levin VA, Uhm JH, Jaeckle KA, et al. Phase III randomized study of postradiotherapy chemotherapy with {alpha}-difluoromethylornithine-procarbazine, N-(2-chloroethyl)-N'-cyclohexyl-N-nitrosurea, vincristine (DFMO-PCV) versus PCV for glioblastoma multiforme. Clin Cancer Res 2000;6:3878–84.[Abstract/Free Full Text]
  6. Choi W, Gerner EW, Ramdas L, et al. Combination of 5-fluorouracil and N1,N11-diethylnorspermine markedly activates spermidine/spermine N1-acetyltransferase expression, depletes polyamines, and synergistically induces apoptosis in colon carcinoma cells. J Biol Chem 2005;280:3295–304.[Abstract/Free Full Text]
  7. Devereux W, Wang Y, Stewart TM, et al. Induction of the PAOh1/SMO polyamine oxidase by polyamine analogues in human lung carcinoma cells. Cancer Chemother Pharmacol 2003;52:383–90.[CrossRef][Medline]
  8. Huang Y, Hager ER, Phillips DL, et al. A novel polyamine analog inhibits growth and induces apoptosis in human breast cancer cells. Clin Cancer Res 2003;9:2769–77.[Abstract/Free Full Text]
  9. Frydman B, Bhattacharya S, Sarkar A, et al. Macrocyclic polyamines deplete cellular ATP levels and inhibit cell growth in human prostate cancer cells. J Med Chem 2004;47:1051–9.[CrossRef][Medline]
  10. Loussouarn G, Marton LJ, Nichols CG. Molecular basis of inward rectification: structural features of the blocker defined by extended polyamine analogs. Mol Pharmacol 2005;68:298–304.[Abstract/Free Full Text]
  11. Hideshima T, Chauhan D, Richardson P, Anderson KC. Identification and validation of novel therapeutic targets for multiple myeloma. J Clin Oncol 2005;23:6345–50.[Abstract/Free Full Text]
  12. Ghobrial J, Ghobrial IM, Mitsiades C, et al. Novel therapeutic avenues in myeloma: changing the treatment paradigm. Oncology (Huntingt) 2007;21:785–92; discussion 98–800.[Medline]
  13. Roccaro AM, Hideshima T, Richardson PG, et al. Bortezomib as an antitumor agent. Curr Pharm Biotechnol 2006;7:441–8.[CrossRef][Medline]
  14. Valasinas A, Sarkar A, Reddy V, Marton LJ, Basu HS, Frydman B. Conformationally restricted analogues of 1N,14N-bisethylhomospermine (BE-4–4-4): synthesis and growth inhibitory effects on human prostate cancer cells. J Med Chem 2001;44:390–403.[CrossRef][Medline]
  15. Frydman B, Porter CW, Maxuitenko Y, et al. A novel polyamine analog (SL-11093) inhibits growth of human prostate tumor xenografts in nude mice. Cancer Chemother Pharmacol 2003;51:488–92.[Medline]
  16. Carew JS, Nawrocki ST, Krupnik YV, et al. Targeting endoplasmic reticulum protein transport: a novel strategy to kill malignant B cells and overcome fludarabine resistance in CLL. Blood 2006;107:222–31.[Abstract/Free Full Text]
  17. Wang Y, Devereux W, Woster PM, Stewart TM, Hacker A, Casero RA, Jr. Cloning and characterization of a human polyamine oxidase that is inducible by polyamine analogue exposure. Cancer Res 2001;61:5370–3.[Abstract/Free Full Text]
  18. Casero RA, Jr., Gabrielson EW, Pegg AE. Immunohistochemical staining of human spermidine/spermine N1-acetyltransferase superinduced in response to treatment with antitumor polyamine analogues. Cancer Res 1994;54:3955–8.[Abstract/Free Full Text]
