Cancer Research AACR Legacy Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Cancer Research 68, 6969, September 1, 2008. doi: 10.1158/0008-5472.CAN-08-1322
© 2008 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Groen, R. W.J.
Right arrow Articles by Pals, S. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Groen, R. W.J.
Right arrow Articles by Pals, S. T.

Cell, Tumor, and Stem Cell Biology

Illegitimate WNT Pathway Activation by β-Catenin Mutation or Autocrine Stimulation in T-Cell Malignancies

Richard W.J. Groen1, Monique E.C.M. Oud1, Esther J.M. Schilder-Tol1, Marije B. Overdijk1, Derk ten Berge2, Roel Nusse2, Marcel Spaargaren1 and Steven T. Pals1

1 Department of Pathology, Academic Medical Center, University of Amsterdam, Amsterdam, the Netherlands and 2 Howard Hughes Medical Institute and Department of Developmental Biology, Stanford University, Stanford, California

Requests for reprints: Steven T. Pals, Department of Pathology, Academic Medical Center, University of Amsterdam, Meibergdreef 9, 1105 AZ Amsterdam, the Netherlands. Phone: 31-20-5665644; Fax: 31-20-5669523; E-mail: s.t.pals{at}amc.uva.nl.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Recent studies in mice have shown a role for the canonical WNT pathway in lymphocyte development. Because cancers often arise as a result of aberrant activation of signaling cascades that normally promote the self-renewal and expansion of their progenitor cells, we hypothesized that activation of the WNT pathway might contribute to the pathogenesis of lymphoproliferative disease. Therefore, we screened a large panel (n = 162) of non–Hodgkin lymphomas (NHL), including all major WHO categories, for nuclear expression of β-catenin, a hallmark of "active" WNT signaling. In 16 lymphomas, mostly of T-lineage origin, nuclear localization of β-catenin was detected. Interestingly, some of these tumors contained established gain-of-function mutations in the gene encoding β-catenin (CTNNB1); however, in the majority, mutations in either CTNNB1 or APC were not detected. Functional analysis of WNT signaling in precursor T-lymphoblastic lymphomas/leukemias, the NHL subset in which β-catenin accumulation was most prevalent (33% positive), revealed a constitutively activated, but still responsive, WNT pathway, which controlled T-cell factor–mediated gene transcription and cell growth. Our data indicate that activation of the WNT pathway, either by CTNNB1 mutation or autocrine stimulation, plays a role in the pathogenesis of a subset of NHLs, in particular, those of T-cell origin. [Cancer Res 2008;68(17):6969–77]


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Non–Hodgkin lymphomas (NHL) represent a heterogeneous group of malignancies originating from lymphocytes arrested at specific stages of differentiation (1). The transition of a lymphocyte to a fully transformed aggressive lymphoma is a multistep process, which requires the activation of proto-oncogenes, as well as the disruption of tumor suppressor genes (1–3). In spite of their genetic defects, most lymphomas do not replicate spontaneously in vitro, implying that they are still dependent on environmental stimuli for their growth. To date, these external factors are ill defined (2).

WNT signals form one class of paracrine growth factors that could act to influence lymphoma growth. WNT proteins are able to promote the proliferation of progenitor cells or stem cells (4–6), and their sustained overexpression can cause cancer (7, 8). WNT genes encode a family of 19 secreted glycoproteins, which promiscuously interact with several Frizzled (FZD) receptors. This leads to intracellular signals that control gene expression, cell behavior, cell adhesion, and cell polarity during both embryonic development and postnatal life (9, 10). The key event in the WNT signaling pathway is the stabilization of β-catenin. In the absence of WNT signals, a complex of proteins, including the tumor suppressor gene product APC, axin, and glycogen synthase kinase-3β (GSK3β), controls phosphorylation of specific serine and threonine residues in the NH2 terminal region of β-catenin. This phosphorylation marks β-catenin for ubiquitination and degradation by the proteasome. Signaling by WNT proteins blocks GSK3β activity, resulting in the accumulation of β-catenin, which will translocate to the nucleus. Here, it interacts with T-cell factor (TCF) transcription factors (11, 12) to drive transcription of target genes (13–15). Mutations of the phosphorylation sites in the NH2 terminal domain of β-catenin or mutations of the APC tumor suppressor, leading to the formation of constitutive nuclear β-catenin/TCF complexes and altered expression of target genes, have been found in many types of cancer (8, 16, 17). Target genes, which presumably cooperate in neoplastic transformation, include CCND1 (cyclin D1; ref. 13), MYC (14), CD44 (18), and MET (19).

TCF/LEF family transcription factors were initially identified in models of early lymphocyte development (4, 20, 21), whereas studies in TCF-1 and LEF1 knockout mice have shown that these factors are essential for the maintenance of progenitor T-cell and B-cell compartments (4, 22). These observations suggested a role for WNT signaling in the control of cell proliferation and survival during lymphocyte development. Indeed, recent studies have shown that WNT factors and β-catenin affect lymphocyte progenitor fate, as well as hematopoietic stem cell self-renewal (5, 6, 23–27). These observations, combined with the key oncogenic role of WNT signaling in several nonlymphoid tumors and our recent finding that the WNT pathway is illegitimately activated in multiple myeloma (28), prompted us to explore whether deregulation of WNT signaling contributes to lymphoid neoplasia. Although the specificity of WNT signals with respect to target cells is relatively unknown, there is now a powerful method to examine whether cells are activated by a WNT signal, i.e., detection of accumulation and nuclear localization of β-catenin. Here, we show that canonical WNT signaling is active in a substantial subset of precursor T-lymphoblastic lymphomas/leukemias (T-LBL/ALL) and peripheral (mature) T-cell lymphomas (pTL) and that WNT signals are involved in the control of lymphoma growth.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosure of Potential...
 References
 
Case selection and classification. A panel of NHLs was selected from the files of the Department of Pathology, Academic Medical Center, University of Amsterdam. All tumors were classified according to the WHO classification using standard histologic, immunohistochemical, and molecular criteria.

