Cancer Research Targets Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Cancer Research 68, 5619, July 15, 2008. doi: 10.1158/0008-5472.CAN-08-1274
© 2008 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Daikoku, T.
Right arrow Articles by Dey, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Daikoku, T.
Right arrow Articles by Dey, S. K.

Molecular Biology, Pathobiology, and Genetics

Conditional Loss of Uterine Pten Unfailingly and Rapidly Induces Endometrial Cancer in Mice

Takiko Daikoku1, Yasushi Hirota1, Susanne Tranguch1, Ayesha R. Joshi5, Francesco J. DeMayo4, John P. Lydon4, Lora H. Ellenson5 and Sudhansu K. Dey1,2,3

Departments of 1 Pediatrics, 2 Cell and Developmental Biology, and 3 Pharmacology, Division of Reproductive and Developmental Biology, Vanderbilt University Medical Center, Nashville, Tenessee; 4 Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas; and 5 Department of Pathology and Laboratory Medicine, New York Presbyterian Hospital-Weill Medical College of Cornell University, New York, New York

Requests for reprints: Takiko Daikoku or Sudhansu K. Dey, Vanderbilt University, 1161 21st Avenue South, Nashville, TN 37232. Phone: 615-322-8642; Fax: 615-822-4794; E-mail: takiko.daikoku{at}cchmc.org or sk.dey{at}vanderbilt.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Etiology of endometrial cancer (EMC) is not fully understood. Animal models with rapidly and spontaneously developing EMC will help explore mechanisms of cancer initiation and progression. Pten+/– mice are currently being used as a model to study EMC. These females develop atypical endometrial hyperplasia of which ~20% progresses to EMC. In addition, tumors develop in other organs, complicating the use of this model to specifically study EMC. Here, we show that conditional deletion of endometrial Pten results in EMC in all female mice as early as age 1 month with myometrial invasion occurring by 3 months. In contrast, conditional deletion of endometrial p53 had no phenotype within this time frame. Whereas mice with endometrial Pten deletion had a life span of ~5 months, mice with combined deletion of endometrial Pten and p53 had a shorter life span with an exacerbated disease state. Such rapid development of EMC from homozygous loss of endometrial Pten suggests that this organ is very sensitive to this tumor suppressor gene for tumor development. All lesions at early stages exhibited elevated Cox-2 and phospho-Akt levels, hallmarks of solid tumors. More interestingly, levels of two microRNAs miR-199a* and miR-101a that posttranscriptionally inhibit Cox-2 expression were down-regulated in tumors in parallel with Cox-2 up-regulation. This mouse model in which the loxP-Cre system has been used to delete endometrial Pten and/or p53 allows us to study in detail the initiation and progression of EMC. These mouse models have the added advantage because they mimic several features of human EMC. [Cancer Res 2008;68(14):5619–27]


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Endometrial cancer (EMC) is a common gynecologic malignancy, affecting ~40,000 women and leading to ~7,000 deaths each year in the United States alone (1). The etiology of EMC is not yet fully understood, although there is evidence that endocrine and genetic factors contribute to its initiation and progression (1). EMC is categorized into two major types, type I and II, with ~85% of EMCs classified as type I. Type I EMC is divided into well-, moderately, and poorly differentiated grades, depending on t he degree of solid tumor growth. Type II EMC, while uncommon, is more aggressive (1, 2).

In human type I EMCs, the most common genetic mutations are detected in the phosphatase and tensin homologue (Pten)gene (1, 3). Pten mutations are observed in 30% to 80% of type I EMCs and in ~20% of complex atypical hyperplasia (CAH), a precursor to type I EMC. Mutations of p53 are also found in type I EMC, but this alteration occurs in ~50% of poorly differentiated carcinomas and some moderately differentiated type I EMCs, suggesting that p53 mutations are later events that contribute to progression of the disease (1). On the other hand, the majority of type II EMCs, which are more aggressive and less common, mainly contain p53, but not Pten, mutations (1, 2).

The most widely used animal model for studying EMC is Pten heterozygous mice (3). Although Pten homozygous null mice are unavailable due to their embryonic lethality, all Pten heterozygous females develop atypical endometrial hyperplasia with 20% progressing to well-differentiated EMC by age 10 months. The timing and incidence of hyperplasia and carcinoma vary from mouse to mouse in this model (3, 4). Furthermore, Pten heterozygous mice also develop other types of cancer, creating limitations to exclusively study EMC in this model. With respect to p53, both p53 heterozygous and homozygous mice develop many types of cancers, with most homozygous mice dying by age 6 months due to development of widespread lymphoma (5–7). However, EMCs are rarely observed in p53 null mice (5–7). Therefore, endometrial-specific Pten and/or p53-deleted mice would be more preferred models to study endometrial-specific cancer.

