Cancer Research Cancer Epigenetics  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 68, 4875, June 15, 2008. doi: 10.1158/0008-5472.CAN-07-6061
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yuan, Z.-R.
Right arrow Articles by Shi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yuan, Z.-R.
Right arrow Articles by Shi, Y.

Immunology

Chloramphenicol Induces Abnormal Differentiation and Inhibits Apoptosis in Activated T Cells

Zeng-Rong Yuan and Yufang Shi

Department of Molecular Genetics, Microbiology and Immunology, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway, New Jersey

Requests for reprints: Yufang Shi, Department of Molecular Genetics, Microbiology and Immunology, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, 661 Hoes Lane, Piscataway, NJ 08854. Phone: 732-235-4501; Fax: 732-235-4505; E-mail: shiyu{at}umdnj.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Chloramphenicol is a broad-spectrum antibiotic used for the treatment of many infectious diseases and has become one of the major seafood contaminants. Hematologic disorders such as aplastic anemia and leukemia induced by chloramphenicol are a major concern. However, the mechanism underlying chloramphenicol-induced leukemogenesis is not known. By investigating the effects of chloramphenicol on the activation of mouse T cells stimulated with anti-CD3 antibody or staphylococcal enterotoxin B, we found that chloramphenicol induces the differentiation of activated T cells into lymphoblastic leukemia-like cells, characterized by large cell size, multiploid nuclei, and expression of CD7, a maker for immature T cells and T-cell lymphocytic leukemia, thus phenotypically indicating differentiation toward leukemogenesis. High expression of cyclin B1, but not p53, c-myc, and CDC25A, was detected in chloramphenicol-treated activated T cells, which may relate to abnormal cell differentiation. Chloramphenicol inhibited the activation-induced cell death of mouse and human T-cell receptor–activated T cells by down-regulating the expression of Fas ligand. Our findings show that abnormal cell differentiation and inhibition of apoptosis may contribute to the development of leukemia associated with clinical applications of chloramphenicol. [Cancer Res 2008;68(12):4875–81]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Chloramphenicol is an antibiotic originally isolated from Streptomyces venezuelae in 1947. It has a bactericidal effect on a broad range of bacteria, as well as Rickettsia, Chlamydia, and Mycoplasma. Because chloramphenicol is relatively inexpensive to manufacture, highly effective in combating infections, and able to pass the blood-brain barrier, it is still widely used in developing countries (16). However, because of its potential toxicity to the hematopoietic system, chloramphenicol is only occasionally used in developed countries as a substitutional therapy for some infections caused by Haemophilus influenzae, Streptococcus pneumoniae, Salmonella typhi, and Neisseria species. The major side effects found in patients treated with chloramphenicol include reversible bone marrow depression, aplastic anemia, and leukemia. Epidemiologic studies indicate that 1:30,000 to 1:45,000 patients receiving chloramphenicol treatment go on to develop leukemia. Recently, chloramphenicol has become one of the major contaminants of farmed shrimps and fish, with some products containing excessive chloramphenicol residue, raising new concerns about its toxicity.

Leukemia has been linked to various risk factors, such as heredity status, chronic virus infection, radiation, chemical contaminants, and medications. Based on epidemiologic studies, chloramphenicol has been strongly correlated with leukemogenesis (7). One research group has successfully induced leukemia in chloramphenicol-treated toads (8). However, the molecular mechanism through which chloramphenicol induces leukemogenesis is still unclear. Nevertheless, nitrobenzene is a substituent chemical moiety in chloramphenicol and nitrobenzene is a long known carcinogen. It is possible that the transforming ability is related to the nitrobenzene group of this antibiotic. Pharmacologically, chloramphenicol reversibly binds to the 50S ribosomal subunit and prevents the transfer of amino acids during peptide chain elongation in bacteria. Chloramphenicol also has effects on protein synthesis in rapidly proliferating but not resting mammalian cells. Thus, it is possible that leukemia induced by chloramphenicol may directly change the expression of genes associated with cell cycle and apoptosis.

Much evidence has shown that the development of leukemia is related to gene dysregulation. c-myc is a transcriptional factor for control of cell proliferation, and high expression of c-myc has been found in leukemia (9, 10). p53 is a tumor suppressor gene, and mutations causing p53 dysfunction have been detected in patients with different types of leukemia (1113). Cyclin B1, which plays a critical role in the regulation of cell cycle progression, was recently identified as an oncogene. Overexpression and/or unscheduled expression of cyclin B1 are always detected in the cells from leukemia and other tumors (2, 1419). Accumulating evidence indicates that CDC25A can be oncogenic, and its overexpression is frequently shown in a large number of tumors (2023). Moreover, leukemia is also considered a disorder of dysregulation of apoptosis because alterations in Fas and Fas ligand (FasL) expression have been found in leukemia (24, 25). These data indicate that leukemia is a multiplex disorder resulting from dysfunction in various genes, often combined with environmental causes.

