Cancer Research CR  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 68, 6550, August 15, 2008. doi: 10.1158/0008-5472.CAN-08-0137
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guida, E.
Right arrow Articles by Del Sal, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guida, E.
Right arrow Articles by Del Sal, G.

Cell, Tumor, and Stem Cell Biology

Peptide Aptamers Targeting Mutant p53 Induce Apoptosis in Tumor Cells

Elisa Guida1, Andrea Bisso1, Cristina Fenollar-Ferrer2, Marco Napoli1, Claudio Anselmi2, Javier E. Girardini1, Paolo Carloni2,3 and Giannino Del Sal1

1 The National Laboratory CIB, and Dipartimento di Biochimica, Biofisica, e Chimica delle Macromolecole (BBCM), University of Trieste, 2 SISSA, International School for Advanced Studies and Consiglio Nazionale delle Ricerche-National Institute for Physics of Matter-DEMOCRITOS Modeling Center for Research in Atomistic Simulation, and 3 Italian Institute of Technology, Trieste, Italy

Requests for reprints: Giannino Del Sal, The National Laboratory CIB, Area Science Park, Padriciano 99, 34012, Trieste, Italy. Phone: 39-040-398992; Fax: 39-040-398990; E-mail: delsal{at}lncib.it.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Mutations in the p53 tumor suppressor gene frequently result in expression of p53 point mutants that accumulate in cancer cells and actively collaborate with tumor progression through the acquisition of novel properties. Interfering with mutant p53 functions may represent a valid alternative for blocking tumor growth and development of aggressive phenotypes. The interactions and activities of selected proteins can be specifically modulated by the binding of peptide aptamers (PA). In the present work, we isolated PAs able to interact more efficiently with p53 conformational mutants compared with wild-type p53. The interaction between mutant p53 and PAs was further characterized using molecular modeling. Transient expression of PAs was able to reduce the transactivation activity of mutant p53 and to induce apoptosis specifically in cells expressing mutant p53. These PAs could provide a potential strategy to inhibit the oncogenic functions of mutant p53 and improve mutant p53-targeted cancer therapies. [Cancer Res 2008;68(16):6550–8]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Most tumors are characterized by impairment of the p53 pathway, either by mutations of the p53 gene (TP53; ref. 1), or by deregulation of other components of this pathway (2). The importance of p53 function as a tumor suppressor is underlined by the fact that at least 50% of human tumors carry mutations in TP53. Interestingly, the majority of the TP53 alterations are missense mutations leading to the expression of full-length point mutants that accumulate to high levels in tumor cells (3).

Wild-type p53 is a transcription factor that becomes activated in response to stress signals and can determine different cellular outcomes, such as temporary growth arrest and DNA repair, senescence, or apoptosis (24). The p53 protein contains four functional domains: an NH2-terminal transactivation domain (TAD), a proline-rich domain, a central DNA-binding core domain (CD), and a COOH-terminal oligomerization domain (5). Most frequently, tumor-associated p53 mutations lie in the CD and, as a consequence, they hamper the ability of the protein to recognize its responsive elements within target promoters (6). According to the effect of such mutations on protein structure, the most frequent p53 mutants ("hotspots") are classified either as contact mutants, where an amino acid (aa) directly involved in protein-DNA interaction is mutated, or conformational mutants, where mutations alter the overall protein conformation without affecting aas directly involved in DNA binding (7).

The expression of p53 point mutants was shown to favor tumorigenesis and this oncogenic function has been explained by both trans-dominant suppression of wt p53 activities and by the acquisition of novel properties by mutant proteins, commonly called gain-of-function (GOF), which may cooperate with tumor development independently of wt p53 inhibition (8). Mutant p53 GOF has been associated with enhanced tumorigenic potential in mice, increased proliferation, and resistance to drugs commonly used in anticancer therapy (912). In addition, mouse models have provided evidence for a role of mutant p53 in altering tumor spectrum and increasing the metastatic potential of tumors cells (1114). Conversely, ablation of mutant p53 expression in human tumor–derived cell lines reduced proliferation, survival, chemoresistance, and tumorigenicity (15). The mechanisms underlying mutant p53 GOF remain largely unclear; nevertheless, recent experimental findings have shown that mutant p53 is involved in precise cellular events. Mutant p53 was shown to alter the expression of several genes involved in cell proliferation, most likely by modifying the activities of other transcription factors (1619). In addition, p53 mutants form aberrant protein complexes with several proteins such as p73 (20), p63 (21), and Mre11 (22) interfering with their ability to induce apoptosis or a proficient DNA damage response respectively.

Given that mutant p53 actively contributes to tumorigenesis and is highly expressed in tumor cells, it represents an attractive target for the development of selective anticancer therapies. Indeed, some approaches aimed at restoring wt function in p53 mutants led to the identification of small molecules and peptides, which are able to selectively induce apoptosis in cells expressing mutant p53 (23).