Pten is a dual-specificity phosphatase with phosphatidylinositol-3,4,5-phosphate (PIP3) a major substrate. PIP3 is dephosphorylated to phosphatidylinositol-4,5-phosphate by Pten, an event that opposes phosphatidylinositol-3-kinase (PI3K) signaling (8). Loss of Pten function, resulting in stimulation of PI3K signaling, is widely found in many types of cancers. PI3K activates Akt, a serine-threonine kinase, and phosphorylated/activated Akt regulates a variety of target molecules that control cell survival and growth. It was recently shown that introducing Akt deficiency in Pten heterozygous mice impedes tumor development including that of EMC (9), suggesting pAkt to be an immediate downstream molecule of Pten. Cox-2 is a major target of Akt signaling in cancer, overexpressed in tumors and carcinomas of the colon, breast, and lung (10). We and others have shown that human EMCs and endometria with hyperplasia express elevated Cox-2 (11–13). Moreover, Cox-2 expression is also elevated in human EMC cell lines harboring Pten mutations and activated Akt (14, 15). These studies collectively indicate that elevated pAkt and Cox-2 levels resulting from Pten mutations probably contribute to EMC development.

In this study, endometrial-specific Pten and/or p53 deletion were generated by crossing floxed Pten (PtenloxP/loxP) and/or floxed p53 (p53loxP/loxP) mice with mice expressing Cre under the regulation of the progesterone receptor promoter (PRcre/+; ref. 16). We found that 100% of PtenloxP/loxP/PRcre/+ (Ptenpr–/–) and PtenloxP/loxP/p53loxP/loxP/PRcre/+ (Ptenpr–/–/p53pr–/–) mice develop in situ carcinoma as early as ages 3 weeks to 1 month. Although the development of hyperplasia was similar between Ptenpr–/– and Ptenpr–/–/p53pr–/– mice, the loss of both Pten and p53 exacerbated the disease state and was associated with a shorter life span. In contrast, p53loxP/loxP/PRcre/+ (p53pr–/–) mice had apparently normal endometrial histology even through age 5 months. We found that Cox-2 and phospho-Akt (pAkt) were up-regulated in regions with hyperplasia and carcinoma in both Ptenpr–/– and Ptenpr–/–/p53pr–/– uteri. Additionally, microRNAs (miRNA) miR-199a* and miR-101a, which are known to posttranscriptionally impede Cox-2 expression in the mouse uterus and human cancer cell lines (17), were down-regulated in Ptenpr–/– and Ptenpr–/–/p53pr–/– uteri. These mouse models have provided valuable information on genetic, temporal, and dynamic aspects of EMC initiation and progression. Our findings present an opportunity for further study, especially with regards to drug development focused at EMC treatment at early stages.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosure of Potential...
 References
 
Mice. All mice were housed in the Institutional Animal Care Facility according to NIH and institutional guidelines for laboratory animals. PtenloxP/loxP mice were obtained from Jackson Laboratory, and p53loxP/loxP mice were obtained from the Mouse Models of Human Cancers Consortium (National Cancer Institute). PR-Cre (PRcre/+; C57BL6/129SV) mice were obtained from John B. Lydon (Baylor College of Medicine). PRcre/+ mice have Cre recombinase introduced into exon 1 of the PR gene (16). Therefore, Cre expression is regulated by the endogenous progesterone receptor (PR) promoter. PR-Cre heterozygous (PRcre/+) mice are phenotypically indistinguishable from wild-type mice (16). PtenloxP/loxP, p53loxP/loxP, and PRcre/+ mice were generated as described previously (16, 18, 19). PCR analysis of tail genomic DNA determined the genotypes of mutant mice. Standard breeding strategies were used to generate conditional deletion of Pten and/or p53 using transgenic mice (20). Bilateral ovariectomy was performed under appropriate anesthesia. Because the currently used Ptenpr–/–, p53pr–/–, and Ptenpr–/–/p53pr–/– mouse models are on mixed backgrounds, we consistently used littermate floxed (wild-type) mice in all of our experiments. This ensures that results obtained within each experimental set are meaningful.

Western blot analysis. Tissue samples were prepared as previously described (21). After measuring protein concentrations, supernatants mixed with SDS sample buffer were boiled for 5 min. The samples were run on 10% SDS-PAGE gels under reducing conditions and transferred onto nitrocellulose membranes. Membranes were blocked with 10% milk in TBST and probed with antibodies to Pten (Cell Signaling), pAkt (Cell Signaling), p53 (Cell Signaling), Cox-2 (Cayman), or actin (SantaCruz) overnight at 4°C. After washing, blots were incubated in peroxidase-conjugated donkey-anti-goat IgG, donkey-anti-rabbit IgG, or donkey-anti-mouse IgG (Jackson Immuno Research Laboratories, Inc.). For secondary antibody detection of p53, mouse-IgG Trueblot (eBioscience) was used to remove IgG signals. All signals were detected using chemiluminescent reagents (GE Healthcare). Actin served as a loading control.

Immunohistochemistry. Immunohistochemistry was performed as previously described by us (21). In brief, formalin-fixed paraffin-embedded sections (6 µm) were subjected to immunostaining using antibodies to cytokeratin 8 (CK8; Developmental Studies Hybridoma Bank), Pten, pAkt, Cox-2, Ki-67 (Lab Vision Corporation), or {alpha}-smooth muscle actin ({alpha}-SMA; Abcam). After deparaffinization and hydration, sections were subjected to antigen retrieval by autoclaving in 10 mmol/L sodium citrate solution (pH = 6) for 10 min. A Histostain-Plus kit (Invitrogen) was used to visualize antigens.