To explore the mechanism by which chloramphenicol induces leukemia development, mouse primary splenocytes were used as a cell model for morphologic and molecular studies in vitro. Mouse primary splenocytes were activated with anti-CD3 in the presence or absence of chloramphenicol for a prolonged time. We found that chloramphenicol promoted abnormal T-cell differentiation and allowed the formation of leukemia-like cells, whereas in cultures without chloramphenicol all cells eventually died and no abnormal cells were found. These cells survived in culture for months. They expressed high levels of cyclin B1 and very low level of FasL. In addition, these abnormal cells also expressed high level of CD7, a hallmark of immature lymphoblastic leukemia. Therefore, this finding for the first time provides direct evidence that chloramphenicol induces leukemogenesis in mammalian T cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Cell culture and stimulators in vitro. Spleens were taken from 6- to 8-week-old BALB/c mice and pulverized between two autoclaved grass slides in RPMI 1640 (Invitrogen), and a single-cell suspension was obtained by passing through a 40-µm-diameter nylon mesh (BD Biosciences). The cells were washed twice in RPMI 1640 and then cultured at 2 x 106 to 5 x 106 per mL density in complete RPMI 1640, containing 10% fetal bovine serum, 10% L-glutamine, penicillin, and streptomycin. Antibody against CD3 (145-2c-11) at 2.5 µg/mL or staphylococcal enterotoxin B (SEB; Sigma-Aldrich) at 5 µg/mL was used to activate T cells in the presence or absence of chloramphenicol at 500 µg/mL for 1 week. The cells were then maintained in complete RPMI 1640 with interlekin-2 (IL-2) at 50 to 100 units/mL for cell survival studies. Cell differentiation and morphologic changes were observed by light microscopy.

Cell staining. For morphologic study, cell smears were prepared by spreading of cultured cells on a glass slide and allowing them to air dry. The Giemsa reagent (Sigma-Aldrich) was used to stain the cells according to the manufacturer's protocol. Cellular morphologic characteristics were examined under light microscopy. For immunofluorescence staining, freshly cultured cells were washed twice in ice-cold staining buffer (1x PBS with 2% fetal bovine serum and 0.01% sodium azide). Cell staining was carried out in the same staining buffer with FITC-conjugated anti-CD3 (eBioscience) and anti-CD7 plus phycoerythrin (PE)-conjugated anti-goat IgG (Santa Cruz Biotechnology) following the supplier's protocols. After washing twice with cold staining buffer, the cells were mounted with ProLong antifade reagent (Molecular Probes) and covered with a glass coverslip. Fluorescence was analyzed under a Nikon fluorescence inverted microscope (Eclipse TE 2000-S, Nikon).

Flow cytometric analysis. Human T-cell lines Jurkat and Jcam (kind gifts of Dr. Gordon Mills, M. D. Anderson Cancer Center, Houston, TX) were activated by ionomycin at 100 nmol/L each in culture medium and mouse T-cell lines A1.1 and IE5 in plates coated with anti-CD3 at 2.5 µg/mL. Different concentrations of chloramphenicol were added with the stimulators as indicated. After incubation at 37°C for overnight, the cells were harvested and washed twice with cold 1x PBS. The cell pellets were then resuspended in propidium iodide staining buffer (1x PBS with 20 µg/mL propidium iodide, 0.2% saponin, and 50 µg/mL RNase) and incubated for 30 min at room temperature. Flow cytometry analysis was carried out with a FACScan (Becton Dickinson). Cell cycle distribution is indicated by DNA content revealed by propidium iodide staining. After gating out cell fragments, the population of sub-G0 phase on the histogram plot represents apoptotic cells. For cell surface marker testing, the mouse cell line IE5 was stimulated with and without anti-CD3 in the presence or absence of chloramphenicol at 500 µg/mL. After incubation at 37°C for 6 h, the cells were harvested and washed twice with cold staining buffer. The FITC-conjugated anti-Fas antibody and PE-conjugated anti-FasL antibodies (BD Biosciences) were used for cell surface staining and analyzed by flow cytometry.

