Cancer Research 2010 AACR Elections Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Cancer Research 68, 5414, July 1, 2008. doi: 10.1158/0008-5472.CAN-07-5601
© 2008 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meyer zum Büschenfelde, C.
Right arrow Articles by Peschel, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meyer zum Büschenfelde, C.
Right arrow Articles by Peschel, C.

Immunology

GM1 Expression of Non-Hodgkin's Lymphoma Determines Susceptibility to Rituximab Treatment

Christian Meyer zum Büschenfelde, Yvonne Feuerstacke, Katharina S. Götze, Katrin Scholze and Christian Peschel

III Medical Department, Klinikum rechts der Isar, Technical University Munich, Munich, Germany

Requests for reprints: Christian Meyer zum Büschenfelde, Department of Internal Medicine III, Technical University of Munich, Ismaninger Street 22, 81675 Munich, Germany. Phone: 49-89-41405816; Fax: 49-89-41404957; E-mail: christian.mzb{at}lrz.tum.de.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Immunotherapy with rituximab alone or in conjunction with chemotherapy has significantly improved the treatment outcome of B-cell lymphoma patients. Nevertheless, a subpopulation of patients does not respond to rituximab. The reason for treatment failure as well as the exact mechanism of action is still uncertain. The function of rituximab has long been associated with the partitioning of CD20 molecules to lipid microdomains. We now show that the extent of CD20 recruitment to lipid rafts correlates with response to rituximab. In addition, expression of the raft-associated sphingolipid GM1 on lymphoma cells is associated with the susceptibility of lymphoma cells to rituximab. Furthermore, we show substantially different GM1 expression in various primary non-Hodgkin's lymphomas. Whereas chronic lymphocytic leukemia (CLL) cells have a low GM1 expression, marginal zone lymphoma cells exhibit much higher levels. Differences were not only detected among various lymphoma subgroups but also within one lymphoma subtype. Interestingly, whereas CLL cells from patients with high GM1 expression responded to rituximab, patients with low GM1 expressing CLL cells did not. These data show the importance of membrane microdomains in the effect of rituximab and may offer a predictive factor for the responsiveness of lymphoma cells to rituximab. [Cancer Res 2008;68(13):5414–22]


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
The monoclonal antibody (mAb) rituximab directed against the cell-surface molecule CD20 of mature B cells has been proven to be successful in the treatment of a variety of B-cell malignancies (1–4). However, resistance against rituximab occurs and there is no prognostic marker to predict individual response (5). Rituximab has been shown to induce cell killing via antibody-dependent cellular cytotoxicity (ADCC; ref. 6), complement-dependent cytotoxicity (CDC; refs. 7, 8), and the induction of apoptosis (9, 10). However, the mechanism that renders rituximab very effective in vivo remains elusive. Some reports suggest CDC to be the major pathway that is used by rituximab to deplete human lymphoma cells in vitro and in vivo (11). On the other hand, expression of the complement inhibitors CD46, CD55, and CD59 did not predict treatment outcome (12). Other reports have proposed that the activity of rituximab in vivo depends on its interaction with immune cells, in particular through ADCC and phagocytosis (6, 13, 14). The fact that Fc{gamma}RIIIa polymorphisms have been shown to be predictive for tumor clearance in follicular lymphomas supports the importance of ADCC in the action of rituximab (15).

Several studies have addressed the question whether CD20 expression level may be used to predict progression of disease and response to treatment with rituximab. This would be very suggestive especially for chronic lymphocytic leukemia (CLL), characterized by a low CD20 expression level and a general weak response to rituximab (8). However, in vivo studies with anti-CD20 antibodies showed no correlation between the density of CD20 molecules on the cell surface and response to rituximab (16). Thus, no reliable prognostic factor for the susceptibility of non-Hodgkin's lymphoma to rituximab exists thus far.

On the molecular level, membrane microdomains have been shown to be associated with the function of rituximab. Binding of rituximab causes a rapid redistribution of CD20 molecules to detergent-resistant membranes termed lipid rafts (7). These specialized microdomains of the plasma membrane are highly enriched in sphingolipids and cholesterol (17). Membrane-associated events are involved in several biological cell functions such as cell signaling, cell adhesion, and protein sorting. Gangliosides are sialic acid–containing glycosphingolipids that are constituents of mammalian cell membranes. Increasing evidence suggests that gangliosides are not passive structural components of cell membranes but rather act as modulators for important biological processes such as proliferation, adhesion, differentiation, and inflammation (18–22). Furthermore, it has been shown that gangliosides play an important role in the formation and stabilization of lipid rafts (23, 24).

The ganglioside GM1 is widely used as a marker for lipid rafts (25, 26). In the present study, we analyzed the expression of GM1 in various non-Hodgkin's lymphomas. Moreover, we asked whether differences in the GM1 expression of lymphoma cells influence CD20 recruitment to lipid rafts and, thus, the susceptibility of non-Hodgkin's lymphomas to rituximab. Analyzing the GM1 expression level of more than 200 patient samples revealed a significant difference in the expression between various lymphoma subtypes. The different GM1 expression directly correlated with the responsiveness of lymphoma cells to rituximab. Whereas CLL and mantle cell lymphoma (MCL) cells with high GM1 expression responded to rituximab ex vivo, low GM1 expressing lymphoma cells did not.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosure of Potential...
 References
 
Reagents, antibodies, and cell lines. The oligonucleotide DSP30 (TCGTCGCTGTCTCCGCTTCTTCTTGCC) was used at 2 µmol/L, single stranded, phosphorothioate stabilized, and synthesized by TIB Molbiol. Rituximab was purchased by Roche and used in the concentration indicated; interleukin-2 (IL-2) was obtained from PeproTech.

Cell lines were obtained from American Type Culture Collection or Deutsche Sammlung von Mikroorganismen und Zellkulturen and were maintained in RPMI 1640 supplemented with 10% FCS, 100 units/mL penicillin/streptomycin, 2 mmol/L L-glutamine, and 0.05 mmol/L 2-mercaptoethanol (Invitrogen).

Human mAbs anti-CD10-PECy5, anti-CD20-PECy7, anti-CD20-PE, anti-CD23-PE, anti-FMC-7-FITC, anti-CD5-FITC, anti-CD38-PECy5, anti-{kappa}-FITC, anti-{lambda}-PE, anti-CD19-ECD, and appropriate isotype controls were purchased from Beckmann-Coulter. Cholera toxin subunit B-FITC was purchased from Molecular Probes.