In situ hybridization. cDNA clones for Cox-2 have previously been described (22, 23). cDNA clones for p53 were generated by reverse transcription-PCR (RT-PCR). Sense and antisense 35S-labeled cRNA probes were generated using Sp6 or T7 RNA polymerases. Frozen uterine sections were used for in situ hybridization. Uteri from 10-d-old and 3-wk-old mice were placed inside a small groove made on a piece of kidney as a holding cassette because they are extremely tiny, and then snap frozen for cryosectioning. In situ hybridization was performed as previously described (21). Sections hybridized with sense probes did not exhibit any positive signals and served as negative controls.

RT-PCR. RT-PCR was performed as previously described (21). Primers to detect p53 are 5' ACAGGACCCTGTCACCGAGACC 3' and 5' GACCTCCGTCATGTGCTGTGAC 3'.

Northern hybridization. Northern blotting of miRNA was performed as previously described (17). Total RNA (20 µg) was resolved through a 12.5% urea-polyacrylamide gel, transferred onto GeneScreen Plus membranes (PerkinElmer), and UV crosslinked. Antisense oligonucleotide (IDT) was labeled with 32P with a StarFire labeling kit (IDT). Prehybridization, hybridization, and washing were performed at 42°C.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosure of Potential...
 References
 
PR-Cre efficiently deletes endometrial Pten and p53. Our objective was to study endometrial-specific cancer by conditional deletion of Pten, p53, or both in the mouse endometrium. We therefore crossed Pten (PtenloxP/loxP), p53 (p53loxP/loxP), or Pten/p53 (PtenloxP/loxP/p53loxP/loxP) floxed mice with PRcre/+ mice. We have previously used PRcre/+ mice to delete endometrial genes to examine the roles of Hbegf and Bmp2 in pregnancy (20, 24). As shown in Supplementary Fig. S1, endometrial Pten and p53 are deleted by PR-driven Cre activity as confirmed by conventional genotyping.

We next confirmed loss of Pten protein in Ptenpr–/– uterine lysates by Western blotting. As shown in Fig. 1A (top), Pten levels were drastically reduced in Ptenpr–/– uteri from age 3 wk with concomitant increases in Akt phosphorylation (pAkt). This observation of Akt activation with the loss of Pten is consistent with previous findings in other systems (25). We also used immunohistochemistry to monitor cell-specific down-regulation of Pten and up-regulation of Akt activation (Fig. 1A, bottom). Pten levels were efficiently down-regulated in uteri of Ptenpr–/– mice from as early as age 10 days substantiating the Western blot results. Although levels of pAkt were low to undetectable in wild-type uteri with normal levels of Pten, pAkt levels were remarkably up-regulated in Ptenpr–/– uteri in both 10-day-old and 3-week-old mice (Fig. 1A, bottom). Similar analyses were carried out using Ptenpr–/–/p53pr–/– uteri. Western blotting and in situ hybridization showed decreased p53 expression in Ptenpr–/–/p53pr–/– uteri as expected (Fig. 1B). Loss of both Pten and p53 in these mice was also accompanied by heightened levels of pAkt (Fig. 1B, left). Loss of p53 in p53pr–/– uteri was confirmed by RT-PCR (Fig. 1C). Collectively, PR-Cre efficiently deletes endometrial Pten and p53.


Figure 1
View larger version (64K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. PR-Cre efficiently deletes endometrial Pten and p53. A, Western blot analysis of Pten, pAkt, and total Akt in wild-type and Ptenpr–/– uteri (top). Immunohistochemistry of Pten and pAkt in 10-d-old (10 d) and 3-wk-old (3 wk) Ptenpr–/– and wild-type uteri (bottom). Bar, 200 µm. le, luminal epithelium; ge, glandular epithelium; s, stroma; myo, myometrium. B, Western blot analysis of p53, Pten, pAkt, and total Akt in wild-type and Ptenpr–/–/p53pr–/– uteri (left). Actin serves as a loading control. In situ hybridization of p53 in 3-wk-old wild-type and Ptenpr–/–/p53pr–/– uteri (right). Because of extremely tiny sizes of uteri, all wild-type and Ptenpr–/– uteri from 10-d-old and 3-wk-old mice were placed into small grooves made in kidney slices to serve as cassettes for making frozen sections. Bar, 400 µm. Kid, kidney. C, RT-PCR of p53 in wild-type and p53pr–/– uteri. β-Actin is a housekeeping gene.

 
Endometrial deletion of Pten induces EMC. Our next objective was to examine whether endometrial deletion of Pten in mice results in EMC. To address this question, we examined histology of Ptenpr–/– and/or p53pr–/– uteri. Ptenpr–/– uteri showed endometrial epithelial hyperplasia as early as age 10 days (Fig. 2A ). Staining with CK8, an epithelial cell-specific marker, showed luminal and glandular epithelial hyperplasia in Pten-deleted uteri from mice as young as 10 days. Hyperplasia progressed to carcinoma by age 1 month with invasion into the myometrium occurring by 3 months (Fig. 2A). Myometrial invasion was confirmed by {alpha}-SMA immunostaining (Supplementary Fig. S2). Detailed characterization of tumor types and grades are shown (Table 1 ). These results show that conditional deletion of endometrial Pten specifically results in EMC rapidly with 100% penetrance, a much more drastic phenotype than observed in mice heterozygous for Pten deletion.