Northern blot. Mouse splenocytes were stimulated with anti-CD3 in the presence or absence of chloramphenicol at 500 µg/mL for 1 week. Total RNA was extracted using TriPure reagent and its protocol (Roche). RNA (20 µg) of each sample was separated on a 1% denaturing formaldehyde agarose gel and then transferred to a nylon membrane (Amersham Biosciences). The membrane was repeatedly hybridized with [32P]dCTP-labeled probes for cyclin B1, p53, c-myc, and CDC25A. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as an internal quantitative control.

Regulatory T-cell population. BALB/c mouse splenocytes were stimulated with anti-CD3 alone (2.5 µg/mL) or plus chloramphenicol (500 µg/mL) in complete RPMI 1640 for 1 week. The population of CD4+CD25+ cells was measured by flow cytometric analysis after staining with FITC-conjugated anti-CD4 and PE-conjugated anti-CD25 (eBioscience). FoxP3 expression in CD4+CD25+ cells was further analyzed by real-time quantitative PCR using SYBR Green PCR Master Mix (Applied Biosystems). The primer sequences were the following: TTCATGCATCAGCTCTCCAC (sense) and CTGGACACCCATTCCAGACT (antisense). GAPDH expression was analyzed simultaneously as an internal quantitative control.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Chloramphenicol promotes abnormal differentiation of leukemic cells. The most suspected transformations induced by chloramphenicol are acute lymphoblastic leukemia and acute myelogenous leukemia, both of which are derived from proliferating cells. Because our preliminary experiments with in vitro culture of mouse splenocytes with chloramphenicol alone did not produce abnormal cells, no matter what concentration of chloramphenicol was used or how long the cultures were maintained, we believe that the effect of chloramphenicol is exerted on proliferating cells. Epidemiologic study of chloramphenicol-induced leukemia has shown that it is always related to a history of bacterial infection. We thus believe that some bacterial superantigens, such as SEB, may work synergistically with chloramphenicol by inducing T-cell proliferation. In these proliferating cells, chloramphenicol may promote abnormal differentiation by altering the expression of some cell cycle–related and apoptosis-related genes. By stimulating mouse splenocyte with anti-CD3 or SEB in the presence or absence of chloramphenicol for 1 week, we found that chloramphenicol at 400 to 600 µg/mL resulted in the appearance in culture of many large cells, which were not present in control cultures activated without chloramphenicol or treated with chloramphenicol alone (Fig. 1A ). These abnormal cells were morphologically similar to leukemic cells, characterized by very large cell size and multiploid nuclei. The same cultured cells were also analyzed for DNA content with propidium iodide staining. The results show that chloramphenicol not only induces additional mitosis, as indicated by the high diploid peak, but also results in many multiploid cells, changes that were identical to those revealed by microscopy (Fig. 1B). Significantly, when we continued to culture the chloramphenicol-treated activated T cells supplemented with IL-2 for up to a month, many large cells continued to survive (Fig. 2A ), whereas all cells activated in the absence of chloramphenicol died off (Fig. 2B). Furthermore, by immunofluorescence staining, we found that all of the surviving cells express CD3 and only the large cells also express CD7, a marker of immature T leukemic cells (Fig. 2C and D). This phenotypic change may represent a differentiation process toward leukemogenesis. Taken together, these results show that chloramphenicol induces abnormal cell differentiation to leukemia-like cells.


Figure 1
View larger version (104K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Chloramphenicol induces abnormal cell differentiation. Mouse splenocytes were cultured for 1 wk in different conditions, as indicated. Cell morphology was observed under light microscopy. A, the presence of chloramphenicol (CAP) in the culture induces many large cells, which were not present in control cultures. B, top, chloramphenicol-stimulated cells were much larger with multiploid nuclei; bottom, flow cytometric analysis shows a significantly right shift in chloramphenicol-treated cells in forward scatter. The phenotype of abnormal large cells is as a leukemia-like cell morphocytologically.

 

Figure 2
View larger version (77K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Chloramphenicol-treated cells express CD3 and CD7 markers and survive longer. Cells were cultured as described in Materials and Methods. Most cells stimulated in the presence of chloramphenicol are still alive and appear healthy after 1 mo (A), whereas cells stimulated with anti-CD3 alone completely died out (B). Among surviving cells in the chloramphenicol cultures, all cells expressed CD3 (C) and only larger cells expressed CD7, an immature T-cell marker (D), as determined by immunofluorescence and flow cytometry.