Flow cytometric analysis. Peripheral blood or bone marrow aspirates were anticoagulated with sodium heparin. Further processing was done within 24 h. For lysis, 300 µL of bone marrow or 300 µL of peripheral blood were lysed with 2 mL of Versa-Lysis (Coulter) in rotating tubes for 10 min. After washing, cells were stained for CD19, CD20, CD5, CD23, CD38, FMC7, CD10, {kappa}, {lambda}, and GM1 with three 5-color combinations and analyzed by flow cytometry with the use of a Coulter Cytomic FC 500. The GM1 expression level in granulocytes was used as a staining control because GM1 was comparably expressed in granulocytes from different patients (data not shown). To determine the GM1 expression level of lymphoma cells in the same tube, separate gates were set on CD19-positive lymphoma cells and CD45int granulocytes. Depicted is the ratio of GM1 expression in lymphoma cells relative to granulocytes.

Cells from cell culture were washed in PBS containing 2% FCS and incubated with saturating amounts of fluorochrome-conjugated antibodies. After 30 min at 4°C, cells were washed with PBS/2% FCS and analyzed by flow cytometry with the use of a Coulter Cytomic FC 500 cytofluorometer.

Culture conditions of cell lines. Lymphoma cells were cultured in RPMI 1640, supplemented with 10% FCS, 100 units/mL penicillin/streptomycin, 2 mmol/L L-glutamine, and 0.05 mmol/L 2-mercaptoethanol (all from Life Technologies, Inc./Invitrogen). All tissue culture experiments were done in a fully humidified atmosphere with 5% CO2 at 37°C. Cells were plated at 100,000 in a total volume of 200 µL in 96-well dishes and were grown for 1 to 3 d.

Isolation of B-cell CLL and MCL samples by immunomagnetic separation. After informed consent was obtained, peripheral blood was collected from patients with confirmed B-cell CLL (B-CLL) and MCL according to morphologic and immunophenotypic criteria. Patients were either untreated or had not received cytoreductive chemotherapy for at least 3 mo before blood collection. At the time of analysis, all patients were free of infectious complications.

Enrichment of B-CLL and MCL cells by immunomagnetic sorting has been described (27). In brief, mononuclear cells were first enriched by density gradient centrifugation over a Ficoll-Hypaque layer, and then T lymphocytes and monocytes were depleted with immunomagnetic microbeads. As assessed by flow cytometry, the content of monoclonal CD19+ B cells was >95% in all immunoseparated samples. Cells were used immediately for further experiments.

Culture conditions for primary lymphoma cells. B-CLL or MCL cells were cultured in RPMI 1640, supplemented with 30% autologous serum, 50 IU/mL penicillin/streptomycin, 2 mmol/L L-glutamine, and 0.05 mmol/L 2-mercaptoethanol (Life Technologies/Invitrogen). All tissue culture experiments were done in a fully humidified atmosphere with 5% CO2 at 37°C. Cells were plated at 500,000 in a total volume of 200 µL in 96-well dishes and were grown for 48 h. It should be noted that, in addition to rituximab-mediated cell death, spontaneous cell death was observed in all cultured CLL samples. Especially in CLL cells cultured with medium and serum alone, the spontaneous cell death was high. To rescue CLL cells from spontaneous cell death, cells were stimulated with the CpG oligonucleotide DSP30 (2 µmol/L) and IL-2 (100 units/mL; ref. 27).

Inhibition of functional rafts using methyl-β-cyclodextrin. Cells were incubated for 30 min with 10 mmol/L methyl-β-cyclodextrin (MβCD; Sigma). After addition of rituximab in the concentration indicated, cells were incubated for 30 min at 37°C. After three washing steps, cells were incubated for 1 to 3 d and analyzed for the number of viable cells by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTS) assay.

Inhibition of sphingolipid synthesis. To inhibit GlcCer synthesis, the lymphoma cell line Nceb was cultured in the presence of 30 µmol/L D-threo-1-phenyl-2-decanoylamino-3-morpholino-1-propanol (PDMP; Calbiochem) for 5 d (28).

Rituximab-mediated cytotoxicity assays. For rituximab-mediated cell death (apoptosis and CDC), 1 x 106 cells were resuspended in 300 µL of human serum (non–heat inactivated) and 700 µL of culture medium with or without 100 µg/mL rituximab at 37°C for 24 h. Dead and viable cells were discriminated by Annexin V/propidium iodide (PI) staining.

Annexin V/PI staining. Cells (1 x 105) were washed and resuspended in binding buffer [10 mmol/L HEPES (pH 7.4), 140 mmol/L NaCl, and 2.5 mmol/L CaCl2] containing 1 µg/mL FITC-Annexin V. PI (1.25 µg/mL) was also added to the samples to distinguish between early apoptosis and secondary necrosis. Subsequently, cells were assessed by flow cytometry.

MTS assay. B cells were cultured in RPMI 1640 (Life Technologies/Invitrogen) supplemented with 10% FCS (PAA) or 30% autologous serum, 50 IU/mL penicillin/streptomycin, 2 mmol/L L-glutamine, and 0.05 mmol/L 2-mercaptoethanol (Life Technologies/Invitrogen). All tissue culture experiments were done at 37°C and 5% CO2 in a fully humidified atmosphere in 96-well plates at 1 x 105 cells (cell lines) or 5 x 105 primary lymphoma cells in a total volume of 200 µL for 1 to 3 d. At the end of the culture period, a 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay was done: 40 µL of a combined MTS/phenazine methosulfate solution (Promega) were added, and the absorbance at 490 nm (A490) was determined using an ELISA reader. Mean values were calculated from triplicate cultures. Data from individual experiments are presented as mean ± SD. We confirmed our results with the trypan blue exclusion method in two independent samples.

