
Cancer Research 68, 5363, July 1, 2008. doi: 10.1158/0008-5472.CAN-08-0035
© 2008 American Association for Cancer Research
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
Increasing Melanoma Cell Death Using Inhibitors of Protein Disulfide Isomerases to Abrogate Survival Responses to Endoplasmic Reticulum Stress
Penny E. Lovat1,
Marco Corazzari3,
Jane L. Armstrong2,
Shaun Martin1,
Vittoria Pagliarini3,
David Hill1,
Anna M. Brown1,
Mauro Piacentini3,4,
Mark A. Birch-Machin1 and
Christopher P.F. Redfern2
1 Dermatological Sciences, School of Clinical and Laboratory Sciences and 2 Northern Institute for Cancer Research, Newcastle University, Newcastle upon Tyne, United Kingdom; 3 L'Spallanzani, National Institute for Infectious Disease; and 4 University of Tor Vergata, Rome, Italy
Requests for reprints: Christopher Redfern, Northern Institute for Cancer Research, Newcastle University, Paul O'Gorman Building, Framlington Place, Newcastle upon Tyne NE2 4HH, United Kingdom. Phone: 44-191-246-4416; Fax: 44-191-246-4301; E-mail: chris.redfern{at}ncl.ac.uk.
 |
Abstract
|
|---|
Exploiting vulnerabilities in the intracellular signaling pathways of tumor cells is a key strategy for the development of new drugs. The activation of cellular stress responses mediated by the endoplasmic reticulum (ER) allows cancer cells to survive outside their normal environment. Many proteins that protect cells against ER stress are active as protein disulfide isomerases (PDI) and the aim of this study was to test the hypothesis that apoptosis in response to ER stress can be increased by inhibiting PDI activity. We show that the novel chemotherapeutic drugs fenretinide and velcade induce ER stress–mediated apoptosis in melanoma cells. Both stress response and apoptosis were enhanced by the PDI inhibitor bacitracin. Overexpression of the main cellular PDI, procollagen-proline, 2-oxoglutarate-4-dioxygenase β subunit (P4HB), resulted in increased PDI activity and abrogated the apoptosis-enhancing effect of bacitracin. In contrast, overexpression of a mutant P4HB lacking PDI activity did not increase cellular PDI activity or block the effects of bacitracin. These results show that inhibition of PDI activity increases apoptosis in response to agents which induce ER stress and suggest that the development of potent, small-molecule PDI inhibitors has significant potential as a powerful tool for enhancing the efficacy of chemotherapy in melanoma. [Cancer Res 2008;68(13):5363–8]
 |
Introduction
|
|---|
Exploiting vulnerabilities in the intracellular signaling pathways of tumor cells is a key strategy for the development of new drugs. Agents that disrupt normal signaling pathways may induce homeostatic responses to restore normal function. The endoplasmic reticulum (ER) is responsible for the regulation of intracellular calcium (Ca2+) and the synthesis of cell surface or secretory proteins. Disruption of ER function induces a stress response characterized by the up-regulation of ER chaperones and a cascade of transcriptional regulation allowing the cell to adapt and focus resources for damage repair. The unfolded protein response is an important ER stress response which rescues the cell by removing unfolded or misfolded proteins (1). However, ER stress will induce apoptotic death if homeostatic mechanisms are insufficient to protect or repair the cell. The ability of ER stress to drive apoptosis could be harnessed to increase the effectiveness of cancer treatment if homeostatic responses can be attenuated with appropriate drugs. Recent studies in which elements of the ER stress response have been down-regulated or blocked have shown that this can shift the balance towards apoptosis in cells treated with ER stress–inducing agents (2, 3).
Cancer cell types differ in their susceptibility to chemotherapy, and malignant melanoma, one of the most difficult cancers to treat, is largely unresponsive to conventional chemotherapy, resulting in low 5-year survival rates (4). Melanoma cells have extensive repertoires of molecular defenses against immunologic and cytotoxic attack (5), resulting in defective apoptotic signaling. Increased expression of ER stress chaperones can be an early event in tumor initiation (6), and targeting the ER stress responses of melanoma cells is a novel therapeutic approach (7). Many ER stress–response chaperones have protein disulfide isomerase (PDI) activity or PDI-like domains (8, 9), and blocking this activity may be a way to attenuate ER stress responses and tip the balance towards apoptosis in stressed cells. The aim of the present study was to test the hypothesis that apoptosis in response to ER stress can be increased using a PDI inhibitor to attenuate homeostatic mechanisms.