Figure 2
View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Uteri from Ptenpr–/– and Ptenpr–/–/p53pr–/– mice show aberrant histology and their loss affects survival. Histology of (A) Ptenpr–/– and (B) Ptenpr–/–/p53pr–/– uteri. H&E and CK8 staining of (A) Ptenpr–/– and (B) Ptenpr–/–/p53pr–/– uteri in mice at various ages (10 d, 3 wk, 1, 2, and 3 mo). le, luminal epithelium; ge, glandular epithelium; s, stroma; myo, myometrium. C, effects of endometrial loss of Pten and/or p53 on survival. Wild-type, Ptenpr–/–, p53pr–/–, and Ptenpr–/–/p53pr–/– mice were monitored for any sign of sickness for a total of 250 d. We sacrificed mice with any sign of sickness or discomfort, and the day of sacrifice was recorded.

 

View this table:
[in this window]
[in a new window]

  		Table 1. EMCs in mice with uterine loss of Pten and/or p53

 
We next examined the effects of combined deletion of p53 and Pten. Histologic analyses of PtenloxP/loxP/p53loxP/loxP/PRcre/+ (Ptenpr–/–/p53pr–/–) uteri after staining with H&E showed that Ptenpr–/–/p53pr–/– uteri were enlarged compared with those of Ptenpr–/–, with luminal and glandular hyperplasia (Fig. 2B). Lesions were observed as early as age 10 days similar to the time frame noted in Ptenpr–/– uteri (Fig. 2B). Furthermore, these lesions progressed to in situ carcinoma by age 3 weeks (Table 1). Uteri from wild-type mice did not exhibit any pathology. We next examined p53pr–/– uteri. Although loss of endometrial p53 expression was seen in mice as young as age 3 weeks (Fig. 1C), endometrial morphology and histology seemed normal through age 5 months (Supplementary Fig. S3; Supplementary Table S1).

Endometrial deletion of both Pten and p53 advances mortality. In human, loss of Pten and p53 increases severity of EMC development when compared with those with only Pten mutation (1, 2). However, we observed similar histology between Ptenpr–/– and Ptenpr–/–/p53pr–/– uteri during EMC initiation. A close monitoring of conditionally deleted mice for sickness during the tenure of these experiments revealed that loss of both Pten and p53 affects their survival as early as age 2 months, whereas loss of Pten alone does not affect longevity until around 5 months, with deletion of p53 alone affecting viability even later (Fig. 2C). H&E staining of uterine sections from Ptenpr–/–/p53pr–/– uteri indicate that the cause of early death in these mice is due to excess uterine bleeding due to invasion of uterine blood vessels by tumor cells (Supplementary Fig. S4). At sacrifice, extensive blood clots on the surface of the entire uterus were visible in these mice.

Endometrial deletion of Pten or of both Pten and p53 induces epithelial Cox-2 expression and proliferation. Cox-2 is a downstream target of pAkt signaling and associated with development of many types of cancers (14, 26). Thus, we examined Cox-2 expression in Ptenpr–/– uteri. As shown in Fig. 3A , levels of Cox-2 protein increased in Ptenpr–/– uteri compared with wild-type uteri from age 3 weeks. Interestingly, uterine levels of Cox-1 were very low to undetectable at these time points irrespective of genotype (Fig. 3A). Levels of Cox-2 transcripts as determined by RT-PCR correlated well with Cox-2 protein levels (Fig. 3B). We also used in situ hybridization (Fig. 3C) and immunohistochemistry (Fig. 3D) to determine the spatiotemporal expression of Cox-2. We observed increased Cox-2 mRNA and Cox-2 protein levels primarily in endometrial epithelia of Ptenpr–/– mice. As expected, Cox-2 expression was low to undetectable in wild-type uteri. This observation is similar to higher Cox-2 expression that is observed in human type I EMC (12, 13).


Figure 3
View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Heightened Cox-2 expression in Ptenpr–/– uteri with EMC. A, Western blot analysis of Cox-2 and Cox-1 in Ptenpr–/– uteri. Actin serves as control. B, RT-PCR of Cox-2 in Ptenpr–/– uteri. β-Actin is a housekeeping gene. WT, wild-type; KO, Ptenpr–/–. C, in situ hybridization of Cox-2 in Ptenpr–/– and wild-type (Pten+/+) uteri. Bar, 400 µm. le, luminal epithelium; ge, glandular epithelium; s, stroma; myo, myometrium; Kid, kidney. D, immunohistochemistry of Cox-2 in uteri of 3-wk-old Ptenpr–/– and wild-type (Pten+/+) mice. Bar, 400 µm.

 
Heightened levels of Cox-2 protein and mRNA were also observed in Ptenpr–/–/p53pr–/– uteri (Fig. 4A–C and D, top ). In contrast, levels of Cox-2 transcripts remained very low and unaltered in endometria deleted with p53 alone (Supplementary Fig. S5). Because Cox-2 is known to stimulate cell proliferation in other cancers, we performed Ki67 immunostaining in uterine sections of wild-type, Ptenpr–/– or Ptenpr–/–/p53pr–/– mice at age 3 weeks. We observed increased Ki67-positive cells primarily in the epithelia of both Ptenpr–/– and Ptenpr–/–/p53pr–/– uteri compared with wild-type mice (Fig. 4D, bottom). Because levels of Cox-2 expression were lower in Ptenpr–/–/p53pr–/– uteri of 2-month-old mice, we also performed Ki67 immunostaining to determine the proliferation status (Fig. 4D, bottom). We found a correlation between Cox-2 expression and proliferation index. Uteri with low Cox-2 expression at 2 months also had reduced Ki-67 staining. This is in contrast with the observed higher Cox-2 expression and Ki-67 staining in 3-week-old tumors (Fig. 4D, bottom). It is important to note, however, that immunostaining of Ki67 was noted at the leading edge of tumors in uteri of older mice. This agrees with previous studies showing that the middle of tumors is hypoxic and necrotic (27). These findings in our Ptenpr–/– and Ptenpr–/–/p53pr–/– mice are exciting and identify these two mouse models as suitable systems for studying human type I EMC.