Purification of raft fractions. Purification of raft fractions has been described (29). Cells (3 x 107) were lysed on ice in 1 mL of 1% Triton in MNE buffer [25 mmol/L MES (pH 6.5), 150 mmol/L NaCl, 5 mmol/L EDTA, 50 mmol/L NaF, and 1 mmol/L sodium orthovanadate, and 10 mg/mL each of aprotinin, leupeptin, and pepstatin and the protease inhibitor mix Complete Mini (Roche)], dounced 10 times, and mixed with 1 mL of 85% sucrose made with MNE buffer. After transfer of the lysate to the centrifuge tube, 2 mL of 35% sucrose in MNE buffer were overlaid, then 1 mL of 5% sucrose in MNE was overlaid. After centrifugation for 3.30 h at 200,000 x g in a Beckman SW50.1 rotor, 400-µL fractions were collected from the top of the gradient. Protein concentration of each fraction was determined with the Bio-Rad protein assay kit, which is based on the Bradford dye binding procedure. Fractions were pooled or analyzed individually by SDS-PAGE and Western blotting.

Western blotting. Western blot analysis was done with the indicated antibodies following SDS-PAGE and transfer onto nitrocellulose paper (Schleicher and Schuell). They were hybridized with antibodies to CD20 (Novocastra), lyn (Santa Cruz Biotechnology), cholera toxin subunit B-HRP (Calbiochem), caspase-3 (Cell Signaling), and caspase-8 (R&D). All immunoblots were developed with the ECL system (Pierce).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosure of Potential...
 References
 
Rituximab mediates cell death in Nceb cells but not in DB cells. Rituximab has been shown to induce cell death in lymphoma cells via CDC, ADCC, and induction of apoptosis. However, resistance to rituximab occurs in vitro and in vivo. We investigated four different mantle cell, three diffuse large cell, two CLL, and two Burkitt lymphoma cell lines for their response to rituximab (Table 1 ). Rituximab-mediated cell death (apoptosis and CDC) was determined in the presence of non–heat-inactivated serum from a healthy donor. Lymphoma cells were incubated in the absence or presence of rituximab for 24 hours. Cell death was assessed by fluorescence-activated cell sorting (FACS) analysis using Annexin V/PI staining. The results of two exemplary cell lines, the MCL cell line Nceb and the diffuse large B-cell lymphoma cell line DB, are depicted in Fig. 1 . Nceb cells, but not DB cells, died after rituximab treatment. The antilymphoma effect of rituximab in Nceb cells was dose dependent. Incubating Nceb cells with increasing concentrations of rituximab led to an increase in rituximab-mediated cell death (Fig. 1B). In contrast, no cytotoxic effect, even at 100 µg/mL rituximab, was observed in the DB cell line.


View this table:
[in this window]
[in a new window]

  		Table 1. GM1 expression but not CD20 expression correlates with susceptibility of lymphoma cell lines to rituximab

 

Figure 3
View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. GM1 expression, but not CD20 expression, correlates with susceptibility of lymphoma cell lines to rituximab. A, surface expression of CD20 and GM1 on DB and Nceb cells was determined by FACS. Cells (1 x 106) were stained with 1 µg of anti-CD20 mAb-PE (IgG1 subtype; solid black lines), isotype control (pure IgG1; gray lines), or 1 µg of cholera toxin subunit B-FITC, and then analyzed by FACS. B, Nceb cells were treated with PDMP (30 µmol/L) or left untreated. GM1 expression was measured by FACS as described in A. C, PDMP-treated and untreated Nceb cells were incubated with 100 µg/mL rituximab for 24 h or left untreated, as indicated, in the presence of 30% non–heat-inactivated human serum. Cells were analyzed by FACS analysis with a standard Annexin V/PI staining.

 

Figure 1
View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. Rituximab-mediated apoptosis and CDC in the Nceb cell line but not in the DB cell line. A, the MCL cell line Nceb and the diffuse large B-cell lymphoma cell line DB were treated with 100 µg/mL rituximab for 24 h or left untreated in the presence of 30% non–heat-inactivated human serum from a healthy donor. Cells were analyzed by FACS analysis with a standard Annexin V/PI staining. B, DB and Nceb cells were incubated with various concentrations of rituximab (0, 0.01, 1, and 100 µg/mL) in the presence of 30% non–heat-inactivated serum from a healthy donor. Cells (105) in triplicates were used in a standard MTS assay. Points, mean; bars, SD.

 
Lipid rafts are crucial for rituximab-mediated cell death. Rituximab has been shown to recruit CD20 molecules into lipid rafts (7). Moreover, it has been discussed whether CD20 recruitment to lipid rafts is essential for rituximab-mediated cell death. Because the two cell lines, DB and Nceb, responded differently to rituximab treatment, we asked whether the difference in response could be due to differences in CD20 raft recruitment. We isolated lipid rafts from Nceb and DB cells by sucrose gradient centrifugation. The raft fractions (fractions 1–4) and nonraft fractions (fractions 8–11) were pooled and subjected to Western blot analysis. The tyrosine kinase Lyn, known to be constitutively expressed in lipid rafts, served as a control (30). Both unstimulated DB and unstimulated Nceb cells did not exhibit any raft-associated CD20. Interestingly, within 5 minutes of rituximab treatment, Nceb cells showed a robust recruitment of CD20 molecules to lipid rafts. In contrast, little CD20 recruitment was observed in the rituximab-resistant DB cell line (Fig. 2A ). We next asked if the recruitment of CD20 in Nceb cells to lipid rafts would be necessary for cell killing. For this purpose, we investigated the effect of MβCD on the survival of Nceb cells after rituximab treatment. MβCD inhibits the function of lipid rafts by cholesterol depletion (17). Nceb cells were incubated with 10 mmol/L MβCD for 30 minutes. Cells were then treated with rituximab or untreated. After 24 hours, the percentage of viable cells was determined by MTS assay (Fig. 2B). On rituximab treatment, a decrease in viable cells of >50% was observed. This apoptotic effect was completely abolished by preincubation with MβCD. Therefore, the recruitment of CD20 to lipid microdomains on rituximab treatment is an initial event that is crucial for rituximab-mediated cell death.


Figure 2
View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Lipid rafts are crucial for rituximab-mediated cell death. A, DB and Nceb cells (3 x 107) were incubated with 100 µg/mL rituximab for 5 and 20 min or left untreated. Cells were lysed and sucrose gradient fractions were prepared as described (31). Raft fractions 1 to 4 and nonraft fractions 8 to 11 were pooled and separated by SDS-PAGE. Immunoblotting was done with anti-CD20 and anti-Lyn specific mAbs. B, Nceb cells were incubated for 30 min with 10 mmol/L MβCD. After addition of 100 µg/mL rituximab, cells were incubated for 30 min at 37°C. After washing thrice with medium, cells were incubated for 24 h. Cells (105) in triplicates were used in a standard MTS assay. Columns, mean; bars, SD. C, Nceb cells were preincubated or not with 10 mmol/L MβCD for 30 min. After washing, cells were left untreated or stimulated with 100 µg/mL rituximab for 5 min. Sucrose gradient fractions from 3 x 107 cells were prepared as described in A. Immunoblotting was done with an anti-CD20 specific mAb. D, Nceb and DB cells were treated as described in A. Immunoblotting was done with caspase-8 and caspase-3 specific mAbs.

