Cancer Research Cancer Epigenetics Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Cancer Research 68, 5979, July 15, 2008. doi: 10.1158/0008-5472.CAN-07-6828
© 2008 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Donev, R. M.
Right arrow Articles by Morgan, B. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Donev, R. M.
Right arrow Articles by Morgan, B. P.

Immunology

Modulation of CD59 Expression by Restrictive Silencer Factor–Derived Peptides in Cancer Immunotherapy for Neuroblastoma

Rossen M. Donev1, Lisa C. Gray2, Baalasubramanian Sivasankar1, Timothy R. Hughes1, Carmen W. van den Berg2 and B. Paul Morgan1

Departments of 1 Medical Biochemistry and Immunology and 2 Pharmacology, Therapeutics and Toxicology, School of Medicine, Cardiff University, Cardiff, United Kingdom

Requests for reprints: Rossen M. Donev, Department of Medical Biochemistry and Immunology, School of Medicine, Cardiff University Heath Park, Cardiff CF14 4XN, United Kingdom. Phone: 44-029-206-87868; Fax: 44-029-206-87079; E-mail: donevrm{at}cardiff.ac.uk.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Tumor cells escape clearance by complement by abundantly expressing CD59 and other membrane complement regulators. Existing strategies for blocking/knocking down these regulators can contribute to tumor immunoclearance in vitro; however, there are numerous difficulties restricting their use in vivo. Here, we report a new strategy for suppression of CD59 expression in neuroblastoma using peptides that target regulators of CD59 expression. We identified the neural-restrictive silencer factor (REST) as a target for modulation of CD59 expression in neuroblastoma. We next designed plasmids that encoded peptides comprising different DNA-binding domains of REST and transfected them into neuroblastoma cell lines. These peptides suppressed CD59 expression, sensitizing neuroblastoma to complement-mediated killing triggered by anti-GD2 therapeutic monoclonal antibody. These CD59-modulating peptides might be effective therapeutic adjuvants to therapeutic monoclonal antibodies used for treatment of neuroblastoma and other cancer types sharing the same mechanism for regulation of CD59 expression. [Cancer Res 2008;68(14):5979–87]


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Complement is a major component of innate immunity (1). Complement can be activated on tumor cells by antibodies (2), immune complexes (3), as a consequence of apoptosis (4) or through proteolytic processes (5). Normal and malignant cells are protected by membrane-bound complement regulators (mCReg) that act as physiologic brakes to complement amplification either by limiting either formation of the C3/C5 convertase enzymes (CD35, CD46, CD55), or assembly of the cytolytic membrane attack complex (CD59; ref. 1). In many tumors, mCReg expression is greater than in normal surrounding tissue (5, 6). Consequently, the increased complement resistance conferred by these mCRegs has been proposed as a mechanism that facilitates survival of the tumor or the metastasizing tumor cell when it enters the circulation (7).

Most monoclonal antibodies (mAb) used in anticancer immunotherapy activate complement; however, strong evidence for a role of complement in cancer regression exists only for rituximab (anti-CD20; 8). For the majority of therapeutic mAb, complement likely plays little or no role in tumor clearance because the tumor abundantly expresses mCReg (9). Indeed, repeated suboptimal rituximab treatment caused resistance to complement killing in the B-cell line RAMOS by inducing increased expression of CD55 and CD59 (10). Blocking of CD55 and CD59 increased the effectiveness of therapeutic mAb killing in lymphoma cells in vitro (11) and in animal models (12), confirming the protective role of mCReg. Although blocking of the mCReg with mAbs enhances complement-mediated immunoclearance of tumors, their high molecular mass and the ubiquitous expression of their targets are serious limitations for their application in humans. An alternative approach, down-modulation of mCReg has been successfully achieved in vitro by RNA interference; however, there are numerous problems (e.g., in vivo stability, tissue specific targeting, and unwanted immune system activation) currently preventing use in vivo (13).

These facts justify development of new strategies to overcome the stated drawbacks. We reasoned that a novel approach, inhibiting expression of mCReg genes by targeting their transcriptional regulators, could reduce mCReg expression and considerably enhance the therapeutic potential of currently used anticancer immunotherapy. Little is currently known about the mechanisms that control expression of the mCReg. We have recently shown a modulation of CD59 expression by p53 during treatment of neuroblastoma cells with chemotherapeutics (14). Here, we have extended this work and identified additional and novel molecular mechanisms leading to overexpression of CD59 in neuroblastoma. We implicated the neural-restrictive silencer factor (REST) as an important regulatory component of the transcriptional machinery of the CD59 gene. REST was originally described as a transcriptional repressor of neuronal gene expression (15, 16); however, recently, it has emerged as a tumor suppressor capable of transforming epithelial cells when mutated (17). Thus far, REST has been found to be a target for several different types of mutations in neuroblastoma (18), small-cell lung carcinoma (19), and colorectal cancer (17).

Based on our finding that REST is involved in modulation of CD59 expression in neuroblastoma, we designed REST peptides that targeted the identified transcriptional regulators of CD59, reduced CD59 expression, and sensitized tumor cells to complement-mediated killing triggered by a mAb used in neuroblastoma immunotherapy.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosure of Potential...
 References
 
Cell lines and patient samples. Human neuroblastoma cell lines IMR32, SH5Y, Kelly, La-N-1, La1-55N, SK-N-SH, La1-5S (European Collection of Animal Cell Cultures), NMB7, and SK-N-ER (kind gift from Dr. P. Gasque, University of La Reunion, Saint Denis, Ile de la Reunion, France) were maintained in RPMI 1640 with 10% heat-inactivated FCS, supplemented with glutamine, penicillin, and streptomycin (Invitrogen). Neuroblastoma clinical samples (NT1-NT10) were obtained via the CCLG Biological Studies Tumor Bank, United Kingdom (Study number 2007 BS 08).

Preparation of nuclear lysates and Western blotting. Nuclear protein extracts were prepared from all neuroblastoma cell lines as described previously (20). Expression of REST was detected in the lysates by Western blotting (14) with rabbit polyclonal anti-REST antibody (H-290) raised against amino acids 1-290 of the protein (Santa Cruz Biotechnology). This antibody recognizes both the full-length and the truncated REST isoforms.