  19. Nawrocki ST, Carew JS, Pino MS, et al. Aggresome disruption: a novel strategy to enhance bortezomib-induced apoptosis in pancreatic cancer cells. Cancer Res 2006;66:3773–81.[Abstract/Free Full Text]
  20. Carew JS, Nawrocki ST, Kahue CN, et al. Targeting autophagy augments the anticancer activity of the histone deacetylase inhibitor SAHA to overcome Bcr-Abl-mediated drug resistance. Blood 2007;110:313–22.[Abstract/Free Full Text]
  21. Nawrocki ST, Bruns CJ, Harbison MT, et al. Effects of the proteasome inhibitor PS-341 on apoptosis and angiogenesis in orthotopic human pancreatic tumor xenografts. Mol Cancer Ther 2002;1:1243–53.[Abstract/Free Full Text]
  22. Nawrocki ST, Sweeney-Gotsch B, Takamori R, McConkey DJ. The proteasome inhibitor bortezomib enhances the activity of docetaxel in orthotopic human pancreatic tumor xenografts. Mol Cancer Ther 2004;3:59–70.[Abstract/Free Full Text]
  23. Nawrocki ST, Carew JS, Pino MS, et al. Bortezomib sensitizes pancreatic cancer cells to endoplasmic reticulum stress-mediated apoptosis. Cancer Res 2005;65:11658–66.[Abstract/Free Full Text]
  24. Mitchell JL, Simkus CL, Thane TK, et al. Antizyme induction mediates feedback limitation of the incorporation of specific polyamine analogues in tissue culture. Biochem J 2004;384:271–9.[CrossRef][Medline]
  25. Hideshima T, Richardson P, Chauhan D, et al. The proteasome inhibitor PS-341 inhibits growth, induces apoptosis, and overcomes drug resistance in human multiple myeloma cells. Cancer Res 2001;61:3071–6.[Abstract/Free Full Text]
  26. Richardson PG, Barlogie B, Berenson J, et al. A phase 2 study of bortezomib in relapsed, refractory myeloma. N Engl J Med 2003;348:2609–17.[Abstract/Free Full Text]
  27. Goy A, Younes A, McLaughlin P, et al. Phase II study of proteasome inhibitor bortezomib in relapsed or refractory B-cell non-Hodgkin's lymphoma. J Clin Oncol 2005;23:667–75.[Abstract/Free Full Text]
  28. Fidler IJ. The pathogenesis of cancer metastasis: the 'seed and soil' hypothesis revisited. Nat Rev Cancer 2003;3:453–8.[CrossRef][Medline]
  29. Shaked Y, Kerbel RS. Antiangiogenic strategies on defense: on the possibility of blocking rebounds by the tumor vasculature after chemotherapy. Cancer Res 2007;67:7055–8.[Abstract/Free Full Text]
  30. Takahashi Y, Mai M, Nishioka K. {alpha}-difluoromethylornithine induces apoptosis as well as anti-angiogenesis in the inhibition of tumor growth and metastasis in a human gastric cancer model. Int J Cancer 2000;85:243–7.[Medline]
  31. Jasnis MA, Klein S, Monte M, Davel L, Sacerdote de Lustig E, Algranati ID. Polyamines prevent DFMO-mediated inhibition of angiogenesis. Cancer Lett 1994;79:39–43.[CrossRef][Medline]
  32. Takigawa M, Enomoto M, Nishida Y, Pan HO, Kinoshita A, Suzuki F. Tumor angiogenesis and polyamines: {alpha}-difluoromethylornithine, an irreversible inhibitor of ornithine decarboxylase, inhibits B16 melanoma-induced angiogenesis in ovo and the proliferation of vascular endothelial cells in vitro. Cancer Res 1990;50:4131–8.[Abstract/Free Full Text]
  33. Takigawa M, Nishida Y, Suzuki F, Kishi J, Yamashita K, Hayakawa T. Induction of angiogenesis in chick yolk-sac membrane by polyamines and its inhibition by tissue inhibitors of metalloproteinases (TIMP and TIMP-2). Biochem Biophys Res Commun 1990;171:1264–71.[CrossRef][Medline]