Figure 4
View larger version (88K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. Cox-2 expression and cell proliferation in Ptenpr–/–/p53pr–/– uteri. A, Western blot analysis of Cox-2 and Cox-1 in Ptenpr–/–/p53pr–/– uteri. Actin serves as control. B, RT-PCR of Cox-2 in Ptenpr–/–/p53pr–/– uteri. β-Actin is a housekeeping gene. C, in situ hybridization of Cox-2 in Ptenpr–/–/p53pr–/– and wild-type uteri. Bar, 400 µm. D, immunohistochemistry of Cox-2 in 3-wk-old Ptenpr–/–/p53pr–/– and wild-type mice (top). Immunohistochemistry of Ki67 in 3-wk-old and 2-mo-old Ptenpr–/– and Ptenpr–/–/p53pr–/– and wild-type uteri (bottom). Arrowheads, leading edge. Bar, 200 µm. le, luminal epithelium; ge, glandular epithelium; s, stroma; myo, myometrium; Kid, kidney; T, tumor.

 
Down-regulation of miR-199a* and miR-101a correlates with heightened Cox-2 expression in endometrial carcinogenesis. miRNAs are noncoding small RNAs (19–22 nucleotides) transcribed from genomic DNAs. These small RNAs influence posttranscriptional gene expression and effect various biological events (28, 29). Recent studies have shown differential expression of various miRNAs in certain cancers compared with normal tissues. This differential expression is thought to affect the tumor suppressor genes such as p27 and cyclin G1 (30, 31). We recently found that miR-199a* and miR-101a posttranscriptionally suppress Cox-2 expression in a human cancer cell line (17). We also observed that these miRNAs colocalize with Cox-2 in the mouse uterus during implantation and regulate its protein levels at the implantation site (17). Thus, we examined whether expression levels of these two miRNAs are affected by endometrial carcinogenesis in Ptenpr–/– or Ptenpr–/–/p53pr–/– uteri. We observed that Cox-2 overexpression in Ptenpr–/– uteri (Fig. 3) is indeed correlated with decreased levels of miR-199a* and miR-101a expression (Fig. 5A ). The expression of these miRNAs is also reduced in Ptenpr–/–/p53pr–/– uteri with elevated Cox-2 expression (Fig. 5B). These data suggest that miR-199a* and miR-101a play roles in regulating Cox-2 expression in EMC.


Figure 5
View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. Levels of miR-199a* and miR-101a expression are reduced in uteri with EMC. Northern blot analysis of (A) Pten+/+ (WT) versus Ptenpr–/– (KO) uteri and (B) Pten+/+/p53+/+ (WT) versus Ptenpr–/–/p53pr–/– (KO) uteri. Stained gels served as loading controls.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosure of Potential...
 References
 
Mutations of tumor suppressor genes are linked to carcinogenesis in various organ systems. Unfortunately, systemic deletion of these genes in mice often results in embryonic lethality. The loxP-Cre system allows for tissue-specific and temporal deletion of tumor suppressor genes (32, 33). The goal of this study was to take advantage of the loxP-Cre system to generate conditional deletion of Pten and/or p53 in the uterus to study the initiation and progression of endometrial carcinoma. Because there is no endometrial-specific promoter identified as of yet, PR-Cre mice are being widely used to delete floxed genes in the uterus (16, 20, 24). It is to be noted, however, that PR is also expressed in tissues such as oviduct, ovary, mammary gland, and pituitary. Our current study shows that EMC develops in Ptenpr–/– or Ptenpr–/–/p53pr–/– mice within age 3 weeks to 1 month with no evidence of cancers in other tissues, including those that express PR. One reason for development of endometrial-specific cancer could perhaps be attributed to increased sensitivity of the uterus to Pten loss. Nonetheless, this endometrial-specific phenotype demonstrates the importance of Pten loss in the initiation of EMC. Studies in humans have shown that type I EMC originates mainly from the epithelial components and not the stroma; however PR is expressed in both epithelia and stroma (1). Therefore, whether EMC in Ptenpr–/– or Ptenpr–/–/p53pr–/– mice originates from epithelial or stromal components remains to be determined. Because Pten is expressed primarily in endometrial epithelia during early neonatal development, it is speculated that cancer is initiated in this compartment due to the loss of Pten. Definitive answers to the specific roles of epithelial versus stromal Pten in EMC will require epithelial-specific loxP-Cre and stromal-specific loxP-Cre systems for deletion of Pten.