 
Overexpression of cyclin B causes abnormal cell differentiation. The precise execution of cell cycle events is tightly controlled by concerted activation and inhibition of the expression of various genes and the activities of their products (10, 2628). Dysregulation of critical genes in this process leads to abnormal cell proliferation and differentiation. To understand the mechanism of chloramphenicol-mediated abnormal cell differentiation, we analyzed the expression of several cell cycle–related genes. We found that the expression of cyclin B1 is dramatically increased in cells treated with anti-CD3 and chloramphenicol, whereas the expression of other genes, such as p53, CDC25A, and c-myc, was not significantly altered (Fig. 3 ). Because cyclin B1 regulates the transition in the mitosis phase of the cell cycle, overexpression of cyclin B1 may result in excessive nuclear division and the formation of leukemic cells with multiploid nuclei. It has been shown that treatment of cancer cells with butyrolactone I causes accumulation of cyclin B1 and formation of cells with multiple nuclei (29). Even in plants, when a nondegradable cyclin B1 is expressed, it also causes defective G2-M and increase in cells with multiple nuclei (30).


Figure 3
View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Chloramphenicol induces high cyclin B1 expression. The expression of cyclin B1, p53, c-myc, and CDC25A was analyzed by Northern blotting in splenocytes treated by anti-CD3 antibody in the presence or absence of chloramphenicol. Chloramphenicol significantly induced overexpression of cyclin B1, but not p53, c-myc, and CDC25A. GAPDH served as an internal quantitative control.

 
Chloramphenicol inhibits activation-induced cell death. Activation-induced cell death (AICD) is a key mechanism for maintaining cellular homeostasis during lymphocyte development, immune responses, and tumorigenesis. Although mouse splenocytes at rest do not proliferate, they do exhibit dramatic proliferation potential following stimulation of anti-CD3 or SEB. Previously activated T cells will undergo apoptosis after reactivation. This apoptosis, however, can be significantly inhibited by chloramphenicol in our experiment. We found that activation of chloramphenicol-treated cells displays much less apoptosis than cells treated with anti-CD3 alone (Fig. 4A ). To further confirm this finding as a universal biological phenomenon, different concentrations of chloramphenicol were also applied to inhibit AICD in the human T-cell lines Jurkat and Jcam as well as the mouse T-cell hybridomas A1.1 and IE5. As shown in Fig. 4B and C, chloramphenicol clearly blocked AICD in all four cell lines, although these cells were activated by different stimuli. Our data show that chloramphenicol not only promotes abnormal differentiation of splenocytes into leukemia-like cells but also promotes the survival of these cells by inhibiting apoptosis. We believe that these two properties of chloramphenicol could be key to its leukemia-inducing potential.


Figure 4
View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Chloramphenicol inhibits apoptosis in mouse primary cells and several cell lines. Mouse splenocytes were stimulated by anti-CD3 with graded concentrations of chloramphenicol, as indicated. DNA content was determined by flow cytometric analysis after staining with propidium iodide. The sub-G0 population (M1) represents apoptotic cells. A, chloramphenicol significantly inhibited AICD compared with the cells stimulated with anti-CD3 in the absence of chloramphenicol. Mouse T-cell lines A1.1 and IE5 were stimulated with anti–CD3-coated plates, and human T-cell lines Jurkat and Jcam were stimulated by ionomycin (100 nmol/L). Different concentrations of chloramphenicol were added to the culture, as indicated. Apoptosis was examined by DNA content as in A. B, the inhibition of apoptosis by chloramphenicol correlated well with its concentration. C, the effect of chloramphenicol on AICD in IE5 cells is representative.

 
Chloramphenicol blocks FasL expression induced by T-cell receptor activation. AICD in T cells is mediated by induction of the expression of Fas and FasL and their subsequent interaction. Blocking this interaction with TR6, Fas fusion protein, or monoclonal antibodies against FasL can completely prevent AICD (31). Because chloramphenicol is believed to affect mitochondrial protein synthesis, we examined whether the effect of chloramphenicol on AICD is exerted through an effect on cytochrome c or the Fas pathway. We found that chloramphenicol did not change cytochrome c levels and did not inhibit apoptosis induced by anti-Fas antibody. Because AICD is largely dependent on the Fas-FasL pathway, these results indicate that chloramphenicol inhibits AICD at a step before activation of the Fas receptor. To understand the molecular mechanism by which chloramphenicol inhibits apoptosis, we examined changes in Fas and FasL expression in chloramphenicol-treated cells by immunofluorescence cell staining and flow cytometry. We found that the high expression of FasL stimulated by anti-CD3 antibody is completely inhibited by chloramphenicol. However, chloramphenicol does not seem to affect Fas expression (Fig. 5 ). Therefore, chloramphenicol must inhibit AICD by blocking FasL expression. Our result shows that the molecular mechanism of chloramphenicol-mediated inhibition of apoptosis is by blocking FasL expression.