Immunohistochemistry. Immunohistochemical staining was performed on formalin-fixed paraffin-embedded tissue sections or cell lines. Endogenous peroxidase activity was blocked with 0.1% NaN3 and 1.5% H2O2 in a 20-mmol/L citrate buffer. For detection of β-catenin, we used an antigen retrieval protocol, which allows effective and specific detection of nuclear β-catenin in formalin-fixed paraffin-embedded tissue sections (29). In brief, the sections were gently boiled for 50 min in a Tris/EDTA buffer (respectively 40 mmol/L:1 mmol/L; pH 8); after which, they were blocked with 1% bovine serum albumin (BSA) in PBS and incubated for 2 h with anti–β-catenin monoclonal antibody clone 14 (BD Biosciences). Binding of the antibody was visualized using the Envision+ detection system and DAB+ (DAKO). The sections were counterstained with hematoxylin (Merck). Slides were analyzed with a BX51 microscope (Olympus), and images were captured using Olympus software and a DP70 camera (Olympus).

Mutation analysis. DNA for PCR amplification was extracted and purified from representative tumor tissue using the QIAamp DNA Mini kit (Qiagen) for paraffin-embedded material or DNAzol (Invitrogen Life Technologies) for snap-frozen material. Of CTNNB1, we analyzed exon 3 encoding amino acids 25-65 for gain of function mutations. This domain, containing the phosphorylation sites important for ubiquitination and degradation of β-catenin was screened, using the following primers: forward, 5' ATGGAACCAGACAGAAAAGC 3' and reverse, 5' GCTACTTGTTCTTGAGTGAAG 3'. The PCR mixture contained 100 ng of genomic DNA, 1x PCR Rxn buffer (Invitrogen Life Technologies), 0.2 mmol/L deoxynucleotide triphosphate (dNTP), 2 mmol/L MgCl2, 0.2 mg/mL BSA (Roche), 0.2 µmol/L of each primer, and 1 unit of platinum Taq polymerase (Invitrogen Life Technologies). PCR conditions were denaturing at 95°C for 5 min, followed by 35 cycles of 45 s at 95°C, 45 s at 52°C, and 1 min and 30 s at 72°C. The reaction was completed for 10 min at 72°C. The PCR products were cloned into pCR2.1-TOPO (Invitrogen Life Technologies), and several clones were sequenced to determine specificity of the amplified products using a big-dye terminator kit (Amersham Biosciences) and the T7 primer.

For APC, we analyzed four overlapping regions spanning the mutation cluster region (MCR) located between codons 1286 and 1513 in exon 15. Mutations in this region lead to a truncated APC protein, which has lost its ability to bind axin and to regulate β-catenin. Nonradioactive PCR-SSCP analysis was performed to screen the MCR of APC for mutations. Four overlapping regions were amplified spanning the MCR using the following primers: fragment I, 5' GAAATAGGATGTAATCAGACG 3' and 5' CGCTCCTGAAGAAAATTCAAC 3'; fragment II, 5' AGACTGCAGGGTTCTAGTTTATC 3' and 5' GAGCTGGCAATCGAACGACT 3'; fragment III, 5' TACTTCTGTCAGTTCACTTGAT 3' and 5' ATTTTTAGGTACTTCTCGCTTG 3'; fragment IV, 5' AAACACCTCCACCACCTCCT 3' and 5' GCATTATTCTTAATTCCACATC 3'. PCR conditions were denaturing at 96°C for 7 min, followed by 35 cycles of 50 s at 96°C, 50 s at 56°C, 50 s at 72°C, and a final elongation step at 72°C for 10 min. The PCR mixture contained 100 ng of genomic DNA, 1x PCR Rxn buffer (Invitrogen Life Technologies), 0.2 mmol/L dNTP, 2 mmol/L MgCl2, 0.2 µmol/L of each primer, and 0.5 units platinum Taq polymerase (Invitrogen Life Technologies). SSCP was performed using the GeneGel Excel 12.5/24 kit (Amersham Biosciences). PCR mixture (7 µL) was diluted with 7 µL of a denaturing solution, consisting of 23.75 mL formamide (95%), 1.25 mL xylene cyanol (1%), and 10 mg bromophenol blue. Samples were denatured at 95°C for 5 min and directly placed on ice; 5-µL sample was applied to the gel. Samples were run at two different temperatures, 5°C and 15°C, at a GenePhor Electrophoresis unit. Gels were stained according to manufacturer's protocol using the PlusOne DNA Silver Staining kit (Amersham Biosciences).

For NOTCH1, exons 26, 27, and 34 were analyzed with nonradioactive PCR-SSCP analysis using primers, as described by Weng and colleagues (30) and the above mentioned PCR conditions. PCR amplicons exhibiting aberrant migration patterns during SSCP were ligated into pCR2.1-TOPO (Invitrogen Life Technologies), and several clones were sequenced to determine specificity of the amplified products using a big-dye terminator kit (Amersham Biosciences) and the T7 primer.

Images were captured using a Imacon digital back (Hasselblad) and processed with Adobe Photoshop. All primers were manufactured by Sigma-Aldrich.