  34. Roccaro AM, Hideshima T, Raje N, et al. Bortezomib mediates antiangiogenesis in multiple myeloma via direct and indirect effects on endothelial cells. Cancer Res 2006;66:184–91.[Abstract/Free Full Text]
  35. Lauricella M, Emanuele S, D'Anneo A, et al. JNK and AP-1 mediate apoptosis induced by bortezomib in HepG2 cells via FasL/caspase-8 and mitochondria-dependent pathways. Apoptosis 2006;11:607–25.[CrossRef][Medline]
  36. Chauhan D, Li G, Podar K, et al. Targeting mitochondria to overcome conventional and bortezomib/proteasome inhibitor PS-341 resistance in multiple myeloma (MM) cells. Blood 2004;104:2458–66.[Abstract/Free Full Text]
  37. Dai Y, Rahmani M, Grant S. Proteasome inhibitors potentiate leukemic cell apoptosis induced by the cyclin-dependent kinase inhibitor flavopiridol through a SAPK/JNK- and NF-{kappa}B-dependent process. Oncogene 2003;22:7108–22.[CrossRef][Medline]
  38. Hideshima T, Mitsiades C, Akiyama M, et al. Molecular mechanisms mediating antimyeloma activity of proteasome inhibitor PS-341. Blood 2003;101:1530–4.[Abstract/Free Full Text]
  39. Manni A, Washington S, Hu X, et al. Effects of polyamine synthesis inhibitors on primary tumor features and metastatic capacity of human breast cancer cells. Clin Exp Metastasis 2005;22:255–63.[CrossRef][Medline]
  40. Bhattacharya S, Ray RM, Viar MJ, Johnson LR. Polyamines are required for activation of c-Jun NH2-terminal kinase and apoptosis in response to TNF-{alpha} in IEC-6 cells. Am J Physiol Gastrointest Liver Physiol 2003;285:G980–91.[Abstract/Free Full Text]
  41. Ray RM, Zimmerman BJ, McCormack SA, Patel TB, Johnson LR. Polyamine depletion arrests cell cycle and induces inhibitors p21(Waf1/Cip1), p27(Kip1), and p53 in IEC-6 cells. Am J Physiol 1999;276:C684–91.[Medline]
  42. Lashinger LM, Zhu K, Williams SA, Shrader M, Dinney CP, McConkey DJ. Bortezomib abolishes tumor necrosis factor-related apoptosis-inducing ligand resistance via a p21-dependent mechanism in human bladder and prostate cancer cells. Cancer Res 2005;65:4902–8.[Abstract/Free Full Text]
  43. Kane RC, Dagher R, Farrell A, et al. Bortezomib for the treatment of mantle cell lymphoma. Clin Cancer Res 2007;13:5291–4.[Abstract/Free Full Text]
  44. Yu C, Rahmani M, Conrad D, Subler M, Dent P, Grant S. The proteasome inhibitor bortezomib interacts synergistically with histone deacetylase inhibitors to induce apoptosis in Bcr/Abl+ cells sensitive and resistant to STI571. Blood 2003;102:3765–74.[Abstract/Free Full Text]
  45. Campbell RA, Sanchez E, Steinberg JA, et al. Antimyeloma effects of arsenic trioxide are enhanced by melphalan, bortezomib and ascorbic acid. Br J Haematol 2007;138:467–78.[CrossRef][Medline]
  46. Lima e Silva R, Kachi S, Akiyama H, et al. Trans-scleral delivery of polyamine analogs for ocular neovascularization. Exp Eye Res 2006;83:1260–7.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carew, J. S.
Right arrow Articles by Cleveland, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carew, J. S.
Right arrow Articles by Cleveland, J. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online