Here, we report the identification and characterization of short peptide aptamers (PA) able to bind to different p53 mutants, whereas not to wt p53. PAs consist of a short variable peptide domain usually expressed in the context of a protein scaffold and they are selected from high-complexity libraries to specifically target proteins and modulate their activity (24). The identified PAs specifically interfere with mutant p53 transcriptional functions and are able to trigger apoptosis selectively in tumor cells expressing mutant p53. Moreover, by molecular modeling based on the available structural information, we defined a region on mutant p53 that is predicted to be recognized by PAs.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Combinatorial library construction and yeast two-hybrid screening. In the yeast two-hybrid screening, the baits used were p53R175H from aa 74 to aa 298, p53R175H or wt p53 from aa 74 to aa 393, cloned in pLexA vector (pLexAp53R175H74-298, pLexAp53R175H74-393, and pLexAp5374-393). The high complexity peptide library (pJG4-5-HA-TNV16mers) was constructed in the pJG4-5-HA vector by cloning a mixture of degenerated oligonucleotides into the RsrII site, present in the sequence of the catalytic region of Escherichia coli Thioredoxin (TrxA). Oligos contained 16 repetitions of the codon NNG/T (N, any nucleotide) flanked by two regions with defined sequences including the site for AvaII, compatible with RsrII. This construct mediates the expression of the preys, inserted in the TrxA scaffold, fused to the B42 TAD of E. coli, and under the control of the inducible promoter Gal1. The S.cerevisiae strain EGY48 (MATa trp1 ura3 his3 LEU2::pLEXAop6LEU2), transformed with the plasmid pSH18-34, containing the reporter gene LacZ, was used. For the primary screening, the strain EGY48/pSH18-34 was transformed initially with the bait pLexAp53R175H74-298 and then with the library pJG4-5-HA-TNV16mers. The yeast two-hybrid screening was performed as previously described (24). About 9 million of clones were screened in selective medium lacking Histine, Uracil, Tryptophan, Leucine, and containing 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) as previously described (24).

Peptides. Peptides corresponding to the sequences of A3, A29, A79, sA79, B6, and C-(SFDTDVLKADGAILVD) were automatically synthetized on solid phase (Fmoc/t-Bu chemistry) at ICGEB as described in Supplementary Data. Peptide A60 was not synthesized due to technical problems.

Cell culture, transfections, and luciferase assays. H1299, U2OS, Sk-Br-3, HCT116, MG63, HT-29, and MDA-MB-468 cells were cultured as described (25). Transfections of all cell lines were performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. For luciferase assays, MG63 were seeded in 24-wells plates and transfected with 600 ng of c-MycD1Luc reporter, 250 ng of p53D281G expression plasmid, 20 ng of the reporter pRL-CMV (Promega), together with 500 ng of pLPC-EGFP-TNV-PAs or pLPC-EGFP-TNV or pLPC-EGFP. Luciferase assays in the presence of FsA79 were performed in H1299 cells seeded in 24-well plates and transfected with 250 ng of EGR1Luc reporter, 600 ng of p53R175H or p53R273H expression plasmids, and 20 ng of the reporter pRL-CMV (Promega). FsA79 (at final concentrations of 1.6, 4, and 20 µmol/L) was added in the cDNA premix before incubation with Lipofectamine 2000. More than 90% of cells were positive to FsA79 staining (Supplementary Fig. S1B). Thirty-six hours after transfection, cells were lysed and assayed for luciferase activity using the Dual Luciferase kit (Promega). P values were obtained from two-tailed homoscedastic t tests. For RNAi, cells were transfected with 80 nmol/L double-stranded siRNA oligonucleotide for human p53 (GACUCCAGUGGUAAUCUAC) or for LacZ (GUGACCAGCGAAUACCUGGU) using Lipofectamine RNAi MAX (Invitrogen).

Coimmunoprecipitation, in vitro binding assays, and Western blot analysis. Coimmunoprecipitation (Co-IP) and in vitro binding assays were performed as described in Supplementary Data and as previously described (26). Western Blot analysis was performed using affinity purified polyclonal anti–green fluorescent protein (GFP); monoclonal anti-p53 antibody (clone: DO1; S.Cruz Biotechnology), monoclonal anti-HA (SIGMA), monoclonal anti–vesicular stomatitis virus (VSV; SIGMA), anti-PARP p85 polyclonal antibody (Promega), anti-Bax polyclonal antibody (Cell Signaling), and anti-actin polyclonal antibody (SIGMA).

Modeling and docking analysis. The structure of mutant p53 R273H was built from the crystal structure (PDB entry: 2BIM; ref. 27) after reversing all the stabilizing mutations that were necessary for crystallization (M133L, V293A, N239Y, and N268D) by means of the Swiss-PDB Viewer program (28). Aptamers were first modeled as loops inserted inside TrxA nuclear magnetic resonance structure (PDB entry: 1XOB; ref. 29) using Modeler8v2 program (30). The central structures of the best five clusters of each peptide were chosen as representative of the peptide structure. Peptides underwent to blind docking against mutant p53 by using the AutoDock 3.0.5 program (31) considering the protein static. Ligand-only side chains were considered flexible, as partial backbone conformational variability is considered by docking the five most representative structures of each peptide. Eventually, 1,250 different complexes of each peptide were produced. A more detailed description of the modeling and the docking procedure is available in the Supplementary Data.

Fluorescence-activated cell sorting analysis. Sk-Br-3, MDA-MB-468, H1299, or U20S cells were seeded in 6-wells and transfected with the indicated plasmids. Cells were collected by trypsinization, along with the supernatants, and resuspended in PBS/0.1% NP40/2 µg/mL RNaseA. After 10 min of incubation, 10 µg/mL propidium iodide was added. Cells were analyzed by cytofluorimeter (FACScalibur) after additional 20 min. At least 104 enhanced green fluorescent protein (EGFP)-positive cells were analyzed in each acquisition. For Annexin-V binding analysis, 36 h after transfection, 2 x 105 cells were collected and washed as described above, resuspended in 500 µL of 1x Binding Buffer (#1035-100; BioVision), and 1 µL AnnexinV-PE-Cyan5 reagent (#1015-200; BioVision) was added. After 5 min of incubation, cells were analyzed for AnnexinV-PE-Cy5 binding by flow cytometer. In every fluorescence-activated cell sorting (FACS) analysis, P values were obtained from one-tailed homoscedastic t tests. Etoposide was from SIGMA. PRIMA-1 was kindly provided by Klas Wiman (Karolinska Institut, Stockholm, Sweden).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Isolation of PAs interacting with mutant p53. To identify PAs that specifically recognize and bind mutant p53, a modified yeast two-hybrid screening was performed using as a bait the CD (aas 74–298) of p53R175H mutant (Fig. 1A ). A library of random PAs was generated as a prey, by inserting degenerated oligonucleotides encoding 16 aa peptides, into the catalytic site of E. coli TrxA A, used as scaffold (see Materials and Methods). The library construct (pJG4-5-HA-TNV16mers) contains an expression cassette named TNV, where the Trx cDNA is fused with an NH2-terminal HA tag and with a COOH-terminal nuclear localization sequence from SV40 virus large T-antigen (NLS) and a VSV tag (Fig. 1B; ref. 26). About 9 million clones were screened (32), and after two rounds of screening, 53 PAs were identified as interactors of p53R175H CD. These interactions were also confirmed in a tertiary screening, by using aas 74 to 393 of either p53R175H or wt p53 as baits. Ten aptamers were able to bind mutant p53R175H, but not wt p53, and were therefore chosen for further study. Sequence analysis revealed that most aptamers are rich in hydrophobic residues, even if their primary sequences do not show significant homology (Fig. 1C).