Cell culture and transfections. T-LBL/ALL cell lines, Molt4, CCRF-CEM, and SupT1, were cultured in Iscove's medium (Invitrogen Life Technologies) supplemented with 10% FCS, penicillin (50 units/mL), and streptomycin (50 µg/mL; both from Invitrogen Life Technologies). L cells, stably transfected with the TOPFLASH and LacZ reporter plasmids ("LSL cells"; ref. 31), were cultured in DMEM (Invitrogen Life Technologies) supplemented with 10% FCS, penicillin (50 units/mL), and streptomycin (50 µg/mL).

Transient transfections were performed by electroporation using the Bio-Rad GenePulser (Bio-Rad) at 250 V and 960 µF.

Conditioned medium was obtained from cells being seeded at a density of 8x 105/mL and cultured for 48 h in fully supplemented medium. As control, the fully supplemented medium was incubated for 48 h without cells.

Western blot analysis. Cells were lysed with an NP40 lysis buffer, containing 20 mmol/L Tris-HCl (pH 8), 300 mmol/L NaCl, 2% NP40, 20% glycerol, 10 mmol/L EDTA, 4 mmol/L Na3VO4, 10 mmol/L NaF, and protease inhibitors. Equal amounts of protein (25 µg/lane) were loaded. Samples were separated by 10% SDS-PAGE and subsequently blotted. Equal loading was confirmed by staining the lower part of the blot (<50 kDa) with anti–β-actin monoclonal antibody (clone AC-15, Sigma-Aldrich). The upper part (>50 kDa) was stained for β-catenin (clone 14; BD Biosciences) or non–phosphorylated β-catenin (clone 8E4; Alexis Biochemicals). Primary antibodies were detected by a horseradish peroxidase–conjugated rabbit anti-mouse, followed by detection using Lumi-LightPLUS western blotting substrate (Roche).

Luciferase assay. Cells were transfected with either the TOPFLASH or the FOPFLASH reporter construct alone or in combination with constructs expressing S33Y β-catenin, Dickkopf-1 (DKK1), dnTCF4, or a control plasmid without insert. If indicated, stimuli were added 24 h after transfection or plating. After 48 h, cells were harvested and lysed, and luciferase activity was determined using the Dual-Luciferase Reporter assay (Promega). Luciferase activity in LSL cells was determined using the dual-light system for combined detection of luciferase and β-galactosidase (Applied Biosystems).

Growth analysis. Cells were cotransfected with pEGFP-N3 (Invitrogen Life Technologies) and either a construct expressing S33Y β-catenin or an empty vector. At 24 h after transfection, viable GFP-positive cells were sorted using a FACSAria (BD Biosciences). Sorted cells were plated in 96-well flat-bottomed tissue culture plates (Costar) at a density of 104 cells/200 µL and cultured for 4 d. At day 2 and 4, cells were analyzed for viability by means of a trypan blue staining (Sigma-Aldrich). Results are expressed as total number of viable cells.

WNT signaling pathway gene array. Total RNA was isolated using Trizol according to the manufacturer (Invitrogen Life Technologies). The RNA was further purified using isopropanol precipitation and was concentrated using the RNeasy MinElute Cleanup kit (Qiagen). The quantity of total RNA was measured using a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies), and the RNA quality was examined using the Agilent 2100 bioanalyzer (Agilent Technologies). Total RNA (3 µg) was used for cDNA synthesis, labeling, and amplification and subsequently hybridized to a WNT signaling pathway Oligo GEArray membrane (OHS-043) according to manufacturer's protocol (SuperArray). After chemiluminescent detection, images were analyzed using manufacturer's software (SuperArray).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosure of Potential...
 References
 
Aberrant activation of the canonical WNT signaling pathway in non–Hodgkin lymphomas. To explore whether the WNT signaling pathway activation might play a role in the pathogenesis of lymphoid malignancies, we screened a large panel of NHLs for a key feature of active canonical WNT signaling, i.e., the presence of nuclear β-catenin, by using a staining protocol that allows effective and specific detection of nuclear β-catenin in formalin-fixed paraffin-embedded tissue sections (29). As expected, this method revealed a strong nuclear β-catenin staining in colorectal carcinoma tissue from patients with familial adenomatous polyposis (FAP), in which β-catenin is stabilized as a consequence of loss of APC function (Fig. 1A, left ). By contrast, the B and T cells in normal lymph nodes, thymus, tonsils, and spleen, were devoid of detectable nuclear β-catenin expression (Fig. 1A, middle and right and data not shown).


Figure 1
View larger version (88K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. Nuclear localization of β-catenin in malignant lymphomas. A, left, colorectal cancer specimen of a FAP patient showing strong nuclear β-catenin expression in part of the tumor cells, as well as cytoplasmic and membrane staining (positive control). Middle, β-catenin expression was not detectable in T or B lymphocytes (normal lymph node). Follicular dendritic cells show positive (membrane) staining for β-catenin. Right, absence of (nuclear) β-catenin expression in precursor T cells (normal thymus). B, left, T-LBL/ALL showing membrane and nuclear expression of β-catenin. In this tumor, a S33Y mutation was found. Middle, pTL showing a strong nuclear accumulation of β-catenin. In this tumor a S33F mutation was found. Right, consecutive section of B (middle) stained for CD3. Original magnifications, x20 (A left) and x64 (A middle–B right).