 |
Materials and Methods
|
|---|
Cell culture, transfection, and measurement of apoptosis. Melanoma cell lines CHL-1, A375, and WM266-4, obtained from the American Type Culture Collection, were cultured as described previously (3). Melanocytes were obtained from human foreskin keratinocytes (10) by selective trypsinization, confirmed by immunostaining for the melanocyte differentiation antigen Melan-A (antibody from Abcam), and cultured in medium 254 supplemented with human melanocyte growth supplement-2 as described by the manufacturers (Invitrogen). For the overexpression of PDI, plasmids containing constructs for a wild-type and an inactive mutant procollagen-proline, 2-oxoglutarate-4-dioxygenase β subunit (P4HB), the main cellular PDI, were generous gifts from Ou and Silver (11). The transient transfection of 3 µg of wild-type P4HB, mutant P4HB, or pCMVSport-β-galactosidase (Invitrogen) as an unrelated control construct was done using Lipofectamine 2000 (Invitrogen) as previously described (12). Flow cytometry of propidium iodide–stained cells was used to estimate the level of cell death or apoptosis by measuring the percentage of cells in the sub-G1 fraction (3). Cell viability was measured using the MTS assay (CellTiter 96 AQueous Assay; Promega) according to the manufacturer's protocol.
Quantitative PCR. Primers were designed using Primer Express 1.0 software (Applied Biosystems). ATF4 and GADD34 mRNA were quantified relative to the ribosomal protein L34 as an internal control using the comparative Ct method. PCR amplification was performed using a LightCycler with DNA Master SYBER Green I kit (Roche Applied Science) according to the manufacturer's instructions as previously described (3). Primers were GTGGCCAAGCACTTCAAACC and CCCGGAGAAGGCATCCTC for ATF4, ACACCGGGAGTGTTGTCCAG and TGGGCAAGACACCCAAGTG for GADD34, and GTCCCGAACCCCTGGTAATAGA and GGCCCTGCTGACATGTTTCTT for L34.
PCR for XBP-1 splicing. The human XBP-1 sequence was amplified by PCR using the primer pair AAACAGAGTAGCAGCTCAGACTGC and CCTTCTGGGTAGACCTCTGGGAG as previously described (3).
Western blotting. Total protein was extracted from cell pellets, separated by electrophoresis through 4% to 20% SDS-PAGE gels (25 µg per track) and blotted onto polyvinylidene difluoride membranes as previously described (13). Antibodies used to probe the blots were a GADD153 antibody (B-3, Santa Cruz Biotechnology) diluted 1:500, a P4HB antibody from Cell Signaling Technology (New England Biolabs) diluted 1:1,000, and as a loading control, a β-actin antibody (Sigma) diluted 1:5,000. The binding of primary antibodies was detected with secondary peroxidase-conjugated antibodies (Upstate Biotechnology) diluted 1:2,000 and visualized using the enhanced chemiluminescence system (Amersham Biosciences).
PDI activity assay. Assays for PDI activity were carried out according to Smith and colleagues (14) on cell extracts in Tris-HCl buffer containing 25 mmol/L of KCl and 5 mmol/L of MgCl2 (15). Protein extracts were reacted with 80 mmol/L of bovine insulin and PDI activity monitored as increased turbidity at 650 nm; the reaction was linear after 30 min and up to 50 to 80 min, and turbidity at 50 min was used as the end point. Turbidity was linear in proportion to loge 5 to 100 µg bovine liver PDI standard (Sigma) and up to 80 µg of A375 cell–extract protein (data not shown). PDI activity of cell extracts and the bovine liver PDI standard was abolished by heat denaturation (data not shown).
Statistical analysis. For the analysis of synergy or additivity, the CalcuSyn program (Biosoft) was used to derive parameter estimates for the median-effect equation with single drug treatments (fenretinide, velcade, bacitracin) and combination indices (CI) for treatments with bacitracin and fenretinide or velcade. CI values for effective doses at 50% (ED50), 75% (ED75), and 90% (ED90) were calculated. Data for loge relative mRNA levels and PDI activity in cells transfected with P4HB constructs were analyzed by one-way ANOVA with post hoc Dunnett's test and data for apoptosis in cells transfected with mutant or wild-type PDI were analyzed by two-way ANOVA. SPSS v.15.01 (SPSS, Inc.) and Systat v. 10.01 (SPSS Inc.) were used for statistical analysis. For the PDI activity assays, a transformed ordinate scale (OD650 nm raised to the power e) was used for graphical presentation of results because turbidity in this scale was linear with respect to PDI quantity, but statistical analysis was done in the original scale as the variance of these data were independent of the mean.
 |
Results
|
|---|
Induction of ER stress in melanoma cells. Fenretinide, a synthetic derivative of retinoic acid, and the 26S-proteosome inhibitor velcade (bortezomib) both induce apoptosis of melanoma cells by inducing ER stress (3, 16). The induction of ER stress in human melanoma cell lines CHL-1, A375, and WM266-4 (17) in response to fenretinide or velcade at clinically achievable concentrations (18, 19) was confirmed by the marked induction of mRNA for GADD34 (protein phosphatase 1, regulatory subunit 15A) and the stress transcription factor ATF4 (Fig. 1A and B; refs. 1, 3
), and the splicing of XBP-1 mRNA (Fig. 1C). For ATF4 and GADD34 in CHL1 and A375 cells, all treatments were significantly different from control (P < 0.001). For WM266-4 cells, fenretinide, velcade at 6 and 18 h, and thapsigargin significantly induced ATF4 mRNA (P
0.002, P
0.001, and P < 0.001, respectively), but only velcade (6 and 8 h) and thapsigargin significantly induced GADD34 mRNA (P < 0.03 and P < 0.001, respectively) at the drug concentrations used. The A375 and WM266-4 cell lines carry B-Raf mutations (17, 20), resulting in constitutive activation of the Ras/Raf/MEK/ERK pathway and increased resistance to apoptosis (21); these cell lines showed lower inductions of ATF4 and GADD34 than the B-Raf wild-type CHL-1 cells (22) at the drug concentrations used and differed in the time course of responses, particularly with respect to velcade (Fig. 1).