Figure 1
View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Identification of PAs interacting with mutant p53 R175H. A, representative colonies containing positive interactors from the yeast two-hybrid screening of the pJG4-5-HA-TNV-16mer library with p53R175H74-298 as a bait. Yeast clones were plated in selective medium lacking Histidine, Trypthophan, and Uracil (-HTU) and containing Galactose (Gal) plus X-Gal where indicated. B, schematic representation of the pJG4-5-HA-TNV yeast two hybrid vector and of the pLPC-EGFP-TNV mammalian expression vector. These constructs express the TNV cassette, formed by the TRX (TrxA A) cDNA, NLS nuclear localization signal, and VSV tag. Oligonucleotides from a combinatorial library encoding 16mers PAs were inserted at the RsrII restriction site in the TRX sequence. B42: TAD. C, sequences of the PAs identified in the yeast two-hybrid screening. D, interaction of EGFP-TNV-PAs with p53R175H was analyzed by Co-IP upon expression in H1299 cells. After immunoprecipitation (IP) with anti-GFP antibody, immunoprecipitated proteins and input cell lysates were analyzed by Western Blot (WB) with the indicated antibodies. Cells transfected with p53R175H and pLPC-EGFP-TNV (–) were used as control.

 
To confirm the interaction of the selected PAs with mutant p53 in mammalian cells, we generated constructs encoding the TNV cassette containing the selected aptamers fused to EGFP into pLPC expression vector (Fig. 1B). Experiments were performed by transiently overexpressing p53R175H and PAs in p53-null H1299 cells, in which they efficiently colocalize in the nucleus (Supplementary Fig. S1A). Co-IP experiments revealed that all PAs tested were able to bind to mutant p53 with the exception of B6 (Fig. 1D). Aptamers A3, A29, A60, and A79 showed the strongest interaction with p53R175H, and were therefore chosen for further characterization, whereas aptamer B6 was used as a negative control.

Aptamers may lose their ability to bind the target protein when tested as unconstrained molecules, free from the protein scaffold (33). To evaluate whether unconstrained PAs retain the ability to bind mutant p53, biotinylated 16mers were produced for in vitro binding experiments with cellular lysates of Sk-Br-3, expressing endogenous p53R175H (Supplementary Fig. S2A). Some of the tested peptides, but not a control peptide derived from the TrxA sequence (C–), retained the ability to bind to mutant p53. Due to technical problems in the chemical synthesis, we redesigned the A79 peptide, changing the position of some residues in its primary sequence (Fig. 1C). The modified biotinylated A79, called sA79, binds efficiently mutant p53 in vitro (Supplementary Fig. S2A). The interaction between sA79 inserted in the TrxA scaffold and mutant p53 was also confirmed by Co-IP experiments (Supplementary Fig. S2B).

Selective binding of PAs to mutant p53. In our screening, we searched for aptamers able to bind specifically the CD of p53R175H because this domain is expected to be structurally distorted and consequently dissimilar to that of wt p53. Therefore, we examined whether the selected PAs could discriminate between the altered conformation of mutant p53 and the native conformation of wt p53. HA-tagged versions of p53R175H and wt p53 were generated and coexpressed along with EGFP-tagged aptamers in H1299 cells. Co-IP experiments indicated that all aptamers bind stronger to p53R175H than to wt p53 (Fig. 2A ). Similar results were obtained also upon overexpression of PAs in HCT116 cells, harboring endogenous wt p53, or in Sk-Br-3 cells (Supplementary Fig. S2C). Moreover, we examined whether the PAs could recognize the p53 homologues, p73 and p63 (34), in similar Co-IP experiments. Interestingly, all selected PAs bind efficiently also HA-TAp73{alpha} (Fig. 2A) and to a lesser extent HA-TAp63{alpha} (data not shown). Taken together, these results show that the identified aptamers recognize more efficiently p53R175H and TAp73{alpha} than wt p53.


Figure 2
View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Binding of PAs to mutant p53, wt p53, and p73. A, comparison of the ability of EGFP-TNV-PAs to bind overexpressed HA-p53R175H, HA-wt p53, and HA-TAp73{alpha} in H1299 cells was performed as in Fig. 1D. Cells transfected with HA-p53R175H and pLPC (–) were used as control. B, comparison of the ability of EGFP-TNV-PAs to bind different p53 mutants and p53 wt overexpressed in H1299 cells was performed as in Fig. 1D. Cells transfected with p53R175H and pLPC (–) were used as control.