 
Of the 162 NHLs studied, 110 were of B-lineage origin. Of these tumors, only three (3%) showed nuclear β-catenin expression (Table 1 ). One of these three tumors was a precursor-B lymphoblastic lymphoma. Notably, this tumor carried a t(1;19)(q23;p13), which results in expression of a E2A-Pbx1 fusion protein (32). This fusion protein was shown to cause WNT16 overexpression, resulting in constitutive WNT signaling (32, 33). Furthermore, 2 of the 54 diffuse large B-cell lymphomas (DLBCL; 4%) showed nuclear expression of β-catenin. Nuclear β-catenin staining in this clinically and biologically heterogeneous group of tumors was neither associated with the presence of a germinal center, activated B cell, or plasmablastic phenotype, nor with the presence of a preexisting immunodeficiency, i.e., infection with EBV and/or Kaposi sarcoma–associated herpes virus (KSHV; data not shown). Nuclear β-catenin was not detected in mantle cell lymphomas, Burkitt lymphomas, follicular lymphomas, chronic lymphocytic leukemia (CLL)/small lymphocytic lymphomas, and marginal zone lymphomas (MZL).


View this table:
[in this window]
[in a new window]

  		Table 1. Nuclear β-catenin expression in NHLs

 
Of the 52 T-lineage lymphomas studied, 13 (25%) showed nuclear expression of β-catenin (Table 1). Nuclear β-catenin was present in 9 of 27 (33%) precursor T-LBL/ALL (Fig. 1B, left). In addition, four pTL showed a distinct nuclear β-catenin expression (Fig. 1B, middle). Notably, three of these cases represented advanced cutaneous T-cell lymphoma (CTCL) localized to regional lymph nodes. The tumor cells at the (primary) cutaneous site in these patients did not show nuclear β-catenin expression (data not shown). The fourth pTL showing nuclear β-catenin expression represented a nodal pTL-unspecified. Nuclear β-catenin was not detected in anaplastic large cell lymphoma, angioimmunoblastic T-cell lymphoma, or natural killer (NK)/T-cell lymphoma (Table 1). Taken together, our observations indicate that aberrant activation of the canonical WNT pathway is present in a subset of the lymphomas within several distinct NHL subcategories and is relatively common (33%) in T-LBL/ALL.

Activation of WNT signaling in T-NHLs by gain-of-function mutations in CTNNB1 (β-catenin). Mutations in WNT pathway components, specifically in the genes encoding β-catenin (CTNNB1) or APC, often underlie the accumulation of β-catenin and aberrant activation of TCF-mediated transcription in cancer. To explore whether mutational activation of the WNT pathway also takes place in non–Hodgkin lymphomas, we studied the tumors with nuclear β-catenin expression for the presence of mutations in CTNNB1 or APC. This analysis identified four lymphomas containing a point mutation in the mutational hotspot region in exon 3 of CTNNB1 (Fig. 2A ). All four mutations were established gain-of-function mutations resulting in an amino acid substitution at a specific phosphorylation site (Fig. 2B) required for targeting β-catenin for ubiquitination and degradation. Three mutations were found in pTLs, i.e., two lymph nodes involved by CTCL and one nodal pTL-unspecified (S33F, S45F, T41N), whereas one mutation was found in a T-LBL/ALL (S33Y). PCR-SSCP and sequence analysis of the MCR of APC identified several known single-nucleotide polymorphisms but no loss-of-function APC mutations (data not shown). Our data identify gain-of-function mutation of CTNNB1 as one of the mechanisms of β-catenin deregulation in T-cell malignancies.


Figure 2
View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Missense mutations of β-catenin in T-cell lymphomas. A, mutational analysis of exon 3 of CTNNB1. Left, mutational transitions were visualized as aberrant migrating amplicons by SSCP analysis at either 5°C or 15°C (asterisks). Shown are the migration patterns of a nonmutated lymphoma (TALL21) and the four T-cell lymphomas carrying a mutational transition in CTNNB1 compared with a nonmutated control (tonsil). Right, sequence analysis of CTNNB1 confirmed the mutational transitions in T-cell lymphomas (asterisks). Shown are a nonmutated lymphoma (TALL21) and the four T-cell lymphomas carrying a mutation in the gene encoding β-catenin. B, schematic representation of the β-catenin protein with the mutated phosphorylation sites (S33F/Y, T41N and S45F) identified in T-cell lymphomas.

 
Nuclear β-catenin expression in T-LBL/ALL is not restricted to a specific stage of maturation arrest. T-cell maturation in the thymus proceeds through a number of developmental checkpoints, marked by distinct phenotypical changes. In the human, thymocytes are successively double negative (DN; CD4–CD8–), immature single positive (CD4+CD3–), double positive (DP; CD4+CD8+), and single positive (SP; CD3+CD4+ or CD3+CD8+). This maturation is tightly controlled by various signaling pathways, including the NOTCH, WNT, and HEDGHOG pathways (34, 35). To assess whether aberrant WNT signaling in T-LBL/ALL is associated with arrest at a specific developmental stage, the relation between nuclear β-catenin expression and T-LBL/ALL phenotype was studied. As shown in Fig. 3 , nuclear β-catenin expression was not restricted to a single stage of maturation arrest but was present in several DN, DP, and SP tumors (Fig. 3; Supplementary Table S1). However, the incidence was higher (5 of 10) in late-stage (SP) than in the early-stage (DN and DP) tumors (4 of 17).