Figure 5
View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Suppression of FasL expression plays a critical role in apoptosis inhibition by chloramphenicol. IE5 cells were stimulated by anti-CD3 with or without chloramphenicol. The expression of Fas and FasL was detected by immunofluorescence staining and flow cytometry. Anti-CD3 stimulation induced high FasL expression, but the presence of chloramphenicol significantly inhibited its expression.

 
Chloramphenicol promotes a more regulatory T-cell population. Regulatory T cells (Treg) are potent modulators of immune responses (3235). Various studies indicate that Tregs are immunosuppressive. Animals with depleted Tregs spontaneously develop various T-cell–mediated autoimmune diseases (36). Transfusion of Tregs inhibits lethal graft-versus-host disease (GVHD) in bone marrow transplantation (33). Because activation of the T-cell receptor (TCR) can induce T-cell differentiation, including a population of CD4+CD25+ cells, we examined what would occur in the presence of chloramphenicol. We found that splenocytes stimulated with anti-CD3 in the presence of chloramphenicol had significantly more CD4+CD25+ cells (Fig. 6A ). Moreover, expression of the transcription forkhead box P3 factor (FoxP3) was also significantly higher than in the controls (Fig. 6B). Thus, chloramphenicol promotes more Treg differentiation, which may act to suppress possible immune responses against leukemic cells and thus allow the development of leukemia.


Figure 6
View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Chloramphenicol induces the expansion of Tregs. The induction of Tregs from splenocytes of BALB/c mouse was done as described in Materials and Methods. A, CD4+CD25+ cells were detected by flow cytometric analysis following two-color staining. B, FoxP3 expression in CD4+CD25+ cells was evaluated by real-time quantitative PCR. Chloramphenicol was found to favor the outgrowth of the Treg population.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
It has been known for more than 15 years that there is a link between the use of chloramphenicol and the development of leukemia (37, 38). However, the molecular mechanism for leukemogenesis induced by chloramphenicol is largely unknown. Because chloramphenicol is still popularly used as an effective treatment for many bacterial infections in developing countries, or as a substitutional therapy for drug-resistant bacteria in developed countries, a clear understanding of the mechanism of leukemogenesis induced by chloramphenicol would be of benefit to the development of new drugs and to human health worldwide. In addition, the current increase in the use of chloramphenicol in seafood farming and its associated concerns to human health also demand a better understanding of the toxicology of this antibiotic. In this report, we present evidence that chloramphenicol induces leukemia-like cells in activated T cells by promoting abnormal cell differentiation and inhibiting activation-induced apoptosis.

Leukemia is a type of blood cancer characterized by a large number of abnormal or immature cells in the bloodstream. Unlike most blood cells, the malignant cells tend to multiply and live for a longer time, thus leading to accumulation within the body. However, the mechanisms through which most leukemias develop are still not known. It is well known that cancer cells frequently arise in the body but they normally die by suicide through apoptosis or by fratricide through immune recognition before they accumulate in significant numbers. Therefore, leukemia development is closely related to two key events: unrestrained proliferation and enhanced survival. By using mouse splenocytes as an experimental model in vitro, we showed that chloramphenicol combined with mitogenic stimuli significantly induces the formation of leukemia-like cells, characterized by large cell size, multiploid nuclei, and especially the expression of CD7, a marker for immature T cells and T-cell lymphoblastic leukemia.

The cell phenotypic changes are associated with aberrant expression of cyclin B1, which helps control cell mitosis. It has been shown in other cell systems that overexpression of cyclin B1 promotes the transformation of cells with a multiploid nuclei (39, 40), a mechanism very likely also operative in inducing the multiploid cellular phenotype in our experimental system. Another cellular modification required for leukemogenesis is that the malignant cells must escape apoptosis and avoid attack by the immune system. We show that chloramphenicol is also a potent inhibitor of activation-induced apoptosis, which is efficient in primary cells as well as cell lines of human and mouse. This property of chloramphenicol has not been revealed previously and we believe that it plays a critical role in chloramphenicol-induced leukemogenesis by allowing proliferating cells to continuously survive. Furthermore, we showed that the molecular mechanism of chloramphenicol inhibition of apoptosis is through blocking of FasL expression. Therefore, it is likely that the cellular changes associated with chloramphenicol make leukemic-like cells more likely to survive long-term and develop into clinical leukemia.