 
Finally, we tested whether PAs could also interact with other p53 mutants by performing Co-IPs with another conformational mutant (p53D281G) or with two contact mutants (p53R273H and p53R248W; Fig. 2B; Supplementary Fig. S2D). Noteworthy, when we compared the interaction of PAs with this set of proteins, we observed that they preferentially bind conformational mutants comparing with contact mutants or the wt protein (Fig. 2B). These results suggest that the selected aptamers may recognize more efficiently conformational unfolded p53 mutants.

Docking of PAs on mutant p53 R273H. Taking advantage of the restricted degrees of freedom of the PAs conformation when inserted in the TrxA scaffold, we modeled the conformation of PAs through in silico analysis. Despite the lack of significant homology among their sequences, the backbones of PAs seemed to share a fairly similar extended conformation in their NH2-terminal part (Fig. 3A ).


Figure 3
View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Prediction of PAs structures and docking on mutant p53 CD. A, structural alignment of PAs: A3 (blue), A29 (green), A60 (yellow), A79 (red), sA79 (pink), and B6 (cyan) modeled as constrained loops inserted in the Trx scaffold. PA backbones are depicted as tubes except for B6, represented as trace. B, docking of A3, A29, A60, A79, and sA79 (represented as in A) on p53 R273H CD (cyan). The CD is represented as cartoon (left) or as Van der Waals surface (right). Regions colored in pink and purple comprise the sites contacted by aptamers, summarized in Table 1. The two large loops (L2 and L3) and a LSH motif (loop L1, β-strands S2 and S2', the end of the extended β-strand S10, and the COOH-terminal helix H2) are indicated (45). C, close-up view of the PAs-mutant p53 CD interface. The mutant p53 CD is shown in gray cartoon, and PAs are shown in licorice and colored as in A. Residues that mediate interaction of PAs and mutant p53 CD are represented in licorice and colored by atom code. Interactions are represented with discontinuous yellow lines. All figures are obtained with VMD software (46).

 

View this table:
[in this window]
[in a new window]

 
Table 1. Summary of docking analysis results

 
For the docking of PAs onto mutant p53, we used the X-ray structure of superstable p53R273H, which contains four stabilizing mutations (M133L, V203A, N239Y, and N268D; PDB CODE: 2BIM; ref. 35). At present, this is the only crystal structure available for mutant p53. Indeed, despite the good knowledge of the structure of the wt p53 CD, there are only few structural information about the core domains of p53 mutants, due to their high thermodynamic instability (36). In our docking analysis, all the stabilizing mutations have been reversed using Swiss-Pdb Viewer program (see Materials and Methods).

Two regions of p53R273H were predicted to be important for docking of all the PAs considered (Table 1 ; Fig. 3B and C). They involve the N-terminus of CD and the loop-sheet-helix (LSH) motif, which establish a large number of polar interactions with the aptamers, particularly T102, L130, and N131 that interact with four of five PAs (Fig. 3B). Other residues predicted to be contacted by some aptamers comprise L111-H115 (L1), Y126-K132 (S2/S2'), and K164-H273 (L2-H1). A29 and sA79 also form extensive hydrophobic interactions with Leu111, Phe113, Tyr126, Pro128 and Thr102, Tyr103, respectively.

PAs interfere with mutant p53 transactivating functions. One of the mechanisms proposed to explain the oncogenic activity of mutant p53 is its ability to alter the transcription of several genes. In particular, p53D281G was reported to induce the c-Myc promoter (37). To test whether PAs might inhibit this activity of mutant p53, luciferase assays using a c-Myc reporter were performed after overexpression of p53D281G in p53-null MG63 cells. All aptamers were able to significantly impair the transactivation activity of mutant p53, whereas B6 failed to show any effect (Fig. 4A ). Furthermore, we also tested whether unconstrained synthetic peptides could behave similarly because they are able to interact with p53 mutants such as R175H and R273H (Supplementary Fig. S2A; data not shown). Fluoresceinated sA79 peptide (FsA79) was synthesized and used in reporter assays to test its effect on the induction of EGR-1, known to be another target of mutant p53 transactivation (19). Luciferase assays were performed by treating H1299 cells with FsA79 upon cotransfection of an EGR1 reporter along with either p53R175H or p53R273H expression constructs. The results indicated that FsA79 is able to inhibit the transactivation function of both p53 mutants (Fig. 4B).


Figure 4
View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Effect of PAs on the transcriptional activity of mutant p53, wt p53, and p73{alpha}. A, the effect of PAs on mutant p53 transactivating activity was analyzed in MG63 cells transiently transfected with Myc-Luc reporter along with constructs expressing p53D281G or empty vector and with pLPC-EGFP-TNV-PAs or control vectors pLPC-EGFP (EGFP) or pLPC-EGFP-TNV (TNV). The promoter activity measured in each experiment was normalized to the value measured in the absence of mutant p53. RLU, relative luciferase units. Graphs represent the means of three independent experiments; P value was <0.01 for all PAs relative to the aptamer B6, used as negative control, or pLPC-EGFP-TNV control vector. Expression of mutant p53 and PAs was analyzed by Western Blot with the indicated antibodies. B, the effect of FsA79 peptide on the transactivation of EGR1 promoter by mutant p53 was analyzed in H1299 cells, transfected with EGR1-Luc reporter along with plasmids encoding either p53R175H (left) or p53R273H (right), and treated with increasing amounts of FsA79 peptide (1.6, 4, and 20 µmol/L). Luciferase assays were performed and represented as in A. C, the effect of PAs on p53 wt transcriptional activity was analyzed in H1299 cells transfected with p21-Luc reporter, wt p53-expressing vector, or empty vector along with constructs expressing the EGFP-TNV-PAs or control vectors as in A. Luciferase assays were performed and represented as in A. D, the effect of PAs on the transcriptional activity of TAp73{alpha} was analyzed as in C. *, P = 0.003.