Design of promoter constructs. Expression constructs were prepared by ligating the CD59 promoter fragments into the pEGFP-1 vector (Clontech). This promoterless vector contains a cloning site immediately upstream of the enhanced green fluorescent protein (EGFP) reporter gene. The promoter fragments were amplified from human genomic DNA using a common reverse primer containing restriction site (underlined) for AgeI enzyme (GCACCGGTAAGATCCTCTTCCAGCCTCGA) and a series of forward primers with KpnI restriction site (underlined): CGCCGGTACCTGAATTCAGATTTGTGCACA for the –2140 construct; CGCCGGTACCTCCGCGCGGGGGTGGAGGGAGA for the –151 construct; ATTAGGTACCAAGGGCATCCTGAGGGGC for the –70 construct and ATTAGGTACCCCTTGCGGGCTGGAGCGAA for the –35 construct. The amplified fragments and the plasmid were digested with AgeI and KpnI. After ligation into pEGFP-1, the nucleotide sequence of the inserts was determined by sequencing to ensure that PCR artifacts had not been introduced.

The reporter constructs were transfected into neuroblastoma cells using the jetPEI reagent (Autogen Bioclear UK Ltd.). Cells were then analyzed for expression of EGFP by flow cytometry.

Electrophoretic mobility shift assay. Biotinylated sense and antisense strands of the 35-bp regulatory sequence (Fig. 1C ) were purchased from Biomers.net GmbH. Oligonucleotides (200 pmol each) were mixed in equimolar amounts in 50 µL of annealing buffer [50 mmol/L KCl, 1.5 mmol/L MgCl2, Tris-HCl (pH 8.3)], placed in a boiling water bath for 2 min, and allowed to cool slowly to room temperature. The annealed DNA probe (10 pmol per reaction) was incubated with nuclear protein extracts from IMR32, Kelly, or normal human brain (Active Motif) and DNA was separated and detected as previously described (21).


Figure 1
View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. A 35-bp positive responsive element from the CD59 promoter is essential for overexpression of the gene in neuroblastoma. A, schematic presentation of the CD59 promoter fragments used in the EGFP-reporter assays. Four different fragments containing parts of exon 1 (solid box) along with variable portions of the 5' flanking region (lines) were prepared and ligated into a promoterless pEGFP-1 vector upstream of the EGFP gene. The arrow points in the 3' direction. B, Kelly cells were transfected with the constructs shown in A and the expression of EGFP was assessed by flow cytometry. Columns, mean for three independent experiments; bars, SD. C, the 35-bp sequence that differs between the –35 and –70 constructs and up-regulates expression of the reporter EGFP gene.

 
RNA interference. A small interference RNA (siRNA) sequence efficiently knocking down expression of REST (22) was designed into a short hairpin RNA expressing plasmid pLKO.1-TRC (Addgene, Inc.). Sense and antisense oligonucleotides containing either the active sequence (GATGCACAAACTGTTCTTC) or the scrambled one (CATTCGCGTTTACGACTAA) were purchased from Biomers.net GmbH. Oligonucleotides were annealed (14) and the resultant double-stranded constructs contained sticky AgeI and EcoRI 5'- and 3'-ends, respectively. After digestion of the pLKO.1-TRC with these two enzymes, the annealed constructs were ligated into the plasmid by T4 DNA ligase (Invitrogen). Ligated plasmids were transformed into Escherichia coli, amplified, and purified with GenElute plasmid miniprep kit (Sigma-Aldrich). These two constructs were transfected into IMR32 and Kelly cells using jetPEI reagent. Transfected cells were then selected by adding of 1 µg/mL of puromycin (Invitrogen) to the culture medium and cells were analyzed for expression of REST, CD59, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Design of peptides for suppression of expression of CD59. To test the effect of REST- and p53-derived peptides on expression of CD59, several pDR2{Delta}EF1{alpha}-based constructs for expression in mammalian cells were designed. Sequence encoding REST58 was amplified from IMR32 cDNA using the following pair of primers: CGATCTAGAGCCACCATGTATAAATGTGAACTT (forward) and AGAGGATCCTCAATGCTTAGATTTGAAGT (reverse). Forward and reverse primers contained restriction sites (underlined) for XbaI and BamHI, respectively, which were used for cloning into the pDR2{Delta}EF1{alpha} vector after digestion with the same enzymes. For the REST68 expression construct, domain 5 from REST58 was replaced with a nuclear localization signal (NLS). For this purpose, the same reverse primer was used; however, to accommodate the long extension at the 5'-end, a series of five forward primers were designed, F1 to F5, that partially overlap, and five sequential amplifications, starting with F1 and finishing with F5, were performed. The sequences of these primers were:

F1-GGGTGGTGGTTTTAAATGTGATCAGT;
F2-AACGTAAAGTGGGTGGTGGTTTTAAA;
F3-CCAAAAAAAAAACGTAAAGTGGGTGG;
F4-AGCCACCATGCCAAAAAAAAAACGTA;
F5-CGATCTAGAGCCACCATGCCAAAA.

The F5 primer contained an XbaI restriction site (underlined). All constructs and products were sequenced to ensure their fidelity.

To express the p53i peptide containing a NLS at the NH2 terminus, we synthesized the sense (CTAGAGCCACCATGATGCCAAAAAAAAAACGTAAAGTGGGTGGTGGTGGTTCTTATGGTTTTCGTTTAGGTTTTTTACATTCTGGTACTGCTAAATCAGTTACTTGTACATACTGAG) and antisense (GATCCTCAGTATGTACAAGTAACTGATTTAGCAGTACCAGAATGTAAAAAACCTAAACGAAAACCATAAGAACCACCACCACCCACTTTACGTTTTTTTTTTGGCATCATGGTGGCT) oligonucleotides (Biomers.net GmbH). They were annealed, leaving XbaI and BamHI sticky ends at their 5'- and 3'-ends, respectively, and were ligated to an appropriately digested pDR2{Delta}EF1{alpha} vector. Constructs were transfected into neuroblastoma cells using jetPEI reagent and cells were selected in medium containing hygromycin B (Invitrogen).