 
To confirm the effect of MβCD on the molecular level, we analyzed the rituximab-mediated CD20 recruitment to lipid rafts in the presence of MβCD. As expected, MβCD treatment inhibited the rituximab-mediated raft recruitment of CD20 (Fig. 2C).

Rituximab has been shown to induce cell killing by the induction of apoptosis (10, 11). Because CD20 was recruited to membrane microdomains after rituximab treatment in the susceptible Nceb cells, we next asked whether caspases, mediators of the apoptosis pathway, are also recruited to this membrane compartment. Rituximab-susceptible Nceb and rituximab-resistant DB cells were treated with rituximab and raft fractions were isolated. Interestingly, procaspase-8 and procaspase-3 recruitment to lipid rafts was only observed in the susceptible Nceb cell line but not in the rituximab-resistant DB cells (Fig. 2D), indicating the importance of this molecular event in rituximab-mediated cell death.

GM1 expression correlates with susceptibility of lymphoma cells to rituximab in vitro. The expression of CD20 molecules on lymphoma cells is still discussed as being involved in the responsiveness to rituximab. To test the hypothesis that CD20 expression levels are responsible for differences in CD20 recruitment and, subsequently, altered responsiveness to rituximab, we measured the CD20 expression levels by FACS analysis. Compared with Nceb cells, DB cells showed a significantly higher CD20 expression (Fig. 3A ), although they did not respond to rituximab treatment. Because differences in CD20 recruitment to lipid rafts correlated with response to rituximab, we next asked whether differences in the expression of the raft-associated ganglioside GM1 could be observed between the two cell lines. Nceb cells exhibited a substantially higher GM1 expression compared with DB cells (Fig. 3A). To confirm the hypothesis that GM1 expression correlates with sensitivity to rituximab, we investigated GM1 and CD20 expression in those cell lines, in which the response to rituximab was initially investigated (Table 1). No correlation between CD20 expression and sensitivity to rituximab was observed. In contrast, GM1 expression and response to rituximab correlated in all the B-cell lymphoma cell lines investigated. To further show the importance of GM1 expression in rituximab-mediated cell death, Nceb cells were treated with the glycosphingolipid synthesis inhibitor PDMP. It has been shown that PDMP down-regulates sphingolipid expression (31). Treatment of Nceb cells with the sphingolipid inhibitor PDMP resulted in a marked reduction in GM1 expression as compared with untreated cells (Fig. 3B). Analyzing the effect of rituximab-mediated cell death in PDMP-treated Nceb cells, a significant decrease in susceptibility to rituximab-mediated cell death was observed (Fig. 3C). After rituximab treatment of non–PDMP-treated Nceb cells, <30% of the cells were viable. In contrast, PDMP treatment antagonized the function of rituximab-mediated cell death. Almost 50% of the cells were alive after rituximab treatment. Thus, alterations in GM1 expression directly influence the susceptibility of lymphoma cells to rituximab-mediated cell death.

GM1 expression varies in primary lymphoma cells. It is well known that the effect of rituximab differs in various non-Hodgkin's lymphoma subtypes. For example, CLL cells exhibit a lower sensitivity to rituximab than marginal zone lymphomas. Because we observed a correlation between susceptibility to rituximab and GM1 expression in various lymphoma cell lines, we asked whether this could also be observed in primary lymphoma cells. To this end, we analyzed the GM1 expression of lymphoma cells from a total of 217 patients with indolent lymphomas. FACS analysis of GM1 in CD19+ lymphoma cells was done from blood and bone marrow. Figure 4A indicates the number of patients with different lymphomas analyzed. CLL samples accounted for >50% of all patient samples. GM1 levels of B-cell lymphomas from 34 marginal zone lymphomas, 20 follicular lymphomas, 11 immunocytomas, and 22 MCLs were analyzed by FACS staining. Figure 4B shows the GM1 expression of a typical patient with CLL, MCL, and marginal zone lymphoma in a histogram. The patient with CLL exhibited a much lower GM1 level than did the patient with MCL or marginal zone lymphoma. The average GM1 expression levels of all 217 patients analyzed are shown in Fig. 4A. Interestingly, there was a significant difference in GM1 expression between most non-Hodgkin's lymphoma subgroups as determined by Student's t test (GM1 expression CLL/follicular lymphoma, P = 0.014). Of note, differences were also observed within the subgroup of patients with CLL, with some patients exhibiting high levels and some with low GM1 expression levels (data not shown; Fig. 5A ). The analysis of polyclonal B cells revealed a GM1 expression that was distinct from the expression of monoclonal B cells in most of the samples analyzed. The average GM1 expression of polyclonal B cells from 15 healthy donors indicated expression levels that were higher than those of CLL, follicular lymphoma, and immunocytoma, but lower than those of MCL and marginal zone lymphoma (Fig. 4A).


Figure 4
View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. GM1 expression varies in primary lymphoma cells. A, the average GM1 levels of all 217 patients and 15 healthy donors grouped by lymphoma subtype were measured by FACS. The number of patients for each subtype is indicated below. Y-axis, GM1 expression level of B lymphoma cells relative to granulocytes; bars, SE. B, lymphoma cells were stained anti-CD19-PE and cholera toxin subunit B-FITC. Cells were gated on CD19+ lymphoma cells. FACS analysis of a typical patient with CLL, MCL, and marginal zone lymphoma (MZL).

 

Figure 5
View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. GM1 expression in CLL and MCL cells correlates with susceptibility to rituximab. B cells from 14 patients with CLL and 2 patients with leukemic MCL were isolated as described. CD20 and GM1 surface expression of CLL and MCL cells was determined by FACS. Mean intensity fluorescence of CD20 and GM1 expression level of CLL patients (A) and MCL patients (C) are shown. Susceptibility of CLL cells to rituximab was determined. CLL cells were purified as described. CLL cells (5 x 105) were incubated in the presence or absence of 100 µg/mL rituximab in autologous serum with DSP30 (2 µmol/L) and IL-2 (100 units/mL). After 48 h, viable cells were determined by MTS assay. Numbers shown (apoptotic cells) are the difference between viable cells in the presence and absence of rituximab (B). MCL cells (5 x 105) were incubated in the presence or absence of 100 µg/mL rituximab in autologous serum. After 48 h, cell death was determined by FACS with Annexin V/PI staining (D).