Chloramphenicol had been a popular antibiotic before realizing that it could cause aplastic anemia. It is now also believed to be a carcinogen based on limited evidence of carcinogenicity from clinical studies in humans. Three case reports have shown the development of leukemia after chloramphenicol therapy. In a case-control study in China, Shu and colleagues (37, 38) found increased risks of childhood leukemia, which correlated with the number of days chloramphenicol was administered. Two case-control studies revealed high, but nonsignificant, increases in the risk of aplastic anemia associated with the use of chloramphenicol (41, 42). However, other studies found no association between the use of chloramphenicol and the development of adult leukemia (43, 44). Interestingly, chloramphenicol also induced leukemia in toads (8). When mice were treated with busulfan and chloramphenicol, they develop transplantable T-cell leukemia, providing clear evidence that chloramphenicol can indeed induce leukemia in T cells (45). Therefore, the evidence of a link between aplastic anemia and leukemia, and the increased risk of leukemia found in some case-control studies supports the conclusion that chloramphenicol exposure is associated with an increased malignancy risk in humans.

Immune surveillance also has an important role in killing malignant cells. Recent studies have shown that T-cell leukemia, such as that induced by human T-cell lymphotrophic virus, possesses a Treg phenotype. Tregs are potent modulators of immune responses (3235). Various studies indicate that Tregs are hyporesponsive and suppressive. Animals with depleted Tregs spontaneously develop variable T-cell–mediated autoimmune diseases (36). Transfusion of Tregs inhibits lethal GVHD in bone marrow transplantation (33). Because activation of the TCR can induce cell differentiation, including populations of CD4+CD25+ cell, we examined what would occur in the presence of chloramphenicol. We found that splenocytes stimulated with anti-CD3 in the presence of chloramphenicol had significantly more CD4+CD25+ cells. Moreover, expression of the transcription forkhead box P3 factor FoxP3 was also significantly higher than in the controls. Thus, chloramphenicol promotes more Treg differentiation, which may act to suppress possible immune responses against leukemic cells.

In conclusion, we have shown a molecular mechanism of chloramphenicol-induced leukemia, resulting from overexpression of cyclin B1 during cell differentiation and down-regulation of FasL expression, thus preventing apoptosis. Disruption of normal immune responses by developing a Treg phenotype may also promote leukemogenesis by down-regulating the immune surveillance mechanisms.


    Disclosure of Potential Conflicts of Interest
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
No potential conflicts of interest were disclosed.


    Acknowledgments
 
Grant support: NIH research grants CA76492 and AI43384.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Arthur Roberts for his critical review of the manuscript; Guangwen Ren for technical support; and Drs. Sidney Pestka, Arnold Rabson, and Jerome Langer for discussions.


    Footnotes
 
Note: Current address for Z-R. Yuan: Department of Cell Biology and Molecular Medicine, New Jersey Medical School, University of Medicine and Dentistry of New Jersey, 185 South Orange Avenue, Newark, NJ 07103.