Chromatin immunoprecipitation. Kelly cells transfected either with the REST68 expression construct or the empty vector were analyzed as described previously (23). The immunoprecipitation was carried out either with rabbit polyclonal anti–acetyl-p53 (Lys373, Lys382; Upstate), rabbit polyclonal anti-Sp1 (Merck), rabbit polyclonal anti-AP2 (Merck), sheep polyclonal anti-CPBP (R&D Systems Europe Ltd.), or a mixture of rabbit polyclonal anti-REST (H-290) and goat polyclonal anti-REST (P-18; Santa Cruz Biotechnology) raised against peptides mapping within the NH2 terminus and the internal region of the protein, respectively. Mixing both anti-REST antibodies was necessary to ensure recognition of both the truncated isoform of REST and the REST68 peptide. Nonimmune rabbit IgG was used as a control for the background of these experiments. The naked coimmunoprecipitated DNAs were then used as templates in quantitative PCR (QPCR) assays as described below. Statistical significance of the data was assessed by the Student's t test.

Reverse transcription-PCR and QPCR. Total RNA from frozen patient samples and neuroblastoma cell lines was purified using the GenElute Mammalian Total RNA Miniprep kit (Sigma-Aldrich). Total RNA from normal primary neurons was obtained from TCS Cellworks. To detect the REST isoforms expressed by neuroblastoma cells and tissue samples, a conventional reverse transcription-PCR (RT-PCR) was performed using either a pair of primers on each side of the mutated sequence or with a nested reverse primer within the insert (19). For semiquantification of CD59 expression, CD59-specific primers (TGCAATTTCAACGACGTCACA, forward, and GAAATGGAGTCACCAGCAGAAGA, reverse) and a GAPDH-specific primer pair (24) as a control were used. cDNA were synthesized using TaqMan Reverse Transcription reagents (Applied Biosystems) and the amplification was carried out with Platinum Blue PCR SuperMix (Invitrogen).

To quantify the CD59 copies in purified RNAs and to analyze the data, we followed the procedure described previously (14). At least two independent experiments were done for each mRNA, and Student's t test was applied to calculate the significance in changes of expression pattern. In a similar manner, we quantified the binding of different transcription factors to the CD59 promoter. Immunoprecipitated DNAs were used as templates (10 ng per reaction) in a quantitative assay with primer pairs for detection of either the 35-bp positive regulatory sequence (AAGGGCATCCTGAGGGGC, forward; TTTCGCTCCAGCCCGCAAG, reverse) or the two p53-binding sequences (14). Two independent analyses of the immunoprecipitated DNAs were carried out for each antibody.

Flow cytometry. The effect of different expression constructs on expression of CD59 at protein level was assessed by staining the neuroblastoma cells (3 x 105) with mouse monoclonal anti-CD59 antibody (BRIC229) for 30 min on ice. The unbound antibody was removed by three washes with flow cytometry buffer [PBS containing 10 mmol/L EDTA, 1% bovine serum albumin (pH 7.4)]. The cells were then incubated for another 30 min with 1:100 dilution of FITC-conjugated anti-mouse immunoglobulins (The Binding Site), washed thrice with flow cytometry buffer, and analyzed on a BD FACSCalibur. All measurements were made in duplicate and each experiment was replicated twice. Results were combined and statistically analyzed by Student's t test. P < 0.05 was considered to show statistically significant differences.

Complement lysis assay. Normal human serum (NHS), obtained as described previously (14), was the source of complement in all experiments. Neuroblastoma cells transfected with either empty pDR2{Delta}EF1{alpha} or constructs expressing REST68 were suspended in RPMI 1640 culture medium without FCS and transferred into 96-well plates (104 cells per well) with anti-GD2 monoclonal antibody, clone 14.2Ga (Merck) at a concentration of 10 µg/mL, which was previously shown to yield a maximum lysis effect at these conditions (25). In experiments with CD59 blocking, excess of Fab fragment (10 µg/mL) generated from MEM43 mAb against CD59 (ImmunoPure Fab preparation kit, Perbio Science UK Ltd.) was preincubated with the cells for 30 min at 37°C. NHS was diluted as appropriate in RPMI 1640 and added to cells. The lysis assay was carried out using Colorimetric Cytotoxicity assay kit (Oxford Biomedical Research) that measures the release of lactate dehydrogenase (LDH) by the cells. Spontaneous release was assessed by incubation without mAb and with heat-inactivated NHS (15 min at 56°C). All experiments were performed in triplicate for each condition. The percentage of lysed cells was calculated using the following formula:

Formula

The experiment was replicated twice and data were analyzed by Student's t test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosure of Potential...
 References
 
Identification of a 35-bp positive regulatory sequence within the CD59 promoter in neuroblastoma. We first searched for the sequence within the CD59 promoter that is responsible for elevated expression of CD59 in neuroblastoma. Similar investigations have been carried out previously for human Burkitt lymphoma and chronic myelogenous leukemia using luciferase-reporter constructs (26). Here, we used a pEGFP-1 promoterless vector and generated EGFP-reporter constructs containing either the entire promoter of the CD59 gene (–2140) or parts of it (–35, –70, –151) located upstream of the EGFP coding sequence (Fig. 1A). We introduced these reporter constructs into the Kelly neuronal line and selected transfectants by adding neomycin. Expression of EGFP by the different constructs was then analyzed by flow cytometry (Fig. 1B). The –2140, –151, and –70 constructs all produced similar amounts of EGFP expression; however, expression from the –35 construct was reduced by ~3-fold. These data show the importance of the additional 35-bp sequence between the –35 and –70 promoter constructs (Fig. 1C) for elevated expression of the CD59 gene in neuroblastoma.

We next analyzed the 35-bp positive regulatory sequence in the CD59 promoter for potential binding to transcription factors. Using MatInspector (Genomatix Software GmbH), we identified several transcriptional activators (e.g., Sp1, AP2, CPBP, PLAG1) that may bind to the positive regulatory sequence (Table 1 ). However, we also found putative binding sites for the transcriptional suppressors REST and ZBP-89. It is likely that interplay between at least some of these potential negative and positive regulators will determine the expression status of the CD59 gene.