View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 1. Fenretinide- and velcade-induced markers of ER stress in melanoma cells. Induction of (A) ATF4 or (B) GADD34 mRNA as measured by real-time quantitative PCR, relative to the ribosomal protein L34 as an internal control, in CHL-1, A375, and WM266-4 human melanoma cells after 6, 18, or 24 h treatment with 10 µmol/L of fenretinide (FenR), 30 nmol/L of velcade (Vel; obtained from Janssen-Cilag), or 24 h treatment with control vehicle or, as a positive control, 7.5 µmol/L of thapsigargin (Thap). Columns, mean of three replicates + 95% CI. C, induction of XBP-1 splicing in CHL-1, A375, and WM266-4 melanoma cells in response to 6, 18, or 24 h of treatment with fenretinide (FenR; 10 µmol/L for CHL-1 cells and 15 µmol/L for A375 and WM266-4 cells) or velcade (Vel; 15 nmol/L for CHL-1 cells and 30 nmol/L for A375 cells) or in response to 24 h of treatment with 7.5 µmol/L of thapsigargin (Thap). Arrows, positions of the PCR products from the unspliced (U) and spliced (S) XBP-1 transcripts.
|
|
Increasing the consequences of stress using PDI inhibitors. We have previously shown that the small interfering RNA–mediated down-regulation of the ER stress chaperones ERdj5 or ERp57 in A375 cells increases apoptosis induced by fenretinide or velcade (3). Both these proteins have PDI domains (23, 24) and this raises the possibility that the inhibition of PDI activity may also increase apoptosis in response to ER stress. To test this hypothesis, CHL-1, A375, or WM266-4 melanoma cells were treated for 24 h with 10 µmol/L of fenretinide or 30 nmol/L of velcade in the presence or absence of the PDI inhibitor bacitracin, a macrocyclic dodecapeptide antibiotic (25–27); bacitracin was used at a concentration of 500 µmol/L and the response measured with respect to a decrease in cell viability or the induction of apoptosis. Bacitracin on its own did not induce apoptosis or affect cell viability, but significantly increased apoptosis or decreased viability in response to fenretinide or velcade in these melanoma cell lines (Fig. 2A and B
). Increased expression of GADD153 is widely accepted as a marker of apoptosis resulting from ER stress (28). GADD153 was induced in all three melanoma lines in response to velcade and in CHL1 cells in response to fenretinide (Fig. 2C). However, in the presence of bacitracin, GADD153 was induced by fenretinide in all three melanoma cell lines. Furthermore, velcade-induced GADD153, or fenretinide-induced GAD153 in CHL1 cells, was increased in the presence of bacitracin in all cell lines (Fig. 2C).

View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 2. The PDI inhibitor bacitracin increased ER stress–induced apoptosis in melanoma cells. Relative viability (A) or apoptosis (B) of CHL-1, A375, or WM266-4 cells in response to 24 h of treatment with 500 µmol/L of bacitracin (Bac) in the presence or absence of 10 µmol/L of fenretinide (FenR) or 30 nmol/L of velcade (Vel). Control cells were treated with vehicle control for 24 h in each experiment. Columns, mean of eight (viability) or three (apoptosis) replicates + 95% CI. C, Western blots for GADD153 expression in CHL-1, A375, and WM266-4 melanoma cells in response to 8 h (CHL-1 and WM266-4) or 12 h (A375) of treatment with bacitracin (Bac, 500 µmol/L) in the presence or absence of fenretinide (FenR, 10 µmol/L) or velcade (Vel, 33 nmol/L).