Figure 3
View larger version (6K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Frequent nuclear accumulation of β-catenin in T-LBL/ALL. Nuclear localization of β-catenin in T-LBL/ALLs, subdivided by stage of maturation arrest as being DN (n = 7), DP (n = 10), or SP (n = 10). Although the accumulation of β-catenin was more often found in T-LBL/ALL derived from more mature (SP) T cells, it was not restricted to a single stage of maturation arrest.

 
Because aberrant activation of NOTCH signaling contributes to tumor development in a majority of patients with T-LBL/ALL (30), the presence of mutations in NOTCH1 was examined in a subset of T-LBL/ALL patients (Supplementary Table S2). In line with previous studies (30, 36), more than half of the T-LBL/ALL carried mutations in NOTCH1, dispersed over the heterodimerization and PEST domains. However, no correlation between the absence or presence of NOTCH1 mutations and nuclear β-catenin expression was observed (Supplementary Table S2).

Constitutive TCF-mediated gene transcription in T-LBL/ALL cells by autocrine WNT signaling. As shown above, nuclear accumulation of β-catenin is relatively common in T-LBL/ALL, suggesting activation of the canonical WNT signaling pathway. However, with the exception of a single tumor having a CTNNB1 mutation, the T-LBL/ALLs with nuclear β-catenin had no mutations in either CTNNB1 or APC. In these tumors, the WNT signaling pathway is presumably intact, and activation could be caused by autocrine stimulation. To explore this hypothesis, we used the T-LBL/ALL cell lines CEM, Molt4, and SupT1. Similar to the primary T-LBL/ALLs, CEM and Molt4 strongly express β-catenin, including the active nonphosphorylated form of the protein (Fig. 4A ). To monitor the TCF transcriptional activity in the T-LBL/ALL cell lines, we transfected a TCF-reporter (pTOPFLASH); as a control, we used a reporter containing scrambled TCF binding sites (pFOPFLASH). All three cell lines showed constitutive activation of the TCF-reporter (Fig. 4B). Transfection of a dominant-negative form of TCF4 (dnTCF4) to CEM, the cell line with the highest TOP/FOPFLASH ratio, caused a significant reduction of the basal TCF-mediated transcriptional activity (Fig. 4C), confirming the specificity of the detected reporter activity.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. Autocrine WNT signaling controls constitutive TCF-mediated gene transcription in T-LBL/ALL cells. A, β-catenin expression in T-LBL/ALL cell lines. To monitor the β-catenin protein levels, cells were lysed and immunoblotted using a monoclonal anti–β-catenin antibody (top) or an antibody recognizing non–phosphorylated β-catenin (middle). The bottom part of the blot was stained with anti–β-actin to verify equal loading (bottom). B, T-LBL/ALL cell lines have basal TCF-mediated transcription, as depicted by the TOPFLASH over FOPFLASH ratio. Cell lines were either transfected with the TOPFLASH reporter or the FOPFLASH reporter and assayed for luciferase activity. The mean TOP/FOPFLASH ratio of 10 independent experiments (±SE) is shown. C, dnTCF4 suppresses the constitutive TCF-mediated transcription in T-LBL/ALL, indicating constitutive TCF-mediated transcription. CEM was transfected with the TOPFLASH reporter or the FOPFLASH reporter, either alone or in combination with dnTCF4. The mean TOP/FOPFLASH ratio of three independent experiments (±SE) is shown. **, P < 0.01 by Student's t test. D, conditioned medium of T-LBL/ALL cells activates TCF-mediated transcription. Top left, LSL cells were either incubated with control medium (control), or with the conditioned medium harvested from 48 h cultured T-LBL/ALL cells. The mean fold induction of five independent experiments (±SE) is shown. *, P < 0.05 by Student's t test. Top right, T-LBL/ALL cell lines were either transfected with the TOPFLASH reporter or the FOPFLASH reporter. At 24 h after transfection, the cells were extensively washed and incubated for 24 h with control medium (white columns) or with conditioned medium harvested from 48 h cultured T-LBL/ALL cell lines (black columns). The TOPFLASH/FOPFLASH ratio of the target cells incubated with control medium was normalized to 1. The mean fold induction of three independent experiments (±SE) is shown. *, P < 0.05 by Student's t test. Bottom, DKK1 expression reduces TCF-mediated transcription in T-LBL/ALL. Cell lines were transfected with the TOPFLASH reporter or the FOPFLASH reporter alone or in combination with DKK1. The mean TOP/FOPFLASH ratio of three independent experiments (±SE) is shown. **, P < 0.01; ***, P < 0.001; ns, not significant, by Student's t test.

 
Because the T-LBL/ALL cell lines do not carry any CTNNB1 or APC mutations (data not shown), our results suggest the possible existence of an autocrine stimulatory loop. Therefore, we assessed the expression of WNTs and their receptors (FZD) by means of a WNT signaling pathway gene expression array. The cell lines, as well as a primary T-LBL/ALL, revealed predominant expression of the ligands WNT16 and WNT10A and the receptors FZD1 and FZD2 (Supplementary Table S3), thus allowing for autocrine activation. Accordingly, incubation of an established WNT reporter cell line (LSL; ref. 31), with conditioned media harvested from the T-LBL/ALL cell lines, resulted in enhanced TCF-mediated reporter activity (Fig. 4D). Moreover, applying the conditioned media to the corresponding T-LBL/ALL cell lines themselves, previously transfected with pTOPFLASH and deprived of any autocrine-produced ligands, resulted in enhanced reporter activity in CEM and Molt4 (Fig. 4D). Importantly, transfection of DKK1, a secreted antagonist that prevents WNT signaling by preventing binding of WNT ligands to WNT-signaling coreceptors LRP5/6, led to reduced TCF-reporter activity in both CEM and Molt4 (Fig. 4D). Notably, SupT1, which did not respond to either conditioned medium or DKK1 expression, showed lower expression of FZD1 (and WNT16; Supplementary Table S3). Taken together, these results show that the WNT signaling pathway is constitutively active in the T-LBL/ALL cell lines CEM and Molt4 and support the presence of an autocrine activation loop.