Received 11/ 2/07. Revised 3/25/08. Accepted 3/27/08.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Pancharoen C, Chongthaleong A, Reinprayoon S, Thisyakorn U. Invasive pneumococcal infection and drug-resistant Streptococcus pneumoniae in Thai children. J Med Assoc Thai 2001;84:1246–50.[Medline]
  2. Seneviratne Rde S, Navasivayam P, Perera S, Wickremasinghe RS. Microbiology of cerebral abscess at the neurosurgical unit of the National Hospital of Sri Lanka. Ceylon Med J 2003;48:14–6.[Medline]
  3. Thabet L, Boutiba I, Kammoun A, et al. [Epidemiologic profile of Haemophilus influenzae infection in Tunisia]. Tunis Med 2002;80:469–72.[Medline]
  4. Sirisanthana V, Puthanakit T, Sirisanthana T. Epidemiologic, clinical and laboratory features of scrub typhus in thirty Thai children. Pediatr Infect Dis J 2003;22:341–5.[CrossRef][Medline]
  5. Duke T, Michael A, Mokela D, Wal T, Reeder J. Chloramphenicol or ceftriaxone, or both, as treatment for meningitis in developing countries? Arch Dis Child 2003;88:536–9.[Abstract/Free Full Text]
  6. Muhe L. Managing pneumonia. Child Health Dialogue 1996;13:3–4.[Medline]
  7. Traversa G, Menniti-Ippolito F, Da Cas R, Mele A, Pulsoni A, Mandelli F. Drug use and acute leukemia. Pharmacoepidemiol Drug Saf 1998;7:113–23.[CrossRef][Medline]
  8. el-Mofty MM, Abdelmeguid NE, Sadek IA, Essawy AE, Aleem EA. Induction of leukaemia in chloramphenicol-treated toads. East Mediterr Health J 2000;6:1026–34.[Medline]
  9. Gomez-Casares MT, Vaque JP, Lemes A, Molero T, Delgado MD, Leon J. C-myc expression in cell lines derived from chronic myeloid leukemia. Haematologica 2004;89:241–3.[Free Full Text]
  10. Handa H, Hegde UP, Kotelnikov VM, et al. Bcl-2 and c-myc expression, cell cycle kinetics and apoptosis during the progression of chronic myelogenous leukemia from diagnosis to blastic phase. Leuk Res 1997;21:479–89.[CrossRef][Medline]
  11. Lens D, De Schouwer PJ, Hamoudi RA, et al. p53 abnormalities in B-cell prolymphocytic leukemia. Blood 1997;89:2015–23.[Abstract/Free Full Text]
  12. Lam V, McPherson JP, Salmena L, et al. p53 gene status and chemosensitivity of childhood acute lymphoblastic leukemia cells to adriamycin. Leuk Res 1999;23:871–80.[CrossRef][Medline]
  13. Leonard DG, Travis LB, Addya K, et al. p53 mutations in leukemia and myelodysplastic syndrome after ovarian cancer. Clin Cancer Res 2002;8:973–85.[Abstract/Free Full Text]
  14. Viallard JF, Lacombe F, Dupouy M, Ferry H, Belloc F, Reiffers J. Different expression profiles of human cyclin B1 in normal PHA-stimulated T lymphocytes and leukemic T cells. Cytometry 2000;39:117–25.[CrossRef][Medline]
  15. Shen M, Feng Y, Gao C, et al. Detection of cyclin b1 expression in G(1)-phase cancer cell lines and cancer tissues by postsorting Western blot analysis. Cancer Res 2004;64:1607–10.[Abstract/Free Full Text]
  16. Yu M, Zhan Q, Finn OJ. Immune recognition of cyclin B1 as a tumor antigen is a result of its overexpression in human tumors that is caused by non-functional p53. Mol Immunol 2002;38:981–7.[CrossRef][Medline]
  17. Shen M, Feng Y, Gao C, Tao D, Gong J. [Unscheduled expression of cyclin B1 in G(1)-phase among cultured and clinical tumor cells]. Zhonghua Zhong Liu Za Zhi 2002;24:215–8.[Medline]
  18. Viallard JF, Lacombe F, Dupouy M, Ferry H, Belloc F, Reiffers J. Flow cytometry study of human cyclin B1 and cyclin E expression in leukemic cell lines: cell cycle kinetics and cell localization. Exp Cell Res 1999;247:208–19.[CrossRef][Medline]
  19. Juan G, Traganos F, James WM, et al. Histone H3 phosphorylation and expression of cyclins A and B1 measured in individual cells during their progression through G2 and mitosis. Cytometry 1998;32:71–7.[CrossRef][Medline]
  20. Gasparotto D, Maestro R, Piccinin S, et al. Overexpression of CDC25A and CDC25B in head and neck cancers. Cancer Res 1997;57:2366–8.[Abstract/Free Full Text]
  21. Wu W, Fan YH, Kemp BL, Walsh G, Mao L. Overexpression of cdc25A and cdc25B is frequent in primary non-small cell lung cancer but is not associated with overexpression of c-myc. Cancer Res 1998;58:4082–5.[Abstract/Free Full Text]
  22. Bernardi R, Liebermann DA, Hoffman B. Cdc25A stability is controlled by the ubiquitin-proteasome pathway during cell cycle progression and terminal differentiation. Oncogene 2000;19:2447–54.[CrossRef][Medline]