View this table:
[in this window]
[in a new window]

  		Table 1. Transcription factors predicted to bind within the 35-bp responsive element in the human CD59 promoter

 
REST modulates expression of the CD59 gene. It has been previously shown that REST is expressed as a truncated form in neuroblastoma tumors due to an insertion within the gene that introduces a stop codon (18). Recently, it was suggested that expression of this truncated isoform plays a role in tumor progression (27, 28). Taking into account that REST may bind within the 35-bp responsive element in the CD59 promoter, we addressed here the role of the expression of truncated REST in CD59 overexpression in neuroblastoma. RT-PCR analysis of expression of REST using a primer pair that anneals on both sides of the inserted sequence (Fig. 2A ) showed that eight of nine studied neuroblastoma cell lines express predominantly the truncated isoform. We did not detect the insertion in primary neurons and IMR32 cells, indicating that they expressed exclusively or predominantly full-length REST. However, when we carried out a nested RT-PCR with reverse primer within the REST insertion, the insertion was detected at low level in the IMR32 cells but not in primary neurons. To further explore clinical importance, RT-PCR analysis of expression of REST was tested in 10 clinical neuroblastoma samples. Truncated REST was present in nine of 10 specimens. The sample without truncated REST (N1) contained only trace amounts of full-length REST. These findings show the clinical relevance of the switch to expression of truncated REST in neuroblastoma. Two of the tumors (NT6 and NT7) showed the presence of an additional alternative REST transcript that is not further defined. We confirmed the major expression of truncated REST protein in neuroblastoma cell lines by Western blotting (Fig. 2A). Again, only IMR32 showed predominant expression of the full-length REST. Importantly, we found that the high expression level of CD59 coincided with expression of the truncated REST isoform in the various cell types (Fig. 2B).


Figure 2
View larger version (66K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Full-length REST but not the truncated isoform is a suppressor of CD59 expression. A, RT-PCR and Western blot analysis of expression of REST isoforms in different neuroblastoma cell lines, primary neurons, and clinical neuroblastoma samples (NT1-NT10). Specific primers either annealed on each side of the inserted sequence or a nested reverse primer were designed within the insert, amplifying only the cDNA encoding the truncated REST isoform. GAPDH was monitored as an indicator for the quality of RNA prepared from clinical tissue samples. For Western blotting, equal amounts of protein lysates were loaded in each lane. Lysate from normal brain was used as a control. Molecular weight marker is presented on the right of the panel. B, expression of CD59 on the cell surface of neuroblastoma cells was assessed by flow cytometry. Columns, mean of triplicates and representative of two experiments; bars, SD. C, EMSA with oligonucleotides labeled with biotin, incubated with 5 µg of nuclear protein extracts from normal brain and neuroblastoma cell lines Kelly and IMR32, in the presence of 0.1 µg/µL poly(deoxyinosinic-deoxycytidylic acid) and 1 µg/µL salmon sperm DNA. Antibody against REST was added in some reactions (+) to test whether the oligonucleotide retardation is a result of REST binding. Oligonucleotides were separated in a 6% polyacrylamide gel for 1 h at 100 V, transferred onto a nitrocellulose membrane, and detected by ExtAvidin horseradish peroxidase. The autoradiograph in the bottom panel was obtained under the same conditions as described above; however, the gel was run for 3 h at 100 V for better visualization of the retardation, due to the high molecular mass of the complexes. D, knockdown of expression of REST, both full-length and truncated, in IMR32 and Kelly cells and increase of expression of CD59 in IMR32 cells by RNA interference (restRNAi). Scrambled siRNA sequence (cntrRNAi) was used as a control and expression of the GAPDH housekeeping gene was monitored in addition.

 
To confirm that REST binds in the identified 35-bp responsive element, we performed an electrophoretic mobility shift assay (EMSA) with nuclear protein extracts from normal human brain and neuroblastoma cells (Fig. 2C). We chose IMR32 and Kelly lines as representative for low and high expression of CD59, respectively. We detected protein binding to the 35-bp regulatory element in all the lanes. However, a supershift with antibody against REST was observed only in nuclear extracts from cells expressing the full-length REST. In Kelly cells that expressed only the truncated isoform, no binding between the 35-bp element and REST was detected. This finding, together with the observation that higher expression of CD59 coincides with the expression of truncated REST (Fig. 2B), suggests that the full-length protein suppresses expression of CD59 by binding within the 35-bp responsive element. We tested this by transfecting IMR32 and Kelly cells with plasmid expressing siRNA against both isoforms of REST. The knockdown efficiency for both REST isoforms was ~90% (Fig. 2D). Knockdown of REST resulted in a 7-fold increase in expression of CD59 mRNA in IMR32 cells that predominantly express full-length REST (Fig. 2D). In contrast, knocking down truncated REST in Kelly cells did not affect CD59 mRNA expression.

In light of the fact that neuron-specific splicing resulting in expression of truncated REST is also found in mouse neuroblastoma (18), we next analyzed the promoter sequence of mouse Cd59 for potential REST binding sites. In mice, Cd59 is duplicated and the two genes are designated Cd59a and Cd59b. However, expression of Cd59b is testis restricted and associated with reproduction rather than protection from complement attack (29, 30). Within the 2,000-bp promoter sequence of the Cd59a gene (Supplementary Fig. S1, available online), the gene relevant for protection from complement, we identified two potential REST binding sites. A detailed in silico analysis of the more proximal site showed that it overlaps or resides in the vicinity of potential binding sites for transcriptional activators such as signal transducers and activators of transcription 1 (STAT1), STAT3, Yin-yang 1, GA binding protein, LXRβ/retinoid X receptor, etc. (Supplementary Table S1), suggesting that up-modulation of CD59 in neuroblastomas by expression of alternatively spliced truncated REST isoform is an evolutionarily conserved event.