 
As shown above, all PAs recognized wt p53 less efficiently (Fig. 2). To test if PAs may also affect the transcriptional activity of wt p53, H1299 cells were transfected with a reporter bearing the p21 promoter (p21-Luc) along with vectors expressing wt p53 and PAs. Under these conditions, none of the PAs was able to affect the transcriptional activity of wt p53 (Fig. 4C). Interestingly, similar results were obtained when we have analyzed the effect of PAs on the transactivation of p21-Luc by TAp73{alpha} (Fig. 4D), with the exception of A3, which showed a slight reduction of TAp73{alpha} activity. Moreover, when assayed on a reporter construct bearing the Bax promoter (Bax-Luc), PAs did not significantly affect the transactivation of either wt p53 or TAp73{alpha}, with the exception of A60 (Supplementary Fig. S3). Taken together, these results indicate that PAs, able to specifically bind mutant p53, interfere with its transactivation ability but do not alter the activity of either wt p53 or TAp73{alpha}.

PAs trigger apoptosis specifically in cells bearing mutant p53. Because the expression of mutant p53 in tumor cells has been associated with increased cell proliferation and survival (38, 39), we sought to analyze the effect of PAs on cell cycle and apoptosis of two cancer cell lines (Sk-Br-3 and MDA-MB-468) bearing endogenous mutant p53 (respectively, p53R175H and p53R273H). To selectively analyze cells expressing the PAs, propidium-iodide staining was measured only in the EGFP-positive cell population. FACS analysis of EGFP-positive cells revealed an increment in the sub-G1 population, indicative of apoptotic cell death, only in cells expressing PAs able to bind mutant p53 (Fig. 5A ), whereas no relevant changes were observed in other cell cycle variables (Supplementary Fig. S4A and B). On the other hand, no effect was observed in cells transfected with B6, which is unable to bind mutant p53. Furthermore, PAs did not seem to induce apoptosis of either p53-null H1299 cells or U2OS cells, expressing endogenous wt p53 (Fig. 5A). Noteworthy, upon ablation of endogenous mutant p53 in MDA-MB-468 cells by using specific siRNA, we observed that the effect of the two more effective PAs, A29 and sA79, was significantly reduced (Fig. 5B). To further support the observation that PAs induce cell death specifically in cells expressing mutant p53, we generated polyclonal H1299 cell populations stably expressing p53R175H. PAs induced apoptosis in these cells, whereas no effect was observed in control cells transfected with the empty vector (Supplementary Fig. S4C). All these data suggest that the effect of PAs depends on the presence of mutant p53.


Figure 5
View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. PAs trigger apoptosis specifically in cells bearing mutant p53. A, the apoptotic effect of PAs was analyzed in U2OS (expressing p53 wt), H1299 (p53 null), Sk-Br-3 (expressing p53R175H), and MDA-MB-468 (expressing p53R273H) cells. Cells were transfected either with constructs expressing EGFP-TNV-PAs or pLPC control vector, harvested after 36 h, and stained with propidium iodide before analyzing the DNA content of EGFP-positive cells by flow cytometry. Columns, mean percentage of cells with sub-G1 DNA content measured in three independent experiments; bars, SD. The P values of individual PAs compared with negative controls (aptamer B6 or pLPC vector) were <0.01 in each cell line analyzed. B, analysis of the apoptotic effect of PAs in MDA-MB-468 cells treated with control siRNA (LacZ; black bars) or siRNA for p53 (white bars). Cells were treated and analyzed as in A. Expression of the overexpressed EGFP-TNV-PAs, as well as endogenous p53R273H and actin, was analyzed by Western Blot with the indicated antibodies. The P values of individual PAs compared with negative controls (aptamer B6 or pLPC vector) were <0.01. C, analysis of AnnexinV-PE-Cyan5 staining of Sk-Br-3 cells transfected with constructs encoding either EGFP-TNV-B6, EGFP-TNV-A29, or EGFP-TNV-sA79 PAs or with pLPC control vector. At least 104 EGFP-positive cells were analyzed in each acquisition. Columns, mean of three independent experiments; bars, SD. The P values of A29 and sA79 relative to B6 were <0.01. Expression of the overexpressed EGFP-TNV-PAs as well as endogenous cleaved PARP (p85), p53R175H, and the proapoptotic protein Bax was analyzed by Western Blot with the indicated antibodies. D, Sk-Br-3 cells were transfected with constructs encoding EGFP-TNV-A29 and sA79 PAs and then treated either with Etoposide 10 µmol/L (gray bars), 50 µmol/L (white bars), or with DMSO as control (NT; black bars). FACS analysis of DNA content was then performed as in A. Aliquots of cell lysates untreated (NT) or treated with 50 µmol/L Etoposide (Eto) were analyzed by Western Blot.

 
The ability to induce apoptosis displayed by the most effective PAs (A29 and sA79) was confirmed by Annexin-V assays in EGFP-positive cells. Flow cytometry analysis showed an increase of ~2-fold in the percentage of Annexin-V–positive cells upon transfection with the selected PAs, compared with control-transfected cells (Fig. 5C; Supplementary Fig. S4D and E). Finally, an increase of the cleaved p85 fragment of PARP-1 in Sk-Br-3 cells transfected with A29 or sA79, further confirmed the ability of these aptamers to induce apoptosis (Fig. 5C).

We next compared the apoptotic activity of PAs to the effect of commonly used anticancer drugs and also evaluated their possible cooperation. Sk-Br-3 cells were transfected with A29, sA79, or B6 aptamers, treated with two different doses of Etoposide or left untreated and then assayed for the sub-G1 DNA content as above. Interestingly, we observed that expression of the PAs interacting with mutant p53 was sufficient to induce an apoptotic response comparable with that observed upon drug treatment alone (Fig. 5D). No further increment of cell death was however evidenced when cells transfected with PAs were simultaneously exposed to Etoposide (Fig. 5D, gray and white bars).