|
|
Fixed dose ratio experiments with A375 cells were carried out by combining fenretinide or velcade with the PDI inhibitor bacitracin (29). At a fixed dose ratio of 1:50 for fenretinide with bacitracin, there was an increase in apoptosis with CI ranging from 0.096 at ED50 to 0.002 at ED90, indicating a high degree of synergy (CI < 1; Fig. 3A
; ref. 30). There was also an increase in apoptosis when velcade was combined with bacitracin at a dose ratio of
1:15,000; CI at ED50 and ED75 were 0.833 and 1.076, respectively, indicating additivity (30) but 1.4 at ED90 suggesting some inhibition at high doses. IC50 values for bacitracin with fenretinide or velcade were estimated to be 446 and 256 µmol/L, respectively (Fig. 3A); these are comparable to the reported 500 µmol/L IC50 value for PDI inhibition by bacitracin (29). Similar responses were obtained with respect to cell viability (Fig. 3B). Measurement of PDI activity in A375 cells confirmed that bacitracin was acting as an inhibitor of PDI activity under these conditions (Fig. 3C). Therefore, these results are evidence that inhibition of PDI activity enhances apoptotic responses to ER stress–inducing agents in melanoma cells. To ask if the effect of bacitracin in enhancing apoptosis in response to fenretinide or velcade was specific to melanoma cells, normal human melanocytes were treated with 2 to 5 µmol/L of fenretinide or 7 to 17 nmol/L of velcade in the presence or absence of 100 to 250 µmol/L of bacitracin (dose ratios 1:50 for fenretinide/bacitracin and 1:15,000 for velcade/bacitracin). Under these conditions, there was no evidence for an effect of bacitracin at increasing apoptosis in normal melanocytes (Fig. 3D).

View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 3. Synergistic and additive effects of bacitracin with fenretinide or velcade. A, apoptosis of A375 cells in response to 24 h of treatment with bacitracin (Bac) or fenretinide (FenR) or both agents combined at a fixed dose ratio of 50:1 (left), or in response to bacitracin or velcade or both agents combined at a fixed dose ratio of 15,000:1 (right). Insets in are dose-response curves at 24 h for bacitracin (Sigma) in the presence of fixed concentrations of fenretinide (15 µmol/L) or velcade (33 nmol/L): abscissa, log10 bacitracin dose, ordinate, apoptosis (%). IC50 values were estimated from four-variable sigmoidal curves and were 446 µmol/L for bacitracin with fenretinide and 256 µmol/L for bacitracin with velcade. Points, mean of three replicates ± 95% CI. B, relative viability of A375 cells after 24 h of treatment with bacitracin (Bac) or fenretinide (FenR) or both agents together at a fixed dose ratio of 50:1 (left), or in response to bacitracin or velcade or both agents together at a fixed dose ratio of 15,000:1 (right). Points, mean of eight replicates ± 95% CI. C, PDI activity in A375 cells (cell extract, 40 µg protein) in the presence or absence of 500 µmol/L of bacitracin (Bac); columns, mean ± range of duplicate samples and the ordinate scale is OD650 nm raised to the power e for linearity with PDI quantity. D, apoptosis (mean + 95% CI) in normal human melanocytes in response to 2 or 5 µmol/L of fenretinide, or 7 or 17 nmol/L of velcade, with and without 100 or 250 µmol/L of bacitracin, respectively.
|
|
Bacitracin increases apoptosis by PDI inhibition. Commercial preparations of bacitracin may be contaminated with other activities (31); therefore, in the context of this study, it was important to obtain evidence that bacitracin enhances apoptosis as a result of inhibiting PDI activity. Because many ER stress chaperones also have PDI activity, it is not feasible to test the involvement of PDI inhibition in ER stress abrogation by targeted knockdown of all proteins with PDI activity. However, we predicted that overexpression of a protein with PDI activity would reduce the ability of bacitracin to enhance ER stress–induced apoptosis by competing with endogenous PDI activity for the inhibitor. The main cellular PDI is P4HB, which catalyzes the formation, isomerization, and removal of disulfide bonds (8). Therefore, wild-type P4HB and an inactive mutant with mutations in both active PDI sites (11) were overexpressed in A375 cells by transient transfection, as confirmed by Western blotting using an antibody to P4HB (Fig. 4A
). To verify the activity of the transfected constructs, PDI activity was measured in untransfected A375 cells and A375 cells transfected with an unrelated control construct, wild-type P4HB or the inactive mutant P4HB (one-way ANOVA, F3,11 = 10.85; P = 0.003; Fig. 4B). Transfection with the control construct or the mutant P4HB had no effect on PDI activity relative to untransfected cells (Dunnett's test, P = 0.765 and P = 0.468, respectively), whereas mean PDI activity was significantly increased 3-fold in cells transfected with wild-type P4HB (Dunnett's test, P = 0.008; Fig. 4B).

View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 4. Overexpression of PDI abrogates the enhancement of fenretinide or velcade-induced apoptosis. A, overexpression of PDI in A375 cells: Western blot for P4HB or β-actin (loading control) in control (C) A375 cells or after transient transfection of wild-type (PDI) or mutant (mPDI) P4HB (11) or pCMVSport-β-galactosidase control construct (V). B, PDI activity in A375 cells (cell extract, 80 µg protein) after transient transfection for 24 h with control vector construct (V), wild-type (PDI), or mutant (mPDI) P4HB and expressed as activity relative to mean PDI activity (transformed scale: OD650 nm to the power e) in control, untransfected cells in the same experiment. Columns, mean fold induction ± upper 95% confidence limit. *, P < 0.01 compared with untransfected cells (see text). For these data, statistical analysis was done in the original scale (see text). C, apoptosis of A375 cells in response to transient transfection for 24 h with either control vector construct (white columns), mutant P4HB (gray columns), or wild-type (black columns) P4HB, and subsequent treatment for 24 h with 500 µmol/L of bacitracin (Bac), 10 µmol/L fenretinide (FenR), 30 nmol/L velcade (Vel) or 500 µmol/L of bacitracin combined with 10 µmol/L of fenretinide or 30 nmol/L of velcade. Apoptosis is expressed relative to cells transfected with the control construct without drug treatment; points, mean of three independent experiments; +95% confidence limit. ***, P < 0.00001 for the comparisons marked.