Stimulation of the WNT-signaling pathway promotes TCF-mediated gene transcription and growth of T-LBL/ALL cells. To further explore the integrity and functionality of the WNT signaling pathway in the T-LBL/ALL cells, we tested β-catenin levels and TCF transcriptional activity after applying a number of stimuli that activate the WNT signaling at different levels. Initially, we tested the effect of stimulation at the level of the receptor by purified Wnt3a (37). In Molt4 and SupT1, stimulation with Wnt3a resulted in a pronounced accumulation of β-catenin, including accumulation of non–phoshorylated β-catenin and a significant increase of the TCF-reporter activity (Fig. 5A ). By contrast, CEM hardly responded to Wnt3a (Fig. 5A); in these cells, receptor binding/stimulation may have already been saturated/optimal as a result of autocrine produced WNTs (see Fig. 4D).


Figure 5
View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. Stimulation of the WNT signaling pathway increases TCF-mediated gene transcription and growth of T-LBL/ALL cells. A, accumulation of β-catenin and enhanced TCF-mediated transcription in response to purified Wnt3a. Top, cells were incubated for 6 h in the presence or absence of purified Wnt3a (200 ng/mL). Cells were lysed and immunoblotted using a monoclonal anti–β-catenin antibody or an antibody recognizing non–phosphorylated β-catenin. The bottom part of the blot was stained with anti–β-actin to verify equal loading. Bottom, cells were transfected with either the TOPFLASH or the FOPFLASH reporter construct; 24 h after transfection, the cells were stimulated for 24 h with purified Wnt3a, as indicated (bottom). The mean TOP/FOPFLASH ratio of three independent experiments (±SE) is shown. **, P < 0.01; ***, P < 0.001; ns, not significant, by Student's t test. B, activation of the WNT signaling pathway by inhibition of GSK-3β results in accumulation and nuclear translocation of β-catenin, as well as enhanced TCF-mediated transcription. Top, cells were incubated for 24 h in the presence of 20 mmol/L LiCl or KCl as a control (left),or in the presence or absence of 5 µmol/L BIO (right), after which they were lysed and immunoblotted as described above. Bottom left, to visualize nuclear translocation of β-catenin, CEM was cultured in the presence of 5 µmol/L MeBIO as a control (left) or BIO (right) for 24 h. Nuclear localization was visualized by immunohistochemistry using a monoclonal anti–β-catenin antibody. Bottom right, enhanced basal TCF-mediated transcriptional activity in CEM in response to GSK-3β inhibition. CEM was transfected with the TOPFLASH reporter or the FOPFLASH reporter; 24 h after transfection, the cells were incubated for another 24 h in the presence of 5 µmol/L BIO or a control, MeBIO. The mean TOP/FOPFLASH ratio of three independent experiments (±SE) is shown. ***, P < 0.001 by Student's t test. C, activation of the WNT signaling pathway by a constitutive active mutant β-catenin (S33Y β-catenin) leads to enhanced TCF-mediated transcription and growth. Top, T-LBL/ALL cell lines were transfected with the TOPFLASH reporter or the FOPFLASH reporter, either alone or in combination with S33Y β-catenin. The mean TOP/FOPFLASH ratio of three independent experiments (±SE) is shown. **, P < 0.01; ***, P < 0.001, by Student's t test. Bottom, to monitor the effect of S33Y β-catenin on the growth of the T-LBL/ALL cell lines, cells were transfected with pEGFP in combination with either pcDNA3.1 ({blacksquare}) as a control or S33Y β-catenin ({blacktriangleup}). After overnight recovery, viable GFP-positive cells were FACS-sorted and cultured at a density of 5 x 104 cells/mL. Viability was measured after 2 and 4 d of culture. The mean of three independent experiments (±SE) of the three T-LBL/ALL cell lines CEM, Molt4, and SupT1 is shown. *, P < 0.05; **, P < 0.01; ***, P < 0.001, by Student's t test.

 
Stimulation of WNT signaling at the intracellular level, by lithium chloride (LiCl) or the pharmacologic inhibitor BIO, which both mimic WNT signaling by inhibition of GSK3β (38), resulted in additional β-catenin accumulation in all three ALL cell lines (Fig. 5B, top). GSK3β inhibition also affected β-catenin localization: before inhibitor treatment, low amounts of β-catenin were detected in the cytoplasm of the T-LBL/ALL cells; after treatment, an increase in the total amount of β-catenin and its nuclear translocation was observed (Fig. 5B and data not shown). This was accompanied by a strongly increased TCF-reporter activity in all three cell lines (Fig. 5B and data not shown).