 
GM1 expression in CLL and MCL cells correlates with susceptibility to rituximab. Because different GM1 expression levels were detected in the 122 CLL patients tested, we asked whether differences in response to rituximab could be observed in dependence on the GM1 status. Samples from 14 CLL patients were analyzed by flow cytometry for the expression of the CD20 antigen and the sphingolipid GM1. In Fig. 5A, the CD20 and GM1 expression levels of the 14 patients analyzed are documented.

The induction of apoptosis by rituximab was investigated after 48 hours by Annexin V/PI staining and MTS assay (Fig. 5B; data not shown). The antileukemic effect of rituximab strongly correlated with GM1 expression because only those CLL cells with a high GM1 expression level responded to rituximab. In contrast, CLL cells with low GM1 expression showed only little, if any, susceptibility to rituximab (Fig. 5B). No correlation between response to rituximab and CD20 expression was observed (Fig. 5A and B).

Due to limited case numbers of leukemic MCL, we had access to samples from two patients. Blood samples from these two patients were immunoseparated to >95% purity based on the content of monoclonal CD19+ B cells. Again, cells were analyzed by flow cytometry for the expression of the CD20 antigen and the sphingolipid GM1. Both samples exhibited a comparable CD20 expression, whereas patient 2 displayed a much higher expression level for GM1 (Fig. 5C). MCL cells were cultured in the absence or presence of rituximab. After 48 hours, apoptotic cells were determined by FACS using Annexin V/PI staining and MTS assay. Although CD20 was expressed comparably, MCL cells derived from patient one did not respond to rituximab treatment, whereas ~50% of the cells from patient 2 died (Fig. 5D). These results suggest that GM1 expression, rather than CD20 expression, correlates with responsiveness to rituximab in further types of non-Hodgkin's lymphoma.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosure of Potential...
 References
 
In the present study, we show that expression of the sphingolipid GM1 correlates with response to rituximab in various non-Hodgkin's lymphomas. Furthermore, not only in vitro expression but also ex vivo GM1 expression differs between various lymphoma subtypes and, more importantly, even within one lymphoma subgroup. Analysis of apoptosis induction in CLL and MCL cells revealed that only lymphoma cells with high GM1 expression, but not low expressing lymphoma cells, responded to rituximab (Fig. 5B and D). On the molecular level, susceptibility of lymphoma cells to rituximab correlated with the recruitment of CD20 and procaspase-8 and procaspase-3 molecules to lipid rafts. Together, these data may offer a predictive factor for the treatment response of non-Hodgkin's lymphomas to rituximab.

Although antibody-induced CD20 recruitment to lipid rafts is documented, the importance of this molecular event is still uncertain. Whereas complement-mediated lysis by anti-CD20 mAbs was shown to correlate with the segregation into lipid rafts, the same group reported that CD20-induced lymphoma cell death was independent of raft redistribution (7, 32). However, these observations were made using different CD20 antibodies. In contrast to the anti-CD20 mAb B1, rituximab treatment resulted in CD20 raft recruitment. The rituximab-induced raft recruitment of CD20 was accompanied by CDC-mediated eradication of lymphomas. In contrast, no CDC-mediated cell death was observed on treatment with the anti-CD20 mAb B1 (7). Thus, different CD20 antibodies have different effects on the molecular level in vitro and in vivo (33, 34). Therefore, studies using rituximab are necessary to explain the mechanism of lymphoma eradication in patients.

As shown by previous studies, rituximab treatment results in CD20 recruitment to lipid microdomains. With the two exemplary two cell lines, which respond differently to rituximab, we show that the amount of CD20 recruitment to lipid rafts is crucial for the effect of rituximab. In the rituximab-resistant cell line DB, only a small amount of CD20 was recruited to lipid rafts, whereas in the rituximab-sensitive cell line Nceb, CD20 was recruited substantially to lipid rafts (Fig. 2A). Furthermore, procaspase-8 and procaspase-3 recruitment to lipid rafts was also observed only in rituximab-susceptible Nceb cells but not in the resistant DB cell line. The fact that molecules of the apoptosis pathway are selectively recruited to membrane microdomains following rituximab treatment offers new insights into the mechanism of rituximab-mediated cell death and highlights the importance of the induction of apoptosis. Recently, it has been shown that rituximab results in a rapid and transient increase in acid sphingomyelinase activity and concomitant cellular ceramide generation induced in rituximab-sensitive cell lines (35). The fact that most acid sphingomyelinase activity was contained in lipid rafts supports the importance of membrane microdomains in rituximab-mediated cell death. Furthermore, inhibition of caspase-8 using carbobenzoxy-Val-Ala-Asp-fluoromethylketone inhibits ceramide formation and subsequent apoptosis (36). This underlines the necessity of CD20 and procaspase-8 recruitment to lipid rafts for rituximab-mediated cell death. Together, these data suggest that the recruitment of the death-inducing signaling complex as indicated by caspase-8 recruitment to lipid rafts is an early event that mediates rituximab-induced cell death. In case of raft recruitment of the death-inducing signaling complex (rituximab-susceptible cells), downstream signaling events such as caspase-3 activation, acid sphingomyelinase activity, and ceramide release are initiated.

The importance of CD20 raft recruitment was further documented by the use of the raft-inhibiting detergent MβCD. When Nceb cells were treated with rituximab in the presence of MβCD, no raft recruitment was observed and neither CDC nor apoptosis was induced (Fig. 2B and C). This documents the necessity of CD20 raft recruitment for the function of rituximab, at least for CDC and induction of apoptosis. Monovalent Fab fragments of rituximab have also been shown to be sufficient to recruit CD20 molecules to lipid rafts (37). This emphasizes that cross-linking of two adjacent epitopes by rituximab is not necessary for CD20 raft recruitment. Moreover, these data suggest that Fab fragments stabilize a conformation of CD20 that exhibits a higher affinity for rafts. The higher-affinity association of CD20 to rafts might create a suitable environment for CD20 activation, providing close proximity to raft-localized kinases (38).