|
|
The effect of transient overexpression of control construct, mutant P4HB or wild-type P4HB on apoptosis of A375 cells in response to fenretinide or velcade in the presence and absence of bacitracin, compared with control construct–transfected and untreated (control) cells is shown in Fig. 4C. Statistical analysis was by two-way ANOVA for transfection plasmid and treatment (bacitracin, fenretinide, velcade, bacitracin + fenretinide, bacitracin + velcade). Both main effects and the interaction terms were significant (Fx,30 > 71, P < 0.00001; x = 2, 4, or 8); hypothesis tests on the effect of transfection plasmid showed no overall difference between the control construct and mutant P4HB (F1,30 = 1.29, P = 0.27), whereas transfection of wild-type P4HB significantly decreased apoptosis compared with the control construct or mutant P4HB (F1,30 > 497, P < 0.00001). For cells treated with either fenretinide or velcade alone, transfection with wild-type P4HB decreased apoptosis compared with the control construct or mutant P4HB, indicative of a protective effect of P4HB with functional PDI activity (hypothesis tests, F1,30 > 10; P < 0.003). The mutant P4HB did not increase apoptosis and therefore was not acting in a dominant-negative manner with respect to endogenous PDI activity. In cells treated with bacitracin and fenretinide, or bacitracin and velcade, levels of apoptosis in control-transfected cells or cells overexpressing mutant P4HB were substantially greater than in cells treated with fenretinide or velcade alone, showing that the expression of these constructs did not reduce the ability of bacitracin to enhance apoptosis in response to these ER stress inducers. Conversely, in cells overexpressing wild-type P4HB, levels of apoptosis in response to bacitracin in combination with either drug were substantially lower and only marginally more than cells treated with fenretinide or velcade alone. These data suggest that overexpression of the wild-type P4HB reduced the availability of bacitracin to inhibit endogenous proteins with PDI activity, thus protecting the cells against ER stress–induced apoptosis.
 |
Discussion
|
|---|
These results show that fenretinide and velcade induce ER stress in melanoma cells, that the antibiotic PDI inhibitor bacitracin increases cell death as a consequence of ER stress and that these effects of bacitracin result from its ability to inhibit PDI activity. Although both fenretinide and velcade induced similar ER stress responses, the mechanism of action of these drugs is very different. Fenretinide induces stress via an oxidative stress mechanism (3), which has, thus far, not been characterized. Conversely, velcade is a specific inhibitor of the 26S-proteasome; however, the central role of the proteasome in most cellular functions gives velcade the ability to inhibit cellular function on a broad scale resulting in ER stress, but with the time course and end result, in terms of cell arrest or apoptosis, varying depending on cell type (32). Cancer cells, particularly melanoma and leukemia, are more sensitive to velcade than normal cells (16, 32, 33). Although leukemia cells are also more sensitive than normal cells to fenretinide (34), this is not true with respect to ovarian cancer/normal ovarian epithelial cells (35), and the normal melanocytes used in this study were relatively sensitive to fenretinide; preliminary data for the normal melanocytes suggested that these cells accumulated fenretinide more readily than melanoma cells,5 and such differences in uptake is one mechanism that could explain cell type–specific variability in fenretinide sensitivity.
Despite the sensitivity of normal melanocytes to fenretinide, bacitracin treatment did not increase the response to fenretinide or to velcade. This is in clear contrast to the melanoma cells in which bacitracin produced a dose-dependent increase in cell death in response to fenretinide or velcade, which was synergistic with fenretinide and additive with velcade across a broad dose-range. Therefore, these results suggest that inhibiting PDI activity may offer a novel mechanism to increase the therapeutic benefit of chemotherapeutic drugs for treating metastatic melanoma, particularly in the context of ER stress–inducing agents. The potential for enhancing the activity of velcade is particularly significant as this drug has good clinical activity in myeloma and is being investigated for use in a range of other cancers (36). Furthermore, velcade has shown promise in combination with existing chemotherapeutic drugs (32) and enhances the responses of melanoma cells to temozolomide in vitro (37). The ability to increase the cancer cell–specific effects of velcade with PDI inhibitors would be a powerful addition to the chemotherapeutic arsenal. However, because the clinical use of bacitracin is limited by its nephrotoxicity (38) and low membrane permeability (31, 39), it is important to develop safer and more effective alternatives. This can only be done with adequate knowledge of how bacitracin achieves its effects. Bacitracin did indeed reduce PDI activity in A375 cells; however, bacitracin can have PDI-independent effects (40), has metal-binding activity, and the commercial product can comprise a mixture of bacitracins differing in amino acid sequence and NH2-terminal structure (27).