Moreover, we compared PAs with other molecules previously reported to induce cell death in cells bearing mutant p53, such as peptide 46 and PRIMA-1 (40). First, Sk-Br-3 cells were transfected with the PAs A29 or sA79 or a pLPC-EGFP-TNV construct containing the sequence encoding the peptide 46 and analyzed as above. Propidium iodide staining showed that PAs and peptide 46 produce a similar induction of apoptosis (Supplementary Fig. S4F). Second, Sk-Br-3 cells transfected with aptamer B6, unable to induce apoptosis, and treated with 100 µmol/L PRIMA-1 for 20 hours were compared with cells transfected with A29 or sA79. Also in this case, the percentage of apoptosis in cells expressing PAs was comparable with that induced by PRIMA-1 (Supplementary Fig. S4G). These data therefore suggest that PAs can induce apoptosis specifically in cells expressing mutant p53 to a level comparable with chemotherapeutic drugs, peptide 46, and PRIMA-1.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Mutation of the p53 gene is one of the most frequent alterations found in human cancers (3). The vast majority consists of missense mutations leading to the expression of p53 point mutants, which accumulate to high levels in tumor cells. The presence of these mutant proteins actively contributes to tumorigenesis, either by inhibiting wt p53 activity or by gaining new functions, which may concur to the development of an invasive and metastatic phenotype (reviewed in refs. 7, 38). Consequently, mutant p53 may be regarded as an excellent target for therapeutic approaches aimed at hampering tumor progression. Ablation of mutant p53 expression was indeed shown to reduce proliferation, chemoresistance, and tumorigenicity in several tumor-derived cell lines (15). Moreover, mutant p53-based cancer therapies are expected to be highly selective, leaving unaffected normal cells, which express wt p53.

In the present work, we have identified five PAs able to interact with p53 point mutants. All of them interact preferentially with p53 conformational mutants (R175H, D281G) comparing with contact mutants (R273H, R248W). Moreover, they also bind less efficiently to wt p53, suggesting that the altered conformation of unfolded p53 mutants enhances the interaction.

Docking analysis performed on the available crystal structure of p53R273H, with all the stabilizing mutations reversed to the original residues (36), predicted that all PAs would bind the same region of the mutant p53 CD. Notably, this area partially overlaps with a region that in wt p53 was previously defined as a promiscuous site, involved in the interactions with DNA and proteins, such as Rad51, 53BP2, 53BP1, and Bcl-XL (41).

Interestingly, PAs that interact with mutant p53 are also able to bind efficiently TAp73{alpha}. This may be due to the presence of a structural element in TAp73{alpha} similar to that recognized by PAs in mutant p53. A more detailed structural analysis would be necessary to address this point. Despite their ability to bind TAp73{alpha}, PAs did not significantly affect its transcriptional activity toward p21 and Bax promoters, suggesting that they may not perturb the interaction of TAp73{alpha} with DNA or other cofactors. Conversely, PAs seem to interfere specifically with the transactivating functions of p53 mutants. The oncogenic activity of mutant p53 was associated to its ability to induce transcription of several target genes (42). Even if p53 mutants are unable, or have a reduced ability, to bind wt p53 responsive elements on DNA, they are able to modify gene expression by establishing aberrant complexes with transcription factors (16, 17). According to our results, PAs interfere with the transactivation of c-Myc and EGR-1 promoters by p53 mutants, suggesting that they might act by affecting protein-protein interactions that are relevant for transcriptional activation of these genes.

In addition, we have observed a specific ability of PAs to induce cell death in different cell lines expressing mutant p53, whereas the same PAs failed to produce any effect in cells bearing wt p53 or in p53-null cells. Moreover, ablation of endogenous mutant p53 reduced PA-induced cell death, further suggesting that the induction of apoptosis depends on the presence of mutant p53. The ability of peptides or small molecules, such as PRIMA-1, to induce mutant p53–dependent apoptosis was reported previously (reviewed in ref. 23). In some cases, cell death was associated with restoration of wt functions in mutant p53 proteins, including the ability to bind p53 responsive elements on DNA and to transactivate some of the target genes of wt p53. Of note, the apoptotic response induced by PAs was comparable with that exerted by PRIMA-1. However, the PAs described here seem to behave differently from molecules that reactivate wt p53 functions. In fact, upon binding to mutant p53, PAs were neither able to restore its ability to bind DNA, as judged by EMSA assays, nor to induce wt p53 target genes, such as p21 and Bax (Figs. 4C and 5C; data not shown).

Even if the exact mechanism by which the PAs induce cell death still remains to be determined, it is well-conceivable that PA-induced apoptosis may arise from the activation of alternative types of programmed cell death. Indeed, it was recently reported that a peptide derived from the p53 C-terminus (peptide 46) could induce apoptosis in different tumor cells expressing mutant p53 (40, 43, 44), which was associated with increased PARP-1 cleavage, but not with significant changes in the expression of Bcl-2 family members (40), similar to what we observed in cancer cells expressing PAs.

Ablation of mutant p53 was shown to enhance the induction of cell death upon treatment with genotoxic drugs; however, it is not sufficient to induce apoptosis in the absence of drug treatment (15). Instead, expression of PAs alone, in cells bearing mutant p53, exerted an apoptotic response similar to that induced by Etoposide, and no further increment was observed by concomitant administration of the drug and PAs to cells (Fig. 5D).