Finally, we also studied the effect of transfection of the β-catenin mutant S33Y, which was found in one of the primary T-LBL/ALLs described in this study (Fig. 2). Notably, this is an established gain-of-function mutation, also found in e.g., colorectal cancer, resulting in β-catenin stabilization. Interestingly, apart from strongly enhancing TCF-mediated transcription (Fig. 5C, top), transfection of this β-catenin mutant markedly enhanced the growth of all three ALL cell lines (Fig. 5C, bottom). Taken together, our observations indicate that the canonical WNT pathway in T-LBL/ALL is constitutively activated, but still sensitive to regulation, and induces the growth of T-LBL/ALL cells.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosure of Potential...
 References
 
In the present study, we have explored the role of the WNT signaling pathway in NHLs and show that a significant subset of T-cell lymphomas and some B-cell lymphomas display evidence of active WNT signaling. This aberrant WNT pathway activation was caused by CTNNB1 mutations or, in lymphomas with mutations in neither CTNNB1 nor APC, by the presence of an autocrine activation loop. Functional studies indicate that the WNT signaling pathway may promote lymphoma growth. Our findings imply that the WNT pathway, which is essential for early T-cell and B-cell development (4, 22) and plays a role in the self-renewal of hematopoietic stem cells, is aberrantly activated in a substantial subgroup of NHLs and contributes to lymphomagenesis.

Regulation of β-catenin levels plays a central role in WNT signaling. Our immunohistochemical screening of a large panel of NHLs revealed that a substantial subset of T-cell lymphomas (25%) and occasional B-cell lymphomas (3%) showed nuclear accumulation of β-catenin, a hallmark of active canonical WNT signaling (Table 1; Fig. 1). Compared with the undetectable β-catenin expression in the lymphocytes in tissue sections of normal lymphoid organs, β-catenin was vastly overexpressed in these tumors, implying aberrant WNT signaling activation. Indeed, mutational analysis of CTNNB1 and APC revealed that several of the lymphomas identified by our screening contained missense mutations in CTNNB1 (Fig. 2). In contrast to the mutations of unknown functional significance previously reported in NK/T-cell lymphomas (39, 40), all the current mutations represented established gain-of-function mutations, involving phosphorylation sites important for ubiquitination and degradation of β-catenin, and have previously been reported in hepatocellular, prostate, and colorectal cancer (8). In addition, a B-LBL/ALL with nuclear β-catenin accumulation was found to contain a t(1;19)(q23:p13) translocation with consequent expression of a E2A-Pbx1 fusion protein. This fusion protein causes WNT16 overexpression and constitutive autocrine WNT signaling (32, 33). These observations clearly illustrate the power of our screening protocol to identify NHL with deregulated WNT signaling.

Of the 110 primary B-cell NHLs studied, only three showed nuclear β-catenin expression. Apart from the B-LBL/ALL with the t(1;19)(q23:p13), two DLBCLs were β-catenin–positive. Neither of these tumors showed evidence of infection with KSHV or EBV, viruses that have been suggested to induce WNT pathway activation in B lymphocytes (41, 42). Vice versa, DLBCLs with a proven infection by these {gamma}-herpes viruses (43), did not show nuclear β-catenin accumulation (data not shown). Recent studies have suggested a role for uncontrolled WNT signaling in the pathogenesis of B-LBL/ALL and B-CLL (32, 44, 45), involving either epigenetic silencing of WNT inhibitors (46) or deregulated expression of WNTs and/or other WNT pathway components. However, in line with our current findings (Table 1), these studies did not reveal constitutive nuclear β-catenin expression in B-CLL (44) and in the large majority of LBL/ALLs (45). Although we cannot formally exclude the possibility that low levels of nuclear β-catenin, sufficient to support TCF-mediated transcription, escape detection by our method, we conclude that the currently available data do not support a major role for the WNT pathway in these lymphoid malignancies.

Of the 52 T-cell lymphomas studied, 13 (25%) showed marked nuclear β-catenin expression (Table 1; Fig. 1). These included precursor T-LBL/ALLs, as well as mature T-lineage lymphomas. Among these tumors, one T-LBL/ALL and three pTLs showed classic gain-of-function mutations in CTNNB1, a finding that constitutes "proof of principle" for the oncogenic potential of the WNT pathway in both precursor and mature T cells. Two of the pTLs with CTNNB1 mutations were lymph nodes involved by CTCL. In the primary cutaneous tumors of these patients, neither a CTNNB1 mutation nor β-catenin expression was detected, implying that the WNT pathway activation in these lymphomas was acquired during tumor progression. Notably, nuclear β-catenin expression was most prevalent in lymphomas of the precursor T-LBL/ALLs subgroup (33%). This expression was not restricted to tumors showing an early maturation arrest and, hence, does not reflect the WNT signaling activity present during early thymocyte development (47). By contrast, nuclear β-catenin expression seems to be more common in T-LBL/ALLs with a relatively mature (single positive) phenotype, implying aberrant WNT pathway activation (Fig. 3; Supplementary Table S1). In addition, no correlation was found between WNT pathway activation and the absence or presence of mutations in NOTCH1, a gene mutated in the majority of T-LBL/ALLs (30).