In the absence of purified bacitracins and data to link PDI inhibition to specific bacitracins, it is critical to verify that the ability of bacitracin to increase velcade or fenretinide-induced cell death is a result of PDI inhibition. As predicted, overexpression of P4HB in melanoma cells increased PDI activity and substantially reduced the ability of bacitracin to increase apoptosis in combination with either fenretinide or velcade, presumably by competing with endogenous PDIs for binding to the PDI inhibition function of bacitracin. The mutant P4HB used as a negative control for this experiment lacked PDI activity as a result of cysteine to serine mutations in both active PDI sites (11); the fact that this mutant P4HB construct, despite being overexpressed to similar levels as wild-type P4HB, did not abrogate the potentiation of fenretinide- or velcade-induced apoptosis by bacitracin is strong evidence that inhibiting PDI activity reduces the ability of cells to survive ER stress. These results also show the importance of PDI activity in facilitating the survival of cells exposed to ER stress. In melanoma cells, PDIs have been reported to be expressed at a higher level than normal melanocytes (41, 42) and the expression of PDI family proteins correlates with cancer invasion, metastasis, and drug resistance in other tumor types (43–45). Although recent studies indicate that the sensitivity of melanoma cells to tumor necrosis factor–related apoptosis-inducing ligand–induced apoptosis may be increased by modulation of the unfolded protein response (46), the present results suggest that PDI inhibition can be used as a more general mechanism to down-regulate homeostatic stress responses and drive apoptosis.
The results of this study provide proof-of-principle for the concept that ER stress–induced apoptosis of melanoma cells can be enhanced using PDI inhibitors. Furthermore, the data imply that potent, small-molecule PDI inhibitors designed to bind to the CXXC motif of the PDI active site may have significant potential as powerful tools for enhancing the efficacy of chemotherapy in a wide range of cancers.
 |
Disclosure of Potential Conflicts of Interest
|
|---|
C.P.F. Redfern, P.E. Lovat, and M.A. Birch-Machin are coapplicants on a U.K. patent on the concept of combining PDI inhibitors with anticancer drugs. The other authors disclosed no potential conflicts of interest.
 |
Acknowledgments
|
|---|
Grant support: Cancer Research U.K., Newcastle Healthcare Charity, Ricerca Corrente e Finalizzata del Ministero della Salute, COFIN 2007, Associazione Italiana Ricerca sul Cancro, Progeto Europeo Health-F4-2007-200767, and Telethon, Italy.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The authors thank Drs. J. Silver and Wu Ou, National Institute of Allergy and Disease, NIH, for the generous gift of mutant and wild-type P4HB constructs, and Ross Flockhart, Dermatological Sciences, Newcastle University, for immunostaining the melanocytes.
 |
Footnotes
|
|---|
Note: P.E. Lovat, M. Corazzari, and J.L. Armstrong are joint first authors; M. Piacentini, M.A. Birch-Machin, and C.P.F. Redfern are joint senior authors.
5 J.L. Armstrong, unpublished data. 
Received 1/ 4/08.
Revised 3/27/08.
Accepted 4/12/08.
 |
References
|
|---|
- Szegezdi E, Logue SE, Gorman AM, Samali A. Mediators of endoplasmic reticulum stress-induced apoptosis. EMBO Rep 2006;7:880–5.[CrossRef][Medline]
- Rao RV, Ellerby HM, Bredesen DE. Coupling endoplasmic reticulum stress to the cell death program. Cell Death Differ 2004;11:372–80.[CrossRef][Medline]
- Corazzari M, Lovat PE, Armstrong JL, et al. Targeting homeostatic mechanisms of endoplasmic reticulum stress to increase susceptibility of cancer cells to fenretinide-induced apoptosis: the role of stress proteins ERdj5 and ERp57. Br J Cancer 2007;96:1062–71.[CrossRef][Medline]
- Thompson JF, Scolyer RA, Kefford RF. Cutaneous melanoma. Lancet 2005;365:687–701.[Medline]
- Soengas MS, Lowe SW. Apoptosis and melanoma chemoresistance. Oncogene 2003;22:3138–51.[CrossRef][Medline]
- Denoyelle C, Abou-Rjaily G, Bezrookove V, et al. Anti-oncogenic role of the endoplasmic reticulum differentially activated by mutations in the MAPK pathway. Nat Cell Biol 2006;8:1053–63.[CrossRef][Medline]
- Linder S, Shoshan MC. Lysosomes and endoplasmic reticulum: targets for improved, selective anti cancer therapy. Drug Resist Updat 2005;8:199–204.[CrossRef][Medline]