Design of REST-derived peptides for suppression of CD59 expression. Our next step was to design peptides that can suppress expression of CD59 in neuroblastoma. Based on our observation that only the full-length REST binds within the 35-bp responsive element to suppress expression of CD59, and on previously characterized roles of REST domains (31), we designed two constructs expressing REST-derived peptides predicted to bind to the CD59 promoter and suppress expression of the gene. One of the peptides, named REST58, comprises domain 5, which is responsible for nuclear localization, and domains 6, 7, and 8 (Fig. 3A ) that are essential for DNA binding. In the second peptide, named REST68, domain 5 has been replaced by the classic NLS (32). We transfected these two expression constructs into IMR32 and Kelly cells and investigated their effects on the expression of CD59. A conventional RT-PCR (Fig. 3A) clearly showed that both peptides had considerable suppressive effect on CD59 expression in Kelly cells lacking the full-length REST; however, the peptides had no effect in IMR32 cells expressing mainly the full-length protein. We further clarified this issue by quantifying the effect of REST-derived peptides using real-time QPCR. In Kelly cells, REST58 lowered expression of CD59 mRNA by 2.5-fold, whereas transfection with REST68 constructs yielded a 4-fold suppression (Fig. 3B). In IMR32 cells, there was a nonsignificant trend toward reduction of CD59 mRNA expression by the two constructs. The effect of REST58 and REST68 on expression of CD59 at protein level (Fig. 3C) was similar to that observed at mRNA level, with a reduction in expression in Kelly cells of ~2-fold and 2.5-fold, respectively. We next studied the effect of REST68 on CD59 expression in several other neuroblastoma cell lines (Fig. 3D). In all of them, CD59 expression on the cell surface was reduced within 96 h of the transfection by at least 2-fold. In NMB7 cells, this effect was significantly greater and we observed almost a complete suppression of CD59 by the REST peptide (10% of that in cells transfected with an empty vector).


Figure 3
View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Peptides derived from the DNA-binding domain of REST suppress expression of CD59. A, the REST repressor protein is shown schematically (left), illustrating the eight zinc finger DNA binding domains and two repressor domains. Domains included in REST58 (110-amino-acid residues) and REST68 (includes 82 amino acids from the REST plus the 7-amino-acid NLS) are shown. RT-PCR analysis of expression of CD59 mRNA in IMR32 and Kelly cells transfected either with REST58, REST68, or an empty expression vector. B, QPCR for expression of CD59 mRNA in IMR32 and Kelly cells transfected as above. Expression in cells transfected with empty vector was set as 100%. Columns, results from two independent measurements; bars, SD (*, P < 0.001). C, flow cytometry analysis of expression of CD59 on the surface of IMR32 and Kelly cells transfected as above. D, flow cytometry analysis of expression of CD59 on the surface of NMB7, La-N-1, La1-5S, SH5Y, SK-N-ER, SK-N-SH, and La1-55N 96h after cells were transfected either with REST68 or an empty expression vector. Columns, mean from two independent measurements; bars, SD (*, P < 0.001).

 
Next, we elucidated the mechanism by which REST-derived peptides suppress expression of CD59 in neuroblastoma cells. We carried out chromatin immunoprecipitation (ChIP) assays in Kelly cells transfected with the REST68-expressing construct using antibodies against transcription factors predicted to bind within the 35-bp responsive element from the CD59 promoter (Table 1). In cells expressing the truncated REST (Kelly/pDR2), we detected strong binding of transcriptional activators Sp1, AP2, and CPBP within the 35-bp regulatory element, and no binding of truncated REST was observed (comparable with that for the background control with nonimmune IgG). However, when these cells were transfected with the REST68 expression plasmid, the expressed peptide bound within the regulatory sequence, reducing binding of all three transcriptional activators by ~5-fold (Fig. 4A ).


Figure 4
View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. REST68 peptide suppresses expression of CD59 gene by blocking binding of transcriptional activators to the 35-bp responsive element. A, ChIP was performed on Kelly cells transfected with either REST68 expression construct or empty vector with antibodies against Sp1, AP2, CPBP, and REST. Immunoprecipitation with nonimmune rabbit IgG was carried out as a control for the assay background. The pulled-down DNA was characterized for the presence of the 35-bp element by QPCR. Highest levels of binding for each transcription factor, regardless of the plasmid with which cells were transfected, were set as 100%. Columns, mean for two independent ChIP experiments each analyzed in duplicate; bars, SD (*, P < 0.001). B, ChIP analysis of binding of p53 to the two binding sites within the CD59 promoter: CD59.1 and CD59.2. Kelly cells were transfected with p53i expression constructs or with empty vector as a control. Binding of p53 was quantified by QPCR. Columns, mean from two independent ChIP, each analyzed in duplicate; bars, SD (*, P < 0.05). C, flow cytometry analysis of expression of CD59 on the surface of Kelly cells transfected either with REST68-expressing vector, p53i construct, or both together. Transfection with empty vector was used as a control (set as 100%). REST68 significantly decreased CD59 expression compared with p53i and empty vector–transfected cells (*, P < 0.001). However, no significant effect of p53i alone was observed. Columns, mean from two independent measurements; bars, SD.

 
We recently reported that p53 modulates expression of CD59 by binding to two consensus sequences within the gene promoter (14). To test whether a similar peptide-based approach could influence p53-induced CD59 expression, we designed a plasmid expressing a peptide derived from the p53 core domain (residues 105–125) that was recently showed to inhibit p53 activity in living cells (33). The plasmid, termed p53i, was transfected into Kelly cells either alone or together with the REST68 plasmid. ChIP experiments showed that p53i decreased binding of p53 to the promoter of CD59 by ~20% (Fig. 4B). However, this reduction in binding was not sufficient to contribute to a significant decrease in CD59 expression at either RNA (data not shown) or protein level (Fig. 4C). We did not investigate further the effect of this peptide on sensitivity of neuroblastoma to complement lysis.

REST-derived peptides sensitize neuroblastoma cells to killing by therapeutic mAb and complement. Finally, we tested the effect of the constructs modulating expression of CD59 on complement-mediated cytolysis triggered by anti-GD2 mAb used in neuroblastoma immunotherapy (Fig. 5 ). Lysis assays were performed using different concentrations of human serum as a source of complement. Maximum lysis achieved for Kelly cells with no modulation of expression of CD59 was ~55%. However, cells transfected with the REST68 expression plasmid were more susceptible to complement-dependent killing at all serum doses, and ~80% were lysed at maximum. To confirm that reduced expression of CD59 was responsible for the observed sensitization to complement-dependent cytolysis, lytic susceptibility was assessed in Kelly cells transfected either with REST68-expressing construct or empty vector, in which CD59 was first blocked by Fab fragment prepared from MEM43 antibody that suppresses the protective role of CD59 in complement-mediated lysis (34). After blocking CD59, lytic susceptibility was increased and was similar for cells transfected with REST68 or empty vector, confirming that increased susceptibility of REST68-treated cells to complement lysis was a result of decreased CD59 expression. Heat-inactivated normal human serum did not cause specific lysis of Kelly (data not shown).