These results suggest that the association of PAs with mutant p53 may have a cytotoxic effect. Aberrant interactions of mutant p53 with different proteins was proposed to contribute to its oncogenic functions (38). Among them, transcription cofactors could be deregulated upon interaction with mutant p53 (16) or proapoptotic proteins, such as p73 and p63, could be sequestered by mutant p53 (20, 21). Therefore, the cytotoxic effect of PAs, could derive from their ability to perturb the profile of mutant p53 interactors, either by altering mutant p53 structure or by directly displacing other interactors, which may share with PAs some structural features relevant for their interactions with mutant p53. In this way, proapoptotic factors could be released and activated. A more detailed characterization of these similarities could be useful to identify new mutant p53 interactors.

In summary, our work shows that PAs able to interact with p53 point mutants, interfere with its functions and induce apoptosis in tumor-derived cell lines bearing mutant p53. Based on their characteristics, PAs may be exploited to specifically target tumor cells expressing p53 mutants and therefore they may represent a starting point to design efficient peptido-mimetic drugs.


    Disclosure of Potential Conflicts of Interest
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
E. Guida, A. Bisso, and G. Del Sal: ownership interest/patent. The other authors disclosed no potential conflicts of interest.


    Acknowledgments
 
Grant support: Associazione Italiana per la Ricerca sul Cancro, Ministero Italiano dell'Università e della Ricerca (G. Del Sal) and by EC FP6 funding (contract 502983). This publication reflects the authors' views and not necessarily those of the European Community.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank A. Lunardi, F. Chiacchiera, and all our colleagues at The National Laboratory CIB for critical discussion, and to C. Salvagno and S. Piazza for technical assistance. We thank Zippora Shakked, Susan Haupt, and Ygal Haupt for critical reading of the MS and M. Giacca, R. Mendoza Maldonado, and M. Bestagno for access to ICGEB facilities.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