- Noiva R. Protein disulphide isomerase: the multifuntional redox chaperone of the endoplasmic reticulum. Semin Cell Dev Biol 1999;10:481–93.[CrossRef][Medline]
- Puig A, Lyles MM, Noiva R, Gilbert HF. The role of the thiol/disulphide centers and peptide binding site in the chaperone and anti-chaperone activities of protein disulphide isomerase. J Biol Chem 1994;269:19128–35.[Abstract/Free Full Text]
- Todd C, Reynolds NJ. Up-regulation of p21WAF1 by phorbol ester and calcium in human keratinocytes through a protein kinase C-dependent pathway. Am J Pathol 1998;153:39–45.[Abstract/Free Full Text]
- Ou W, Silver J. Role of protein disulphide isomerase and other thiol-reactive proteins in HIV-1 envelope protein-mediated fusion. Virology 2006;350:406–17.[CrossRef][Medline]
- Lovat PE, Di Sano F, Corazzari M, et al. Gangliosides link the acidic sphingomyelinase-mediated induction of ceramide to 12-lipoxygenase-dependent apoptosis of neuroblastoma in response to fenretinide. J Natl Cancer Inst 2004;96:1288–99.[Abstract/Free Full Text]
- Armstrong JL, Veal GJ, Redfern CP, Lovat PE. Role of Noxa in p53-independent fenretinide-induced apoptosis of neuroectodermal tumour cells. Apoptosis 2007;12:613–22.[CrossRef][Medline]
- Smith AM, Chan J, Oksenberg D, et al. A high-throughput turbidometric assay for screening inhibitors of protein disulphide isomerase activity. J Biomol Screening 2004;9:614–20.[Abstract/Free Full Text]
- Lambert N, Freedman RB. The latency of rat liver microsomal protein disulphide-isomerase. Biochem J 1985;228:635–45.[Medline]
- Fernandez Y, Verhaegen M, Miller TP, et al. Differential regulation of noxa in normal melanocytes and melanoma cells by proteasome inhibition: therapeutic implications. Cancer Res 2005;65:6294–304.[Abstract/Free Full Text]
- Davies H, Bignell GR, Cox C, et al. Mutations of the BRAF gene in human cancer. Nature 2002;417:949–53.[CrossRef][Medline]
- Formelli F, Cleris L. Synthetic retinoid fenretinide is effective against a human ovarian carcinoma xenograft and potentiates cisplatin activity. Cancer Res 1993;53:5374–6.[Abstract/Free Full Text]
- Jackson G, Einsele H, Moreau P, Miguel JS. Bortezomib, a novel proteosome inhibitor, in the treatment of hematologic malignancies. Cancer Treat Rev 2005;31:591–602.[CrossRef][Medline]
- Eskandarpour M, Kiaii S, Zhu C, Castro J, Sakko AJ, Hansson J. Suppression of oncogenic NRAS by RNA interference induces apoptosis of human melanoma cells. Int J Cancer 2005;115:65–73.[CrossRef][Medline]
- Gray-Schopfer VC, da Rocha Dias S, Marais R. The role of B-RAF in melanoma. Cancer Met Rev 2005;24:165–83.[CrossRef][Medline]
- Yeh AH, Bohula EA, Macaulay VM. Human melanoma cells expressing V600E B-RAF are susceptible to IGF1R targeting by small interfering RNAs. Oncogene 2006;25:6574–81.[CrossRef][Medline]
- Pirneskoski A, Ruddock LW, Klappa P, Freedman RB, Kivirikko KI, Koivunen P. Domains b' and a' of protein disulfide isomerase fulfill the minimum requirement for function as a subunit of prolyl 4-hydroxylase. The N-terminal domains a and b enhances this function and can be substituted in part by those of ERp57. J Biol Chem 2001;276:11287–93.[Abstract/Free Full Text]
- Cunnea PM, Miranda-Vizuete A, Bertoli G, et al. ERdj5, an endoplasmic reticulum (ER)-resident protein containing DnaJ and thioredoxin domains, is expressed in secretory cells or following ER stress. J Biol Chem 2003;278:1059–66.[Abstract/Free Full Text]
- Mizunaga T, Katakura Y, Miura T, Maruyama Y. Purification and characterization of yeast protein disulfide isomerase. J Biochem 1990;108:846–51.[Abstract/Free Full Text]
- Mandel R, Ryser HJ-P, Ghani F, Wu M, Peak D. Inhibition of a reductive function of the plasma membrane by bacitracin and antibodies against protein disulphide-isomerase. Proc Natl Acad Sci U S A 1993;90:4112–6.[Abstract/Free Full Text]
- Ming L-J, Epperson J. Metal binding and structure-activity relationship of the metalloantibiotic peptide bacitracin. J Inorg Biochem 2002;91:46–58.[CrossRef][Medline]
- Schroder M, Kaufman RJ. ER stress and the unfolded protein response. Mut Res 2005;569:29–63.[Medline]
- Janiszewski M, Lopes LR, Carmo AO, et al. Regulation of NAD(P)H oxidase by associated protein disulphide isomerase in vascular smooth muscle cells. J Biol Chem 2005;280:40813–9.[Abstract/Free Full Text]
- Chou T-C. The median-effect principle and the combination index for quantification of synergism and antagonism. In: Chou T-C, Rideout DC, editors. Synergism and antagonism in chemotherapy. San Diego: Academic Press; 1991. p. 61–102.