We observed that the combined loss of Pten and p53 resulted in a shorter life span compared with mice with single deletion of either Pten or p53. Previous reports suggested a role for p53 in advanced type I EMC in women (1). Therefore, we speculated that superimposing p53 mutation on Pten deletion would aggravate the disease condition. Our findings of shorter life span of Ptenpr–/–/p53pr–/– mice supports this hypothesis, with the cause of early death attributed to excessive uterine bleeding due to invasion of uterine blood vessels by invasive tumor cells. As a note, type II EMC, which comprises only 10% to 15% of all EMCs, shows a high frequency of p53 mutations. This is contrary to our observation that uterine deletion of p53 does not cause cancer in mice (1). Therefore, understanding the role of p53 mutations in EMC requires further studies.

Our findings of deletion of both p53 and Pten aggravating the mortality rate are consistent with a similar study that used conditional deletion of Pten to induce prostate cancer (32). In this study, the investigators used Ptenloxp/loxp/probasin-Cre mice and showed that Pten deletion alone did not increase the incidence of mortality, but the combined deletion of both Pten and p53 did. Their explanation for this observation was that deletion of Pten alone resulted in p53 up-regulation, which protected cells from senescence (32). We also observed p53 up-regulation primarily in endometrial epithelia of Ptenpr–/– mice (data not shown), consistent with their explanation. Another possibility is that PR-Cre driven deletion of Pten and p53 results in deleterious effects on immune cells. Studies have shown that T-cell or B-cell–specific deletion of Pten results in T-cell lymphomas or defects in class switch recombination (reviewed in ref. 34). It seems unlikely that local immune complications contribute to the progression of EMC in Ptenpr–/–/p53pr–/– mice because neither estrogen receptor nor PR is expressed in uterine lymphocytes, macrophages, or natural killer cells (35, 36).

Because EMC is also known to be influenced by hormonal components (1), we ovariectomized Ptenpr–/–/p53pr–/– mice age 3 weeks to evaluate the contribution of ovarian steroid hormones. We found that ovariectomizing these mice did not minimize tumor development when examined at 2 months (Supplementary Fig. S6), suggesting limited contribution of ovarian steroid hormones to EMC progression induced by Pten and p53 mutations.

Cox-2 is thought to play an important role in carcinogenesis and is overexpressed in a number of solid tumors, including colorectal, breast and lung cancers (10). Treatments with nonsteroidal anti-inflammatory drugs (NSAIDs) that inhibit Cox activity have been shown to be effective in the chemoprevention of many types of solid tumors. In fact, even their daily consumption reduces the risk of certain cancers (37–40). Our study showing elevated Cox-2 expression at the early stages of hyperplasia and carcinoma in both Ptenpr–/– and Ptenpr–/–/p53pr–/– mice suggests that NSAIDs could be considered potential treatment options for type I EMC patients at early stages. Unfortunately, recent clinical studies show that prolonged use of highly selective Cox-2 inhibitors, such as Vioxx, leads to increased myocardial infarctions and stroke. However, NSAIDs such as aspirin or naproxen show lesser side effects and are still being widely used to combat inflammatory diseases and to reduce the risk of developing cancers.

Although Cox-2 expression was elevated in the early stages of hyperplasia and carcinoma, we were initially surprised to observe its gradual disappearance with cancer progression. However, it has been shown that Cox-2 is often associated with early stages of cancer in both liver and uterine cancers, and then is down-regulated with tumor advancement (41, 42). In uterine cancers, levels of Cox-2 correlate with vascular endothelial growth factor expression, implicating their roles in angiogenesis at early stages (42). These studies suggest the potential for NSAIDs treatment to prevent recurrence of EMCs.

Our observations of increased levels of pAkt and Cox-2 at early stages of EMC suggest that the Pten-Akt-Cox-2 signaling axis is important for the initiation of tumor growth. The accelerated growth perhaps occurs due to increased cell proliferation that is evident from Ki67 staining even at age three weeks. Our results showing decreased expression of miR-199a* and miR-101a with enhanced Cox-2 levels in Ptenpr–/– and Ptenpr–/–/p53pr–/– uteri also suggests their close relationship with Cox-2 status in the uterus as we have previously shown (17). However, it is not known whether Pten directly regulates the expression of these miRNAs or their down-regulation is a consequence of the development of EMC with enhanced Cox-2 expression. Nonetheless, these miRNAs are potential targets for anticancer therapy because of their role in down-regulating Cox-2 levels.

In conclusion, the present study presents mouse models that rapidly and unfailingly produce EMC, many characteristics of which mimic human EMC. These models will help delineate other downstream signaling pathways critical to the initiation and progression of human EMC.


   Disclosure of Potential Conflicts of Interest
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
References
 
No potential conflicts of interest were disclosed.


   Acknowledgments
 
Grant support: United States Public Health Service Grants, P01-CA-77839 (R.N. DuBois); VICC-Meharry U54CA091405-06 and HD12304 (S.K. Dey) and U01 CA105352-01/05 (F. DeMayo); Vanderbilt-Ingram Cancer Center Support Grant P30CA068485 and Gynecologic Cancer Foundation Awards/Ann Schreiber Ovarian Cancer Research Grant (T. Daikoku); a Research Fellowship from the Japan Society for the Promotion of Science for Young Scientists (Y. Hirota); and the National Institute of Child Health and Human Resources Training Grant 2THD007043 (S. Tranguch).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Satoshi Umezawa (Musashino RedCross Hospital, Tokyo, Japan) for his scientific advice.


   Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Current address for T. Daikoku: Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio.