  23. Galaktionov K, Chen X, Beach D. Cdc25 cell-cycle phosphatase as a target of c-myc. Nature 1996;382:511–7.[CrossRef][Medline]
  24. Rose MG, Berliner N. T-cell large granular lymphocyte leukemia and related disorders. Oncologist 2004;9:247–58.[Abstract/Free Full Text]
  25. Salih HR, Kiener PA. Alterations in Fas (CD 95/Apo-1) and Fas ligand (CD178) expression in acute promyelocytic leukemia during treatment with ATRA. Leuk Lymphoma 2004;45:55–9.[CrossRef][Medline]
  26. Murray AW. Recycling the cell cycle: cyclins revisited. Cell 2004;116:221–34.[CrossRef][Medline]
  27. Takizawa CG, Morgan DO. Control of mitosis by changes in the subcellular location of cyclin-B1-Cdk1 and Cdc25C. Curr Opin Cell Biol 2000;12:658–65.[CrossRef][Medline]
  28. Uhlmann F. Chromosome cohesion and separation: from men and molecules. Curr Biol 2003;13:R104–14.[CrossRef][Medline]
  29. Suzuki M, Hosaka Y, Matsushima H, Goto T, Kitamura T, Kawabe K. Butyrolactone I induces cyclin B1 and causes G2/M arrest and skipping of mitosis in human prostate cell lines. Cancer Lett 1999;138:121–30.[CrossRef][Medline]
  30. Weingartner M, Criqui MC, Meszaros T, et al. Expression of a nondegradable cyclin B1 affects plant development and leads to endomitosis by inhibiting the formation of a phragmoplast. Plant cell 2004;16:643–57.[Abstract/Free Full Text]
  31. Devadas S, Das J, Liu C, et al. Granzyme B is critical for T cell receptor-induced cell death of type 2 helper T cells. Immunity 2006;25:237–47.[CrossRef][Medline]
  32. Hoffmann P, Ermann J, Edinger M, Fathman CG, Strober S. Donor-type CD4(+)CD25(+) regulatory T cells suppress lethal acute graft-versus-host disease after allogeneic bone marrow transplantation. J Exp Med 2002;196:389–99.[Abstract/Free Full Text]
  33. Ermann J, Hoffmann P, Edinger M, et al. Only the CD62L+ subpopulation of CD4+CD25+ regulatory T cells protects from lethal acute GVHD. Blood 2005;105:2220–6.[Abstract/Free Full Text]
  34. Battaglia M, Stabilini A, Roncarolo MG. Rapamycin selectively expands CD4+CD25+FoxP3+ regulatory T cells. Blood 2005;105:4743–8.[Abstract/Free Full Text]
  35. Hering BJ, Kandaswamy R, Harmon JV, et al. Transplantation of cultured islets from two-layer preserved pancreases in type 1 diabetes with anti-CD3 antibody. Am J Transplant 2004;4:390–401.[CrossRef][Medline]
  36. Shevach EM. CD4+ CD25+ suppressor T cells: more questions than answers. Nat Rev Immunol 2002;2:389–400.[Medline]
  37. Shu XO, Gao YT, Linet MS, et al. Chloramphenicol use and childhood leukaemia in Shanghai. Lancet 1987;2:934–7.[Medline]
  38. Shu XO, Gao YT, Brinton LA, et al. A population-based case-control study of childhood leukemia in Shanghai. Cancer 1988;62:635–44.[CrossRef][Medline]
  39. Cho NH, Kang S, Hong S, et al. Multinucleation of koilocytes is in fact multilobation and is related to aberration of the G2 checkpoint. J Clin Pathol 2005;58:576–82.[Abstract/Free Full Text]
  40. Plesca D, Crosby ME, Gupta D, Almasan A. E2F4 function in G2: maintaining G2-arrest to prevent mitotic entry with damaged DNA. Cell Cycle 2007;6:1147–52.[Medline]
  41. Jimenez JJ, Jimenez JG, Daghistani D, Yunis AA. Interaction of chloramphenicol and metabolites with colony stimulating factors: possible role in chloramphenicol-induced bone marrow injury. Am J Med Sci 1990;300:350–3.[Medline]
  42. Issaragrisil S, Kaufman DW, Anderson T, et al. Low drug attributability of aplastic anemia in Thailand. The Aplastic Anemia Study Group. Blood 1997;89:4034–9.[Abstract/Free Full Text]
  43. Doody MM, Linet MS, Glass AG, et al. Risks of non-Hodgkin's lymphoma, multiple myeloma, and leukemia associated with common medications. Epidemiology 1996;7:131–9.[Medline]
  44. Zheng W, Linet MS, Shu XO, Pan RP, Gao YT, Fraumeni JF, Jr. Prior medical conditions and the risk of adult leukemia in Shanghai, People's Republic of China. Cancer Causes Control 1993;4:361–8.[CrossRef][Medline]
  45. Bhoopalam N, Price K, Norgello H, Barone-Varelas J, Fried W. Busulfan and chloramphenicol induced T cell lymphoma: cell surface characteristics and functional properties. Clin Exp Immunol 1986;64:646–55.[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yuan, Z.-R.
Right arrow Articles by Shi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yuan, Z.-R.
Right arrow Articles by Shi, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online