Figure 5
View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. REST68 peptide sensitizes neuroblastoma cells to complement-mediated lysis. Kelly, La1-5S, SK-N-ER, and NMB7 cells transfected either with REST68 expression construct ({blacksquare}) or empty vector ({blacktriangleup}) were tested for their sensitivity to complement-dependent cytotoxicity triggered by anti-GD2 mAb. Lysis assay with preincubation of both cell lines (REST68, {square}; empty vector, {triangleup}) with CD59-blocking Fab fragment was carried out as a control. Points, mean for three independent experiments; bars, SD.

 
Similar lysis assays were carried out for La1-5S, SK-N-ER, and NMB7 lines (Fig. 5) for which we established populations of transfected cells by selecting with hygromycin B. La1-5S and SK-N-ER cells transfected with REST68 showed ~30% higher maximum lysis compared with those transfected with an empty vector. In NMB7, the maximum lysis achieved in REST68-transfected populations was ~95% (35% higher than in empty vector transfected control). This almost complete complement killing was most likely a result of the very efficient suppression of CD59 in this cell line and of the fact that NMB7 do not express CD55 and CD46 at levels detectable by Western blotting (35).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosure of Potential...
 References
 
CD59 is widely expressed on almost all human cells and prevents damage to self by inhibiting membrane attack complex formation, thereby protecting the cells against complement-mediated membrane damage and lysis (36). However, the expression of this protein in many tumors is significantly elevated and limits the contribution of complement to chemotherapy (14) and mAb-mediated tumor clearance (11, 37). CD59 has been even implicated in enhancing tumor growth in vivo (37). In spite of the obvious importance of this protein as an obstacle in tumor killing, there are very few studies on the mechanisms that lead to overexpression of CD59 in cancer (14, 38, 39).

In this study, we investigated in more detail the molecular mechanisms causing elevated expression of CD59 in neuroblastoma. Here, we identified REST protein as a major player in regulating expression of the CD59 gene (Fig. 2). Full-length REST, a transcriptional suppressor, binds to a positive responsive element within the CD59 gene promoter (Figs. 1 and 2). This responsive element, when not occupied by REST, recruits several transcriptional activators in living cells, such as Sp1, AP2, and CPBP (Table 1; Fig. 4), which up-regulate expression of CD59. Therefore, the balance between these two processes is essential for maintaining normal expression level of CD59. However, primary neuroblastoma tumors and established neuroblastoma cell lines (Fig. 2; ref. 18) express a truncated REST isoform that lacks DNA-binding activity in both cell-free systems (Fig. 2) and living cells (Fig. 4). This results in overexpression of CD59 as a consequence of unregulated binding of transcriptional activators. It was previously shown that inhibition of Sp1 by REST is required for the silencing of its target genes (40). Our study confirms this finding and further extends the list of the transcriptional activators inhibited by REST to include AP2 and CPBP (Fig. 4).

To manipulate CD59 expression in tumor cells expressing truncated REST, we designed two peptides derived from the DNA-binding domains of REST, which we named REST58 and REST68. REST58 is delivered to the nucleus via a REST-specific receptor (41) recognized by the zinc finger domain 5 of the protein. The REST-specific receptor has been identified only recently and its efficacy in delivering REST to the nucleus has not been investigated. In the second peptide, REST68, we replaced domain 5 with the classic NLS (PKKKRKV) delivering proteins to the nucleus via importin {alpha}1 (32). We reasoned that such a substitution might result in a more efficient nuclear import because importin {alpha}1 is abundantly expressed in tumors (42), which should ensure a high efficiency of peptide nuclear delivery and a greater suppressive effect. The data we obtained here (Fig. 3) confirmed our expectations. However, the weaker suppressive effect of REST58 we observed on expression of CD59 might be also a result of competition between REST58 and the relatively highly expressed truncated REST for the REST receptor.

REST68 inhibited expression of CD59 at the mRNA level by 4-fold and at the protein level by 2.5-fold (Fig. 3). Taking into account the fact that cell-bound CD59 turns over relatively rapidly (43) and that transfected Kelly cells were cultured for up to 2 weeks before studying the effect of REST68, the observed discrepancy between mRNA and protein change might be a result of compensatory mechanism(s) that affects either the stability or the expression of CD59 at protein level. We have also tried to inhibit expression of CD59 by modulating binding of p53 to the gene promoter (Fig. 4; ref. 14). However, the p53-derived peptide we tested did not cause any significant effect either alone or in combination with REST68.

Presenting symptoms of neuroblastoma are varied and often vague; hence, some 65% of neuroblastomas are not diagnosed until the disease is widespread. Treatment choices are therefore limited. Intensive chemotherapy is often successful in achieving disease remission; however, relapses are common and difficult to treat, making neuroblastoma one of the most lethal of all childhood cancers (44). Immunotherapy with humanized monoclonal anti-GD2 antibodies has showed promise (reviewed in ref. 45); however, as with chemotherapy, relapse and resistance are common. Recent studies have shown that resistance of neuroblastoma to both chemotherapy and immunotherapy is in part due to the development of enhanced resistance to complement killing caused by up-regulation of expression of CD59 on the tumor (14, 37). Antibody blockade of mCReg increased the effectiveness of immunotherapy in a number of tumors—chronic lymphocytic leukemia B-cells (11), xenograft models of human neuroblastoma (37), and lymphoma cells (12). However, due to the ubiquitous expression of mCReg, the application of this strategy remains limited. The REST68 peptide described here was a potent sensitizer of neuroblastoma cells to complement-mediated killing triggered by anti-GD2 therapeutic antibody (Fig. 5). Targeted delivery of peptides, either as an active component or as a prodrug, has been achieved in other contexts; we believe that REST68 peptide would be a powerful adjuvant to therapeutic mAbs, improving the outcome from neuroblastoma treatment. Others have targeted complement activation to tumor cells to enhance clearance of prostate tumors (46). Combining suppression of mCReg and targeted complement activation would likely result in a very high level of immunoclearance of tumors.