Received 4/ 7/08. Revised 5/13/08. Accepted 5/15/08.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Di Cristofano A, Ellenson LH. Endometrial Carcinoma. Annu Rev Pathol 2007;2:57–87.[CrossRef][Medline]
  2. Baergen RN, Warren CD, Isacson C, Ellenson LH. Early uterine serous carcinoma: clonal origin of extrauterine disease. Int J Gynecol Pathol 2001;20:214–9.[CrossRef][Medline]
  3. Podsypanina K, Ellenson LH, Nemes A, et al. Mutation of Pten/Mmac1 in mice causes neoplasia in multiple organ systems. Proc Natl Acad Sci U S A 1999;96:1563–8.[Abstract/Free Full Text]
  4. Di Cristofano A, Pesce B, Cordon-Cardo C, Pandolfi PP. Pten is essential for embryonic development and tumour suppression. Nat Genet 1998;19:348–55.[CrossRef][Medline]
  5. Donehower LA, Harvey M, Slagle BL, et al. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 1992;356:215–21.[CrossRef][Medline]
  6. Harvey M, McArthur MJ, Montgomery CA, Jr., Bradley A, Donehower LA. Genetic background alters the spectrum of tumors that develop in p53-deficient mice. FASEB J 1993;7:938–43.[Abstract]
  7. Jacks T, Remington L, Williams BO, et al. Tumor spectrum analysis in p53-mutant mice. Curr Biol 1994;4:1–7.[Medline]
  8. Luo J, Manning BD, Cantley LC. Targeting the PI3K-Akt pathway in human cancer: rationale and promise. Cancer cell 2003;4:257–62.[CrossRef][Medline]
  9. Chen ML, Xu PZ, Peng XD, et al. The deficiency of Akt1 is sufficient to suppress tumor development in Pten+/- mice. Genes Dev 2006;20:1569–74.[Abstract/Free Full Text]
  10. Turini ME, DuBois RN. Cyclooxygenase-2: a therapeutic target. Annu Rev Med 2002;53:35–57.[CrossRef][Medline]
  11. Hasegawa K, Ohashi Y, Ishikawa K, et al. Expression of cyclooxygenase-2 in uterine endometrial cancer and anti-tumor effects of a selective COX-2 inhibitor. Int J Oncol 2005;26:1419–28.[Medline]
  12. Nasir A, Boulware D, Kaiser HE, et al. Cyclooxygenase-2 (COX-2) expression in human endometrial carcinoma and precursor lesions and its possible use in cancer chemoprevention and therapy. In Vivo 2007;21:35–43.[Abstract/Free Full Text]
  13. Tong BJ, Tan J, Tajeda L, et al. Heightened expression of cyclooxygenase-2 and peroxisome proliferator-activated receptor-{delta} in human endometrial adenocarcinoma. Neoplasia 2000;2:483–90.[CrossRef][Medline]
  14. St-Germain ME, Gagnon V, Mathieu I, Parent S, Asselin E. Akt regulates COX-2 mRNA and protein expression in mutated-PTEN human endometrial cancer cells. Int J Oncol 2004;24:1311–24.[Medline]
  15. St-Germain ME, Gagnon V, Parent S, Asselin E. Regulation of COX-2 protein expression by Akt in endometrial cancer cells is mediated through NF-{kappa}B/I{kappa}B pathway. Mol Cancer 2004;3:7.[CrossRef][Medline]
  16. Soyal SM, Mukherjee A, Lee KY, et al. Cre-mediated recombination in cell lineages that express the progesterone receptor. Genesis 2005;41:58–66.[CrossRef][Medline]
  17. Chakrabarty A. TS, Daikoku T, Jensen K, Furneaux H, Dey SK. MicroRNA Regulation of Cyclooxygenase-2 during Embryo Implantation. Proc Natl Acad Sci U S A 2007;104:15144–9.[Abstract/Free Full Text]
  18. Flesken-Nikitin A, Choi KC, Eng JP, Shmidt EN, Nikitin AY. Induction of carcinogenesis by concurrent inactivation of p53 and Rb1 in the mouse ovarian surface epithelium. Cancer Res 2003;63:3459–63.[Abstract/Free Full Text]
  19. Lesche R, Groszer M, Gao J, et al. Cre/loxP-mediated inactivation of the murine Pten tumor suppressor gene. Genesis 2002;32:148–9.[CrossRef][Medline]
  20. Xie H, Wang H, Tranguch S, et al. Maternal heparin-binding-EGF deficiency limits pregnancy success in mice. Proc Natl Acad Sci U S A 2007;104:18315–20.[Abstract/Free Full Text]
  21. Daikoku T, Tranguch S, Trofimova IN, et al. Cyclooxygenase-1 is overexpressed in multiple genetically engineered mouse models of epithelial ovarian cancer. Cancer Res 2006;66:2527–31.[Abstract/Free Full Text]
  22. Daikoku T, Wang D, Tranguch S, et al. Cyclooxygenase-1 is a potential target for prevention and treatment of ovarian epithelial cancer. Cancer Res 2005;65:3735–44.[Abstract/Free Full Text]
  23. Tan J, Paria BC, Dey SK, Das SK. Differential uterine expression of estrogen and progesterone receptors correlates with uterine preparation for implantation and decidualization in the mouse. Endocrinology 1999;140:5310–21.[Abstract/Free Full Text]