- Weston BS, Wahab NA, Roberts T, Mason RM. Bacitracin inhibits fibronectin matrix assembly by mesangial cells in high glucose. Kidney Int 2001;60:1756–64.[CrossRef][Medline]
- McCloskey SM, McMullin MF, Walker B, Irvine AE. The therapeutic potential of the proteasome in leukaemia. Hematol Oncol 2008;26:73–81.
- Pigneux A, Mahon FX, Moreau-Gaudry F, et al. Proteasome inhibition specifically sensitizes leukemic cells to anthracyclin-induced apoptosis through the accumulation of Bim and Bax pro-apoptotic proteins. Cancer Biol Ther 2007;6:603–11.[Medline]
- O'Donnell PH, Guo WX, Reynolds CP, Maurer BJ. N-(4-Hydroxyphenyl)retinamide increases ceramide and is cytotoxic to acute lymphoblastic leukemia cell lines, but not to non-malignant lymphocytes. Leukemia 2002;16:902–10.[CrossRef][Medline]
- Brewer M, Wharton JT, Wang J, et al. In vitro model of normal, immortalized ovarian surface epithelial and ovarian cancer cells for chemoprevention of ovarian cancer. Gynecol Oncol 2005;98:182–92.[CrossRef][Medline]
- Armand JP, Burnett AK, Drach J, Harousseau JL, Lowenberg B, San Miguel J. The emerging role of targeted therapy for hematologic malignancies: update on bortezomib and tipifarnib. Oncologist 2007;12:281–90.[Abstract/Free Full Text]
- Amiri KI, Horton LW, LaFleur BJ, Sosman JA, Richmond A. Augmenting chemosensitivity of maliganant melanoma tumors via proteosome inhibition: implication for Bortexomib (VELCADE, PS-341) as a therapeutic agent for malignant melanoma. Cancer Res 2004;64:4912–8.[Abstract/Free Full Text]
- Wang EJ, Snyder RD, Fielden MR, Smith RJ, Gu YZ. Validation of putative genomic biomarkers of nephrotoxicity in rats. Toxicology 2008;246:91–100.[CrossRef][Medline]
- Godin B, Touitou E. Mechanism of bacitracin permeation enhancement through the skin and cellular membranes from an ethosomal carrier. J Control Release 2004;94:365–79.[CrossRef][Medline]
- Mou Y, Ni H, Wilkins JA. The selective inhibition of β1 and β7 integrin-mediated lymphocyte adhesion by bacitracin. J Immunol 1998;161:6323–9.[Abstract/Free Full Text]
- Clauser KR, Hall SC, Smith DM, et al. Rapid mass spectrometric peptide sequencing and mass matching for characterization of human melanoma proteins isolated by two-dimensional PAGE. Proc Natl Acad Sci U S A 1995;92:5072–6.[Abstract/Free Full Text]
- Carta F, Demuro PP, Zanini C, et al. Analysis of candidate genes through a proteomics-based approach in primary cell lines from malignant melanomas and their metastases. Melanoma Res 2005;15:235–44.[CrossRef][Medline]
- Tager M, Kroning H, Thiel U, Ansorge S. Membrane-bound protein disulfide isomerase (PDI) is involved in regulation of surface expression of thiols and drug sensitivity of B-CLL cells. Exp Hematol 1997;25:601–7.[Medline]
- Goplen D, Wang J, Enger PO, et al. Protein disulphide isomerase expression is related to the invasive properties of malignant glioma. Cancer Res 2006;66:9895–902.[Abstract/Free Full Text]
- Gumireddy K, Sun F, Klein-Szanto AJ, et al. In vivo selection of metastasis promoting genes in the mouse. Proc Natl Acad Sci U S A 2007;104:6696–701.[Abstract/Free Full Text]
- Chen JL, Jiang CC, Kiejda KA, et al. Thapsigargin sensitizes human melanoma cells to TRAIL-induced apoptosis by up-regulation of TRAIL-R2 through the unfolded protein response. Carcinogenesis 2007;28:2328–36.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
V. Gillardin, F. Silvestre, M. Dieu, E. Delaive, M. Raes, J.-P. Thome, and P. Kestemont
Protein Expression Profiling in the African Clawed Frog Xenopus laevis Tadpoles Exposed to the Polychlorinated Biphenyl Mixture Aroclor 1254
Mol. Cell. Proteomics,
April 1, 2009;
8(4):
596 - 611.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. Hill, S. Martin, J. L. Armstrong, R. Flockhart, J. J. Tonison, D. G. Simpson, M. A. Birch-Machin, C. P.F. Redfern, and P. E. Lovat
Combining the Endoplasmic Reticulum Stress-Inducing Agents Bortezomib and Fenretinide as a Novel Therapeutic Strategy for Metastatic Melanoma
Clin. Cancer Res.,
February 15, 2009;
15(4):
1192 - 1198.
[Abstract]
[Full Text]
[PDF]
|
 |
|