Using non–heat-inactivated serum from a healthy donor, we are able to detect CDC and apoptosis, but not ADCC. The major effect of CDC and apoptosis compared with ADCC for rituximab-mediated cell death has been shown by Di Gaetano and colleagues. In their study, rituximab prevented death in all mice treated with rituximab after i.v. inoculation of the murine T lymphoma cell line EL4 retrovirally transfected with the human CD20 cDNA. The depletion of natural killer cells, mononuclear cells, and T cells did not affect the therapeutic effect of rituximab (11). Therefore, at least in this system, ADCC was dispensable for the function of rituximab. In contrast, Clynes and colleagues suggest that ADCC is the central effector mechanism of rituximab. In a s.c. xenograft model of lymphoma, the FcR{gamma} chain necessary for signaling from the activating Fc{gamma}RI and Fc{gamma}RIII receptors, present on the surface of macrophages, neutrophils, and natural killer cells, has been shown to be required for the full therapeutic activity of rituximab (6). One explanation for the differences observed in the two models could be the use of different lymphoma cells. It is also possible that the site of the tumor determines the mechanism by which rituximab can kill tumor cells. It might be possible that effector cells invade solid lymphoid tumors and kill lymphoma cells. Leukemic or hypervasculated tumors might be more susceptible to CDC. Both mechanisms, the intrinsic properties of different B cells and their localization within a protective microenvironment, have been shown to play a role in the susceptibility of non-Hodgkin's lymphomas in vivo (39).

Our data provide evidence for a predictive factor for the response of lymphoma cells to rituximab. Starting with the observation that CD20 raft recruitment is a key event following rituximab treatment, we correlated the amount of raft-translocated CD20 with response. Whereas recruitment of CD20 to lipid rafts was in line with treatment response, cell-surface expression levels of CD20 showed no correlation. Interestingly, the expression levels of the ganglioside GM1, widely used as a marker for lipid rafts, correlated with response to rituximab (Table 1). The importance of GM1 expression was further underlined by inhibiting the sphingolipid synthesis in Nceb cells. This resulted in a reduced GM1 expression and, subsequently, in a marked reduction of rituximab-mediated cell death (Fig. 3B and C). Therefore, the observed decrease in rituximab susceptibility is due to a direct reduction in GM1 expression. Gangliosides are not passive structural components of cell membranes. It has been shown that they modulate important biological processes such as proliferation, adhesion, differentiation, and inflammation (18–22). Furthermore, gangliosides play an important role in the formation and stabilization of lipid membrane microdomains. The reduced rituximab-induced CD20 recruitment in the low-expressing DB cell line suggests a role for the ganglioside GM1 in raft formation (Fig. 2A).

The GM1 expression patterns we observed in the lymphoma cells of our patients correspond with the known response to rituximab for most entities. Especially for marginal zone lymphomas, we observed a high GM1 expression (Fig. 4A and B), which correlates with a good response of these lymphomas even to monotherapy with rituximab (40). The low GM1 expression of most CLL cells is also in agreement with the limited success of rituximab in this entity. Previous studies with rituximab showed limited activity in previously treated patients with CLL, with only 10% to 15% of the patients achieving a partial response (41, 42). Therefore, rituximab was thought to be inactive in this lymphoma when used as monotherapy. Recently, Keating and colleagues published early results of the combination of rituximab with the chemotherapy fludarabine and cyclophosphamide (R-FC). This regimen resulted in high complete response rates, indicating a role for rituximab in CLL, at least in combination with chemotherapy (43).

In contrast, our measured GM1 expression in follicular lymphomas does not correlate with the known in vivo activity of rituximab in this entity. However, it has been shown that follicular lymphomas are killed mainly through ADCC. Therefore, it might be possible that for ADCC, lipid rafts and GM1 expression do not play a major role. In agreement with this speculation, Fc{gamma}RIIIa polymorphisms have been shown to be predictive for tumor clearance for follicular lymphomas. The fact that Fc{gamma}RIIIa and Fc{gamma}RIIa polymorhisms do not predict response to rituximab in B-CLL (44) and MCL (45) suggests that different effector mechanisms of rituximab are involved in tumor eradication in different non-Hodgkin's lymphomas.

Especially for CLL and MCL, our data provide new aspects that might be useful for future therapeutic strategies. Our data support the monotherapeutic use of rituximab at least in a subgroup of CLL patients with high GM1 expression. A different treatment option that has not been investigated in CLL yet, but has been shown to be very effective in other indolent lymphomas, is maintenance therapy with rituximab (46–50). In a study by Ghielmini and colleagues in follicular lymphoma, the event-free survival increased from 12 to 23 months under maintenance therapy with rituximab. Because our data provide evidence that rituximab has an effect in CLL patients with high GM1 expression cells, these patients might benefit from rituximab maintenance therapy. Together, these data encourage further investigation of the role of rituximab on the basis of GM1 expression in prospective studies in patients with CLL.


   Disclosure of Potential Conflicts of Interest
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
References
 
No potential conflicts of interest were disclosed.


   Acknowledgments
 
Grant support: Kommission für klinische Forschung.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Jürgen Ruland for scientific discussion and Uta Ferch for critical reading of the manuscript.