  24. Lee KY, Jeong JW, Wang J, et al. Bmp2 is critical for the murine uterine decidual response. Mol Cell Biol 2007;27:5468–78.[Abstract/Free Full Text]
  25. Cantley LC, Neel BG. New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway. Proc Natl Acad Sci U S A 1999;96:4240–5.[Abstract/Free Full Text]
  26. Pommery N, Henichart JP. Involvement of PI3K/Akt pathway in prostate cancer-potential strategies for developing targeted therapies. Mini Rev Med Chem 2005;5:1125–32.[CrossRef][Medline]
  27. Neeman M, Abramovitch R, Schiffenbauer YS, Tempel C. Regulation of angiogenesis by hypoxic stress: from solid tumours to the ovarian follicle. Int J Exp Pathol 1997;78:57–70.[CrossRef][Medline]
  28. Du T, Zamore PD. microPrimer: the biogenesis and function of microRNA. Development 2005;132:4645–52.[Abstract/Free Full Text]
  29. Nilsen TW. Mechanisms of microRNA-mediated gene regulation in animal cells. Trends Genet 2007;23:243–9.[CrossRef][Medline]
  30. le Sage C, Nagel R, Egan DA, et al. Regulation of the p27(Kip1) tumor suppressor by miR-221 and miR-222 promotes cancer cell proliferation. EMBO J 2007;26:3699–708.[CrossRef][Medline]
  31. Gramantieri L, Ferracin M, Fornari F, et al. Cyclin G1 is a target of miR-122a, a microRNA frequently down-regulated in human hepatocellular carcinoma. Cancer Res 2007;67:6092–9.[Abstract/Free Full Text]
  32. Chen Z, Trotman LC, Shaffer D, et al. Crucial role of p53-dependent cellular senescence in suppression of Pten-deficient tumorigenesis. Nature 2005;436:725–30.[CrossRef][Medline]
  33. Zhou Z, Flesken-Nikitin A, Corney DC, et al. Synergy of p53 and Rb deficiency in a conditional mouse model for metastatic prostate cancer. Cancer Res 2006;66:7889–98.[Abstract/Free Full Text]
  34. Kishimoto H, Hamada K, Saunders M, et al. Physiological functions of Pten in mouse tissues. Cell Struct Funct 2003;28:11–21.[CrossRef][Medline]
  35. Henderson TA, Saunders PT, Moffett-King A, Groome NP, Critchley HO. Steroid receptor expression in uterine natural killer cells. J Clin Endocrinol Metab 2003;88:440–9.[Abstract/Free Full Text]
  36. King A, Gardner L, Loke YW. Evaluation of oestrogen and progesterone receptor expression in uterine mucosal lymphocytes. Hum Reprod 1996;11:1079–82.[Abstract/Free Full Text]
  37. Schildkraut JM, Moorman PG, Halabi S, Calingaert B, Marks JR, Berchuck A. Analgesic drug use and risk of ovarian cancer. Epidemiology 2006;17:104–7.[CrossRef][Medline]
  38. Larsson SC, Giovannucci E, Wolk A. Long-term aspirin use and colorectal cancer risk: a cohort study in Sweden. Br J Cancer 2006;95:1277–9.[CrossRef][Medline]
  39. Chan AT, Giovannucci EL, Meyerhardt JA, Schernhammer ES, Curhan GC, Fuchs CS. Long-term use of aspirin and nonsteroidal anti-inflammatory drugs and risk of colorectal cancer. JAMA 2005;294:914–23.[Abstract/Free Full Text]
  40. Baron JA, Cole BF, Sandler RS, et al. A randomized trial of aspirin to prevent colorectal adenomas. N Engl J Med 2003;348:891–9.[Abstract/Free Full Text]
  41. Koga H, Sakisaka S, Ohishi M, et al. Expression of cyclooxygenase-2 in human hepatocellular carcinoma: relevance to tumor dedifferentiation. Hepatology 1999;29:688–96.[CrossRef][Medline]
  42. Toyoki H, Fujimoto J, Sato E, Sakaguchi H, Tamaya T. Clinical implications of expression of cyclooxygenase-2 related to angiogenesis in uterine endometrial cancers. Ann Oncol 2005;16:51–5.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
X. Sun, L. Jackson, S. K. Dey, and T. Daikoku
In Pursuit of Leucine-Rich Repeat-Containing G Protein-Coupled Receptor-5 Regulation and Function in the Uterus
Endocrinology, November 1, 2009; 150(11): 5065 - 5073.
[Abstract] [Full Text] [PDF]

Home page
 Hum Reprod UpdateHome page
E. M. C. Ohlsson Teague, C. G. Print, and M. L. Hull
The role of microRNAs in endometriosis and associated reproductive conditions
Hum. Reprod. Update, September 22, 2009; (2009) dmp034v1.
[Abstract] [Full Text] [PDF]

Home page
 Hum ReprodHome page
J. Wilkens, A.R.W. Williams, K. Chwalisz, C. Han, I.T. Cameron, and H.O.D. Critchley
Effect of asoprisnil on uterine proliferation markers and endometrial expression of the tumour suppressor gene, PTEN
Hum. Reprod., May 1, 2009; 24(5): 1036 - 1044.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Daikoku, T.
Right arrow Articles by Dey, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Daikoku, T.
Right arrow Articles by Dey, S. K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online