Further to the delivery strategy for REST68 to tumors, a key finding in this study showed that the peptide did not affect expression of CD59 in cells predominantly expressing the full-length REST (Fig. 3). Endogenously expressed REST has already down-modulated the expression of CD59 and a further introduction of REST68 does not show a significant effect. These findings led us to suggest that REST68 would not significantly change the expression of other REST-controlled genes in normal cells. Although a detailed study on this matter has yet to be carried out, we emphasize that the selective effect of REST68 on neuroblastoma cells is a critical feature that may remove the need to target this therapeutic peptide to tumors. Expression of the truncated isoform of REST, although not reported in normal cells, is also described in small-cell lung carcinoma (19, 24) and colorectal cancer (17). This new approach to sensitizing tumor cells to complement attack, modeled here in neuroblastoma, may therefore be of broader relevance to tumor immunotherapy.


   Disclosure of Potential Conflicts of Interest
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
References
 
No potential conflicts of interest were disclosed.


   Acknowledgments
 
Grant support: Wellcome Trust Programme Grant 068590 funding (B.P. Morgan), the Tenovus Project Grant SA41 (C.W. van den Berg), and the Medical Research Council New Investigator Grant G0700102 (R.M. Donev).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Peter Giles (School of Medicine, Cardiff University, Cardiff, United Kingdom) for the in silico analysis of mouse Cd59a promoter and Prof. David Kipling (School of Medicine, Cardiff University, Cardiff, United Kingdom) for critical reading and fruitful discussion of this article.


   Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 12/26/07. Revised 4/ 9/08. Accepted 5/ 8/08.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Walport MJ. Advances in immunology: complement (first of two parts). N Engl J Med 2001;344:1058–66.[Free Full Text]
  2. Magyarlaki T, Mosolits S, Baranyay F, Buzogany I. Immunohistochemistry of complement response on human renal cell carcinoma biopsies. Tumori 1996;82:473–9.[Medline]
  3. Lucas SD, KarlssonParra A, Nilsson B, et al.. Tumor-specific deposition of immunoglobulin G and complement in papillary thyroid carcinoma. Hum Pathol 1996;27:1329–35.[CrossRef][Medline]
  4. Matsumoto M, Takeda J, Inoue N, et al. A novel protein that participates in nonself discrimination of malignant cells by homologous complement. Nat Med 1997;3:1266–70.[CrossRef][Medline]
  5. Bjorge L, Hakulinen J, Wahlstrom T, Matre R, Meri S. Complement-regulatory proteins in ovarian malignancies. Int J Cancer 1997;70:14–25.[CrossRef][Medline]
  6. Rushmere NK, Knowlden JM, Gee JMW, et al. Analysis of the level of mRNA expression of the membrane regulators of complement, Cd59, Cd55 and Cd46, in breast, cancer. Int J Cancer 2004;108:930–6.[CrossRef][Medline]
  7. Gorter A, Meri S. Immune evasion of tumor cells using membrane-bound complement regulatory proteins. Immunol Today 1999;20:576–82.[CrossRef][Medline]
  8. Maloney DG, Smith B, Rose A. Rituximab: Mechanism of action and resistance. Semin Oncol 2002;29:2–9.[Medline]
  9. Imai M, Landen C, Ohta R, Cheung NKV, Tomlinson S. Complement-mediated mechanisms in anti-GD2 monoclonal antibody therapy of murine metastatic cancer. Cancer Res 2005;65:10562–8.[Abstract/Free Full Text]
  10. Takei K, Yamazaki T, Sawada U, Ishizuka H, Aizawa S. Analysis of changes in CD20, CD55, and CD59 expression on established rituximab-resistant B-lymphoma cell lines. Leukemia Res 2006;30:625–31.[CrossRef][Medline]
  11. Golay J, Lazzari M, Facchinetti V, et al. CD20 levels determine the in vitro susceptibility to rituximab and complement of B-cell chronic lymphocytic leukemia: further regulation by CD55 and CD59. Blood 2001;98:3383–9.[Abstract/Free Full Text]
  12. Macor P, Tripodo C, Zorzet S, et al. In vivo targeting of human neutralizing antibodies against CD55 and CD59 to lymphoma cells increases the antitumor activity of rituximab. Cancer Res 2007;67:10556–63.[Abstract/Free Full Text]
  13. Eggert US, Field CM, Mitchison TJ. Small molecules in an RNAi world. Mol Biosys 2006;2:93–6.[CrossRef]
  14. Donev RM, Cole DS, Sivasankar B, Hughes TR, Morgan BP. p53 regulates cellular resistance to complement lysis through enhanced expression of CD59. Cancer Res 2006;66:2451–8.[Abstract/Free Full Text]
  15. Chong JHA, Tapiaramirez J, Kim S, et al. REST—a mammalian silencer protein that restricts sodium-channel gene expression to neurons. Cell 1995;80:949–57.[CrossRef][Medline]
  16. Schoenherr CJ, Anderson DJ. The neuron-restrictive silencer factor (NRSF)—a coordinate repressor of multiple neuron-specific genes. Science 1995;267:1360–3.[Abstract/Free Full Text]
  17. Westbrook TF, Martin ES, Schlabach MR, et al. A genetic screen for candidate tumor suppressors identifies REST. Cell 2005;121:837–48.[CrossRef][Medline]
  18. Palm K, Metsis M, Timmusk T. Neuron-specific splicing of zinc finger transcription factor REST/NRSF/XBR is frequent in neuroblastomas and conserved in human, mouse and rat. Mol Brain Res 1999;72:30–9.[Medline]
  19. Coulson JM, Edgson JL, Woll PJ, Quinn JP. A splice variant of the neuron-restrictive silencer factor repressor is expressed in small cell lung cancer: a potential role in derepression of neuroendocrine genes and a useful clinical marker. Cancer Res 2000;60:1840–4.[Abstract/Free Full Text]
  20. Donev R, Horton R, Beck S, et al. Recruitment of heterogeneous nuclear ribonucleoprotein A1 in vivo to the LMP/TAP region of the major histocompatibility complex. J Biol Chem 2003;278:5214–26.[Abstract/Free Full Text]
  21. Enukashvily N, Donev R, Sheer D, Podgornaya O. Satellite DNA binding and cellular localisation of RNA helicase P68. J Cell Sci 2005;118:611–22.[Abstract/Free Full Text]
  22. Kim CS, Hwang CK, Choi HS, et al. Neuron-restrictive silencer factor (NRSF) functions as a repressor in neuronal cells to regulate the mu opioid receptor gene. J Biol Chem 2004;279:46464–73.[Abstract/Free Full Text]
  23. Orlando V, Paro R. Mapping polycomb-repressed domains in the bithorax complex using in vivo formaldehyde cross-linked chromatin. Cell 1993;75:1187–98.[CrossRef][Medline]
  24. Coulson JM, Stanley J, Woll PJ. Tumour-specific arginine vasopressin promoter activation in small-cell lung cancer. Br J Cancer 1999;80:1935–44.[CrossRef][Medline]
  25. Mujoo K, Cheresh DA, Yang HM, Reisfeld RA. Disialoganglioside-GD2 on human neuroblastoma cells - target antigen for monoclonal antibody-mediated cytolysis and suppression of tumor growth. Cancer Res 1987;47:1098–104.[Abstract/Free Full Text]
  26. Holguin MH, Martin CB, Eggett T, Parker CJ. Analysis of the gene that encodes the complement regulatory protein, membrane inhibitor of reactive lysis (CD59) — Identification of an alternatively spliced exon and characterization of the transcriptional regulatory regions of the promoter. J Immunol 1996;157:1659–68.[Abstract]
  27. Coulson JM. Transcriptional regulation: Cancer, neurons and the REST. Curr Biol 2005;15:R665–8.[CrossRef][Medline]
  28. Majumder S. REST in good times and bad—roles in tumor suppressor and oncogenic activities. Cell Cycle 2006;5:1929–35.[Medline]
  29. Baalasubramanian S, Harris CL, Donev RM, et al. CD59a is the primary regulator of membrane attack complex assembly in the mouse. J Immunol 2004;173:3684–92.[Abstract/Free Full Text]
  30. Donev RM, Sivasankar B, Mizuno M, Morgan BP. The mouse complement regulator CD59b is significantly expressed only in testis and plays roles in sperm acrosome activation and motility. Mol Immunol 2008;45:534–42.[CrossRef][Medline]
  31. Shimojo M, Lee JH, Hersh LB. Role of zinc finger domains of the transcription factor neuron-restrictive silencer factor/repressor element-1 silencing transcription factor in DNA binding and nuclear localization. J Biol Chem 2001;276:13121–6.[Abstract/Free Full Text]
  32. Nadler SG, Tritschler D, Haffar OK, Blake J, Bruce AG, Cleaveland JS. Differential expression and sequence-specific interaction of karyopherin {alpha} with nuclear localization sequences. J Biol Chem 1997;272:4310–5.[Abstract/Free Full Text]
  33. Protopopova M, Selivanova G. Inhibition of p53 activity in vitro and in living cells by a synthetic peptide derived from its core domain. Cell Cycle 2003;2:592–5.[Medline]
  34. Bodian DL, Davis SJ, Morgan BP, Rushmere NK. Mutational analysis of the active site and antibody epitopes of the complement-inhibitory glycoprotein, CD59. J Exp Med 1997;185:507–16.[Abstract/Free Full Text]
  35. van Beek J, van Meurs M, t Hart BA, et al. Decay-accelerating factor (CD55) is expressed by neurons in response to chronic but not acute autoimmune central nervous system inflammation associated with complement activation. J Immunol 2005;174:2353–65.[Abstract/Free Full Text]
  36. Kimberley FC, Sivasankar B, Morgan BP. Alternative roles for CD59. Mol Immunol 2007;44:73–81.[CrossRef][Medline]
  37. Chen SH, Caragine T, Cheung NKV, Tomlinson S. CD59 expressed on a tumor cell surface modulates decay-accelerating factor expression and enhances tumor growth in a rat model of human neuroblastoma. Cancer Res 2000;60:3013–8.[Abstract/Free Full Text]
  38. Kimura Y, Furuhata T, Urano T, Hirata K, Nakamura Y, Tokino T. Genomic structure and chromosomal localization of GML (GPI-anchored molecule-like protein), a gene induced by p53. Genomics 1997;41:477–80.[CrossRef][Medline]
  39. Gazouli M, Kokotas S, Zoumpourlis V, et al. The complement inhibitor CD59 and the lymphocyte function-associated antigen-3 (LFA-3, CD58) genes possess functional binding sites for the p53 tumor suppressor protein. Anticancer Res 2002;22:4237–41.[Medline]
  40. Plaisance V, Niederhauser G, Azzouz F, et al. The repressor element silencing transcription factor (REST)-mediated transcriptional repression requires the inhibition of Sp1. J Biol Chem 2005;280:401–7.[Abstract/Free Full Text]
  41. Shimojo M, Hersh LB. REST/NRSF-interacting LIM domain protein, a putative nuclear translocation receptor. Mol Cell Biol 2003;23:9025–31.[Abstract/Free Full Text]
  42. Kau TR, Way JC, Silver PA. Nuclear transport and cancer: from mechanism to intervention. Nat Rev Cancer 2004;4:106–17.[Medline]
  43. Davies CS, Harris CL, Morgan BP. Glycation of CD59 impairs complement regulation on erythrocytes from diabetic subjects. Immunol 2005;114:280–6.[CrossRef][Medline]
  44. Spix C, Aareleid T, Stiller C, Magnani C, Kaatsch P, Michaelis J. Survival of children with neuroblastoma: time trends and regional differences in Europe, 1978-1992. Eur J Cancer 2001;37:722–9.[CrossRef][Medline]
  45. Johnson E, Dean S, Sondel P. Antibody-based immunotherapy in high-risk neuroblastoma. Expert Rev Mol Med 2007;9:1–21.[Medline]
  46. Imai M, Ohta R, Varela J, Song H, Tomlinson S. Enhancement of antibody-dependent mechanisms of tumor cell lysis by a targeted activator of complement. Cancer Res 2007;67:9535–41.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
S. M. Mangsbo, J. Sanchez, K. Anger, J. D. Lambris, K. N. Ekdahl, A. S. Loskog, B. Nilsson, and T. H. Totterman
Complement Activation by CpG in a Human Whole Blood Loop System: Mechanisms and Immunomodulatory Effects
J. Immunol., November 15, 2009; 183(10): 6724 - 6732.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Donev, R. M.
Right arrow Articles by Morgan, B. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Donev, R. M.
Right arrow Articles by Morgan, B. P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online