Received 9/22/07. Revised 2/ 4/08. Accepted 4/13/08.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Coiffier B, Haioun C, Ketterer N, et al. Rituximab (anti-CD20 monoclonal antibody) for the treatment of patients with relapsing or refractory aggressive lymphoma: a multicenter phase II study. Blood 1998;92:1927–32.[Abstract/Free Full Text]
  2. Czuczman MS. CHOP plus rituximab chemoimmunotherapy of indolent B-cell lymphoma. Semin Oncol 1999;26:88–96.[Medline]
  3. Kaminski MS, Zasadny KR, Francis IR, et al. Radioimmunotherapy of B-cell lymphoma with [131I]anti-B1 (anti-CD20) antibody. N Engl J Med 1993;329:459–65.[Abstract/Free Full Text]
  4. Press OW, Leonard JP, Coiffier B, Levy R, Timmerman J. Immunotherapy of non-Hodgkin's lymphomas. Hematol Am Soc Hematol Educ Program 2001:221–40.
  5. Smith MR. Rituximab (monoclonal anti-CD20 antibody): mechanisms of action and resistance. Oncogene 2003;22:7359–68.[CrossRef][Medline]
  6. Clynes RA, Towers TL, Presta LG, Ravetch JV. Inhibitory Fc receptors modulate in vivo cytoxicity against tumor targets. Nat Med 2000;6:443–6.[CrossRef][Medline]
  7. Cragg MS, Morgan SM, Chan HT, et al. Complement-mediated lysis by anti-CD20 mAb correlates with segregation into lipid rafts. Blood 2003;101:1045–52.[Abstract/Free Full Text]
  8. Golay J, Lazzari M, Facchinetti V, et al. CD20 levels determine the in vitro susceptibility to rituximab and complement of B-cell chronic lymphocytic leukemia: further regulation by CD55 and CD59. Blood 2001;98:3383–9.[Abstract/Free Full Text]
  9. Demidem A, Lam T, Alas S, Hariharan K, Hanna N, Bonavida B. Chimeric anti-CD20 (IDEC-C2B8) monoclonal antibody sensitizes a B cell lymphoma cell line to cell killing by cytotoxic drugs. Cancer Biother Radiopharm 1997;12:177–86.[Medline]
  10. Shan D, Ledbetter JA, Press OW. Apoptosis of malignant human B cells by ligation of CD20 with monoclonal antibodies. Blood 1998;91:1644–52.[Abstract/Free Full Text]
  11. Di Gaetano N, Cittera E, Nota R, et al. Complement activation determines the therapeutic activity of rituximab in vivo. J Immunol 2003;171:1581–7.[Abstract/Free Full Text]
  12. Weng WK, Levy R. Expression of complement inhibitors CD46, CD55, and CD59 on tumor cells does not predict clinical outcome after rituximab treatment in follicular non-Hodgkin lymphoma. Blood 2001;98:1352–7.[Abstract/Free Full Text]
  13. Cartron G, Watier H, Golay J, Solal-Celigny P. From the bench to the bedside: ways to improve rituximab efficacy. Blood 2004;104:2635–42.[Abstract/Free Full Text]
  14. Dall'Ozzo S, Tartas S, Paintaud G, et al. Rituximab-dependent cytotoxicity by natural killer cells: influence of FCGR3A polymorphism on the concentration-effect relationship. Cancer Res 2004;64:4664–9.[Abstract/Free Full Text]
  15. Cartron G, Dacheux L, Salles G, et al. Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism in IgG Fc receptor Fc{gamma}RIIIa gene. Blood 2002;99:754–8.[Abstract/Free Full Text]
  16. Perz J, Topaly J, Fruehauf S, Hensel M, Ho AD. Level of CD 20-expression and efficacy of rituximab treatment in patients with resistant or relapsing B-cell prolymphocytic leukemia and B-cell chronic lymphocytic leukemia. Leuk Lymphoma 2002;43:149–51.[CrossRef][Medline]
  17. Simons K, Ikonen E. Functional rafts in cell membranes. Nature 1997;387:569–72.[CrossRef][Medline]
  18. Fukumoto S, Mutoh T, Hasegawa T, et al. GD3 synthase gene expression in PC12 cells results in the continuous activation of TrkA and ERK1/2 and enhanced proliferation. J Biol Chem 2000;275:5832–8.[Abstract/Free Full Text]
  19. Miljan EA, Bremer EG. Regulation of growth factor receptors by gangliosides. Sci STKE 2002;2002:RE15.
  20. Mitsuda T, Furukawa K, Fukumoto S, Miyazaki H, Urano T, Furukawa K. Overexpression of ganglioside GM1 results in the dispersion of platelet-derived growth factor receptor from glycolipid-enriched microdomains and in the suppression of cell growth signals. J Biol Chem 2002;277:11239–46.[Abstract/Free Full Text]
  21. Mutoh T, Tokuda A, Miyadai T, Hamaguchi M, Fujiki N. Ganglioside GM1 binds to the Trk protein and regulates receptor function. Proc Natl Acad Sci U S A 1995;92:5087–91.[Abstract/Free Full Text]
  22. Yamashita T, Hashiramoto A, Haluzik M, et al. Enhanced insulin sensitivity in mice lacking ganglioside GM3. Proc Natl Acad Sci U S A 2003;100:3445–9.[Abstract/Free Full Text]
  23. Inokuchi JI, Uemura S, Kabayama K, Igarashi Y. Glycosphingolipid deficiency affects functional microdomain formation in Lewis lung carcinoma cells. Glycoconj J 2000;17:239–45.[CrossRef][Medline]
  24. Nagafuku M, Kabayama K, Oka D, et al. Reduction of glycosphingolipid levels in lipid rafts affects the expression state and function of glycosylphosphatidylinositol-anchored proteins but does not impair signal transduction via the T cell receptor. J Biol Chem 2003;278:51920–7.[Abstract/Free Full Text]
  25. Simons K, Toomre D. Lipid rafts and signal transduction. Nat Rev Mol Cell Biol 2000;1:31–9.[CrossRef][Medline]
  26. Zambello R, Cabrelle A, Trentin L, Agostini C, Semenzato G, Viola A. The raft marker GM1 identifies functional subsets of granular lymphocytes in patients with CD3+ lymphoproliferative disease of granular lymphocytes. Leukemia 2004;18:771–6.[CrossRef][Medline]
  27. Decker T, Schneller F, Sparwasser T, et al. Immunostimulatory CpG-oligonucleotides cause proliferation, cytokine production, and an immunogenic phenotype in chronic lymphocytic leukemia B cells. Blood 2000;95:999–1006.[Abstract/Free Full Text]
  28. Inokuchi J, Radin NS. Preparation of the active isomer of 1-phenyl-2-decanoylamino-3-morpholino-1-propanol, inhibitor of murine glucocerebroside synthetase. J Lipid Res 1987;28:565–71.[Abstract]
  29. Ferch U, Meyer zum Buschenfelde C, Gewies A, et al. MALT1 directs B cell receptor-induced canonical nuclear factor-{kappa}B signaling selectively to the c-Rel subunit. Nat Immunol 2007;8:984–91.[CrossRef][Medline]