A. Bisso and M. Napoli are FIRC fellows.

Received 1/11/08. Revised 4/15/08. Accepted 6/ 4/08.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Hainaut P, Hollstein M. p53 and human cancer: the first ten thousand mutations. Adv Cancer Res 2000;77:81–137.[Medline]
  2. Vogelstein B, Lane D, Levine AJ. Surfing the p53 network. Nature 2000;408:307–10.[CrossRef][Medline]
  3. Soussi T. p53 alterations in human cancer: more questions than answers. Oncogene 2007;26:2145–56.[CrossRef][Medline]
  4. Harris SL, Levine AJ. The p53 pathway: positive and negative feedback loops. Oncogene 2005;24:2899–908.[CrossRef][Medline]
  5. Toledo F, Wahl GM. Regulating the p53 pathway: in vitro hypotheses, in vivo veritas. Nat Rev Cancer 2006;6:909–23.[CrossRef][Medline]
  6. Joerger AC, Fersht AR. Structure-function-rescue: the diverse nature of common p53 cancer mutants. Oncogene 2007;26:2226–42.[CrossRef][Medline]
  7. Bullock AN, Fersht AR. Rescuing the function of mutant p53. Nat Rev Cancer 2001;1:68–76.[CrossRef][Medline]
  8. Kim E, Deppert W. Transcriptional activities of mutant p53: when mutations are more than a loss. J Cell Biochem 2004;93:878–86.[CrossRef][Medline]
  9. Bergamaschi D, Gasco M, Hiller L, et al. p53 polymorphism influences response in cancer chemotherapy via modulation of p73-dependent apoptosis. Cancer Cell 2003;3:387–402.[CrossRef][Medline]
  10. Dittmer D, Pati S, Zambetti G, et al. Gain of function mutations in p53. Nat Genet 1993;4:42–6.[CrossRef][Medline]
  11. Lang GA, Iwakuma T, Suh YA, et al. Gain of function of a p53 hot spot mutation in a mouse model of Li-Fraumeni syndrome. Cell 2004;119:861–72.[CrossRef][Medline]
  12. Olive KP, Tuveson DA, Ruhe ZC, et al. Mutant p53 gain of function in two mouse models of Li-Fraumeni syndrome. Cell 2004;119:847–60.[CrossRef][Medline]
  13. Caulin C, Nguyen T, Lang GA, et al. An inducible mouse model for skin cancer reveals distinct roles for gain- and loss-of-function p53 mutations. J Clin Invest 2007;117:1893–901.[CrossRef][Medline]
  14. Hingorani SR, Wang L, Multani AS, et al. Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer Cell 2005;7:469–83.[CrossRef][Medline]
  15. Bossi G, Lapi E, Strano S, Rinaldo C, Blandino G, Sacchi A. Mutant p53 gain of function: reduction of tumor malignancy of human cancer cell lines through abrogation of mutant p53 expression. Oncogene 2006;25:304–9.[Medline]
  16. Di Agostino S, Strano S, Emiliozzi V, et al. Gain of function of mutant p53: the mutant p53/NF-Y protein complex reveals an aberrant transcriptional mechanism of cell cycle regulation. Cancer Cell 2006;10:191–202.[CrossRef][Medline]
  17. Kalo E, Buganim Y, Shapira KE, et al. Mutant p53 attenuates the SMAD-dependent TGF-{β}1 signaling pathway by repressing the expression of TGF-{β} receptor type II. Mol Cell Biol 2007; 27:8228–42. Epub 2007 Sep 17.[Abstract/Free Full Text]
  18. Scian MJ, Stagliano KE, Deb D, et al. Tumor-derived p53 mutants induce oncogenesis by transactivating growth-promoting genes. Oncogene 2004;23:4430–43.[CrossRef][Medline]
  19. Weisz L, Zalcenstein A, Stambolsky P, et al. Transactivation of the EGR1 gene contributes to mutant p53 gain of function. Cancer Res 2004;64:8318–27.[Abstract/Free Full Text]
  20. Strano S, Munarriz E, Rossi M, et al. Physical and functional interaction between p53 mutants and different isoforms of p73. J Biol Chem 2000;275:29503–12.[Abstract/Free Full Text]
  21. Strano S, Fontemaggi G, Costanzo A, et al. Physical interaction with human tumor-derived p53 mutants inhibits p63 activities. J Biol Chem 2002;277:18817–26.[Abstract/Free Full Text]
  22. Song H, Hollstein M, Xu Y. p53 gain-of-function cancer mutants induce genetic instability by inactivating ATM. Nat Cell Biol 2007;9:573–80.[CrossRef][Medline]
  23. Selivanova G, Wiman KG. Reactivation of mutant p53: molecular mechanisms and therapeutic potential. Oncogene 2007;26:2243–54.[CrossRef][Medline]
  24. Colas P, Cohen B, Jessen T, Grishina I, McCoy J, Brent R. Genetic selection of peptide aptamers that recognize and inhibit cyclin-dependent kinase 2. Nature 1996;380:548–50.[CrossRef][Medline]
  25. Mantovani F, Tocco F, Girardini J, et al. The prolyl isomerase Pin1 orchestrates p53 acetylation and dissociation from the apoptosis inhibitor iASPP. Nat Struct Mol Biol 2007;14:912–20.[CrossRef][Medline]
  26. Gostissa M, Morelli M, Mantovani F, et al. The transcriptional repressor hDaxx potentiates p53-dependent apoptosis. J Biol Chem 2004;279:48013–23.[Abstract/Free Full Text]
  27. Joerger AC, Ang HC, Veprintsev DB, Blair CM, Fersht AR. Structures of p53 cancer mutants and mechanism of rescue by second-site suppressor mutations. J Biol Chem 2005;280:16030–7.[Abstract/Free Full Text]
  28. Guex N, Peitsch MC. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 1997;18:2714–23.[CrossRef][Medline]
  29. Jeng MF, Campbell AP, Begley T, et al. High-resolution solution structures of oxidized and reduced Escherichia coli thioredoxin. Structure 1994;2:853–68.[Medline]
  30. Sali A, Blundell TL. Comparative protein modelling by satisfaction of spatial restraints. J Mol Biol 1993;234:779–815.[CrossRef][Medline]
  31. Morris GM, Goodsell DS, Halliday RS, et al. Automated docking using a lamarckian genetic algorithm and empirica = l free energy function. J Comp Chem 1998;19:1639.[CrossRef]
  32. Fields S, Sternglanz R. The two-hybrid system: an assay for protein-protein interactions. Trends Genet 1994;10:286–92.[CrossRef][Medline]
  33. Hoppe-Seyler F, Crnkovic-Mertens I, Tomai E, Butz K. Peptide aptamers: specific inhibitors of protein function. Curr Mol Med 2004;4:529–38.[CrossRef][Medline]
  34. Kaelin WG, Jr. The emerging p53 gene family. J Natl Cancer Inst 1999;91:594–8.[Abstract/Free Full Text]
  35. Joerger AC, Allen MD, Fersht AR. Crystal structure of a superstable mutant of human p53 core domain. Insights into the mechanism of rescuing oncogenic mutations. J Biol Chem 2004;279:1291–6.[Abstract/Free Full Text]
  36. Chen JM, Rosal R, Smith S, Pincus MR, Brandt-Rauf PW. Common conformational effects of p53 mutations. J Protein Chem 2001;20:101–5.[CrossRef][Medline]
  37. Frazier MW, He X, Wang J, Gu Z, Cleveland JL, Zambetti GP. Activation of c-myc gene expression by tumor-derived p53 mutants requires a discrete C-terminal domain. Mol Cell Biol 1998;18:3735–43.[Abstract/Free Full Text]
  38. Sigal A, Rotter V. Oncogenic mutations of the p53 tumor suppressor: the demons of the guardian of the genome. Cancer Res 2000;60:6788–93.[Abstract/Free Full Text]
  39. Deppert W. Mutant p53: from guardian to fallen angel? Oncogene 2007;26:2142–4.[CrossRef][Medline]
  40. Dinnen RD, Drew L, Petrylak DP, et al. Activation of targeted necrosis by a p53 peptide: a novel death pathway that circumvents apoptotic resistance. J Biol Chem 2007;282:26675–86.[Abstract/Free Full Text]
  41. Friedler A, Veprintsev DB, Rutherford T, von Glos KI, Fersht AR. Binding of Rad51 and other peptide sequences to a promiscuous, highly electrostatic binding site in p53. J Biol Chem 2005;280:8051–9.[Abstract/Free Full Text]
  42. Weisz L, Oren M, Rotter V. Transcription regulation by mutant p53. Oncogene 2007;26:2202–11.[CrossRef][Medline]
  43. Kim AL, Raffo AJ, Brandt-Rauf PW, et al. Conformational and molecular basis for induction of apoptosis by a p53 C-terminal peptide in human cancer cells. J Biol Chem 1999;274:34924–31.[Abstract/Free Full Text]
  44. Senatus PB, Li Y, Mandigo C, et al. Restoration of p53 function for selective Fas-mediated apoptosis in human and rat glioma cells in vitro and in vivo by a p53 COOH-terminal peptide. Mol Cancer Ther 2006;5:20–8.[Abstract/Free Full Text]
  45. Cho Y, Gorina S, Jeffrey PD, Pavletich NP. Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations. Science 1994;265:346–55.[Abstract/Free Full Text]
  46. Humphrey W, Dalke A, Schulten K. VMD: visual molecular dynamics. J Mol Graph 1996;14:33–8, 27–8.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guida, E.
Right arrow Articles by Del Sal, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guida, E.
Right arrow Articles by Del Sal, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online