  30. Cheng PC, Dykstra ML, Mitchell RN, Pierce SK. A role for lipid rafts in B cell antigen receptor signaling and antigen targeting. J Exp Med 1999;190:1549–60.[Abstract/Free Full Text]
  31. Yanagisawa M, Nakamura K, Taga T. Glycosphingolipid synthesis inhibitor represses cytokine-induced activation of the Ras-MAPK pathway in embryonic neural precursor cells. J Biochem (Tokyo) 2005;138:285–91.[Abstract/Free Full Text]
  32. Chan HT, Hughes D, French RR, et al. CD20-induced lymphoma cell death is independent of both caspases and its redistribution into triton X-100 insoluble membrane rafts. Cancer Res 2003;63:5480–9.[Abstract/Free Full Text]
  33. Cragg MS, Glennie MJ. Antibody specificity controls in vivo effector mechanisms of anti-CD20 reagents. Blood 2004;103:2738–43.[Abstract/Free Full Text]
  34. Uchida J, Hamaguchi Y, Oliver JA, et al. The innate mononuclear phagocyte network depletes B lymphocytes through Fc receptor-dependent mechanisms during anti-CD20 antibody immunotherapy. J Exp Med 2004;199:1659–69.[Abstract/Free Full Text]
  35. Bezombes C, Grazide S, Garret C, et al. Rituximab antiproliferative effect in B-lymphoma cells is associated with acid-sphingomyelinase activation in raft microdomains. Blood 2004;104:1166–73.[Abstract/Free Full Text]
  36. Tepper AD, de Vries E, van Blitterswijk WJ, Borst J. Ordering of ceramide formation, caspase activation, and mitochondrial changes during CD95- and DNA damage-induced apoptosis. J Clin Invest 1999;103:971–8.[Medline]
  37. Li H, Ayer LM, Polyak MJ, et al. The CD20 calcium channel is localized to microvilli and constitutively associated with membrane rafts: antibody binding increases the affinity of the association through an epitope-dependent cross-linking-independent mechanism. J Biol Chem 2004;279:19893–901.[Abstract/Free Full Text]
  38. Deans JP, Kalt L, Ledbetter JA, Schieven GL, Bolen JB, Johnson P. Association of 75/80-kDa phosphoproteins and the tyrosine kinases Lyn, Fyn, and Lck with the B cell molecule CD20. Evidence against involvement of the cytoplasmic regions of CD20. J Biol Chem 1995;270:22632–8.[Abstract/Free Full Text]
  39. Hamaguchi Y, Uchida J, Cain DW, et al. The peritoneal cavity provides a protective niche for B1 and conventional B lymphocytes during anti-CD20 immunotherapy in mice. J Immunol 2005;174:4389–99.[Abstract/Free Full Text]
  40. Bennett M, Sharma K, Yegena S, Gavish I, Dave HP, Schechter GP. Rituximab monotherapy for splenic marginal zone lymphoma. Haematologica 2005;90:856–8.[Abstract/Free Full Text]
  41. Huhn D, von Schilling C, Wilhelm M, et al. Rituximab therapy of patients with B-cell chronic lymphocytic leukemia. Blood 2001;98:1326–31.[Abstract/Free Full Text]
  42. O'Brien SM, Kantarjian H, Thomas DA, et al. Rituximab dose-escalation trial in chronic lymphocytic leukemia. J Clin Oncol 2001;19:2165–70.[Abstract/Free Full Text]
  43. Keating MJ, O'Brien S, Albitar M, et al. Early results of a chemoimmunotherapy regimen of fludarabine, cyclophosphamide, and rituximab as initial therapy for chronic lymphocytic leukemia. J Clin Oncol 2005;23:4079–88.[Abstract/Free Full Text]
  44. Farag SS, Flinn IW, Modali R, Lehman TA, Young D, Byrd JC. Fc{gamma}RIIIa and Fc{gamma}RIIa polymorphisms do not predict response to rituximab in B-cell chronic lymphocytic leukemia. Blood 2004;103:1472–4.[Abstract/Free Full Text]
  45. Ghielmini M, Rufibach K, Salles G, et al. Single agent rituximab in patients with follicular or mantle cell lymphoma: clinical and biological factors that are predictive of response and event-free survival as well as the effect of rituximab on the immune system: a study of the Swiss Group for Clinical Cancer Research (SAKK). Ann Oncol 2005;16:1675–82.[Abstract/Free Full Text]
  46. Forstpointner R, Unterhalt M, Dreyling M, et al. Maintenance therapy with rituximab leads to a significant prolongation of response duration after salvage therapy with a combination of rituximab, fludarabine, cyclophosphamide, and mitoxantrone (R-FCM) in patients with recurring and refractory follicular and mantle cell lymphomas: results of a prospective randomized study of the German Low Grade Lymphoma Study Group (GLSG). Blood 2006;108:4003–8.[Abstract/Free Full Text]
  47. Ghielmini M, Schmitz SF, Cogliatti SB, et al. Prolonged treatment with rituximab in patients with follicular lymphoma significantly increases event-free survival and response duration compared with the standard weekly x 4 schedule. Blood 2004;103:4416–23.[Abstract/Free Full Text]
  48. Hainsworth JD, Litchy S, Barton JH, et al. Single-agent rituximab as first-line and maintenance treatment for patients with chronic lymphocytic leukemia or small lymphocytic lymphoma: a phase II trial of the Minnie Pearl Cancer Research Network. J Clin Oncol 2003;21:1746–51.[Abstract/Free Full Text]
  49. Hainsworth JD, Litchy S, Burris HA, et al. Rituximab as first-line and maintenance therapy for patients with indolent non-Hodgkin's lymphoma. J Clin Oncol 2002;20:4261–7.[Abstract/Free Full Text]
  50. Hainsworth JD, Litchy S, Shaffer DW, Lackey VL, Grimaldi M, Greco FA. Maximizing therapeutic benefit of rituximab: maintenance therapy versus re-treatment at progression in patients with indolent non-Hodgkin's lymphoma-a randomized phase II trial of the Minnie Pearl Cancer Research Network. J Clin Oncol 2005;23:1088–95.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 BloodHome page
N. A. Johnson, M. Boyle, A. Bashashati, S. Leach, A. Brooks-Wilson, L. H. Sehn, M. Chhanabhai, R. R. Brinkman, J. M. Connors, A. P. Weng, et al.
Diffuse large B-cell lymphoma: reduced CD20 expression is associated with an inferior survival
Blood, April 16, 2009; 113(16): 3773 - 3780.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meyer zum Büschenfelde, C.
Right arrow Articles by Peschel, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meyer zum Büschenfelde, C.
Right arrow Articles by Peschel, C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online