In agreement with our current findings in human T-LBL/ALL, it was recently shown that stabilization of β-catenin in mouse thymocytes is oncogenic and results in malignant T-cell lymphomas (27). Except in one of the T-LBL/ALLs, this activation was not caused by mutations in either CTNNB1 or APC, suggesting that the WNT pathway is intact and might be activated in situ by autocrine or paracrine WNTs. Consistent with this hypothesis, WNTs have been reported to be expressed by thymocytes, as well as by thymic epithelial cells (47, 48), and several studies have shown overexpression of WNTs by ALL cells (32, 33, 45). Our studies in T-LBL/ALL cell lines strongly support this autocrine activation scenario: they show that these cells contain active β-catenin and display constitutive TCF-mediated transcriptional activity (Fig. 4B), which is inhibited by DKK1, an extracellular WNT-signaling antagonist that blocks WNT-induced receptor activation by binding to the coreceptor LRP5/6 (Fig. 4D). In line with this observation, we found expression of several WNT and FZD genes in these cells (Supplementary Table S3) and showed that the conditioned media have WNT signaling inducing capacity (Fig. 4D). Notably, WNT16, which has been found to be overexpressed in B-LBL/ALL carrying a t(1;19)(q23:p13) translocation (32, 33), was among the two most-prominently expressed WNTs identified (Supplementary Table S3). Furthermore, our results show that the WNT pathway in T-LBL/ALL cells, although constitutively active, can still be regulated by exogenous stimuli like LiCl, BIO, Wnt3a, conditioned media, by the WNT signaling inhibitor DKK1, or by an active β-catenin mutant (S33Y). These regulatory stimuli that act at distinct levels, including at the receptor level, imply that the pathway is basically intact (Figs. 4 and 5A and B). Our observation that the activating β-catenin mutation (S33Y), which we identified in one of our primary T-LBL/ALLs, enhances the growth of all three T-LBL/ALL cell lines tested (Fig. 5C), suggest that aberrant WNT pathway activation may indeed contribute to tumor growth in human precursor T-LBL/ALLs.

In conclusion, our data indicate that WNT signaling, which normally controls lymphocyte progenitor fate, as well as the self-renewal of hematopoietic stem cells, is illegitimately activated in a distinct subset of NHL, particularly in precursor T-cell lymphomas, and contributes to the pathogenesis of these tumors. Targeting WNT signaling components with recently developed small molecule drugs may prove a successful novel means of therapeutic intervention in lymphoma patients displaying active WNT signaling.


   Disclosure of Potential Conflicts of Interest
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
References
 
No potential conflicts of interest were disclosed.


   Acknowledgments
 
Grant support: Dutch Cancer Society (M. Spaargaren and S.T. Pals).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. J.J. Oudejans for kindly providing us with primary patient material, Dr. C.H.M. Mellink for the cytogenetic data of the T-LBL/ALL patients, H.P. Meijer and B. Hooibrink for technical assistance, and Dr. E.J.W. Redeker for helping us with the PCR-SSCP.


   Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 4/ 9/08. Revised 6/ 5/08. Accepted 7/ 7/08.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Evans LS, Hancock BW. Non-Hodgkin lymphoma. Lancet 2003;362:139–46.[CrossRef][Medline]
  2. Kuppers R. Mechanisms of B-cell lymphoma pathogenesis. Nat Rev Cancer 2005;5:251–62.[CrossRef][Medline]
  3. Rizvi MA, Evens AM, Tallman MS, Nelson BP, Rosen ST. T-cell non-Hodgkin lymphoma. Blood 2006;107:1255–64.[Abstract/Free Full Text]
  4. Verbeek S, Izon D, Hofhuis F, et al. An HMG-box-containing T-cell factor required for thymocyte differentiation. Nature 1995;374:70–4.[CrossRef][Medline]
  5. Reya T, O'Riordan M, Okamura R, et al. Wnt signaling regulates B lymphocyte proliferation through a LEF-1 dependent mechanism. Immunity 2000;13:15–24.[CrossRef][Medline]
  6. Reya T, Duncan AW, Ailles L, et al. A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature 2003;423:409–14.[CrossRef][Medline]
  7. Nusse R, Varmus HE. Wnt genes. Cell 1992;69:1073–87.[CrossRef][Medline]
  8. Polakis P. Wnt signaling and cancer. Genes Dev 2000;14:1837–51.[Free Full Text]
  9. Wodarz A, Nusse R. Mechanisms of Wnt signaling in development. Annu Rev Cell Dev Biol 1998;14:59–88.[CrossRef][Medline]
  10. Moon RT, Bowerman B, Boutros M, Perrimon N. The promise and perils of Wnt signaling through β-catenin. Science 2002;296:1644–6.[Abstract/Free Full Text]
  11. Molenaar M, van de WM, Oosterwegel M, et al. XTcf-3 transcription factor mediates β-catenin-induced axis formation in Xenopus embryos. Cell 1996;86:391–9.[CrossRef][Medline]
  12. Behrens J, von Kries JP, Kuhl M, et al. Functional interaction of β-catenin with the transcription factor LEF-1. Nature 1996;382:638–42.[CrossRef][Medline]
  13. Tetsu O, McCormick F. β-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 1999;398:422–6.[CrossRef][Medline]
  14. He TC, Sparks AB, Rago C, et al. Identification of c-MYC as a target of the APC pathway. Science 1998;281:1509–12.[Abstract/Free Full Text]
  15. van de Wetering M, Sancho E, Verweij C, et al. The β-catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell 2002;111:241–50.[CrossRef][Medline]
  16. Bienz M, Clevers H. Linking colorectal cancer to Wnt signaling. Cell 2000;103:311–20.[CrossRef][Medline]
  17. Kinzler KW, Vogelstein B. Lessons from hereditary colorectal cancer. Cell 1996;87:159–70.[CrossRef][Medline]
  18. Wielenga VJ, Smits R, Korinek V, et al. Expression of CD44 in Apc and Tcf mutant mice implies regulation by the WNT pathway. Am J Pathol 1999;154:515–23.[Abstract/Free Full Text]
  19. Boon EMJ, van der Neut R, van de Wetering M, Clevers H, Pals ST. Wnt signaling regulates expression of the receptor tyrosine kinase Met in colorectal cancer. Cancer Res 2002;62:5126–8.[Abstract/Free Full Text]
  20. Travis A, Amsterdam A, Belanger C, Grosschedl R. LEF-1, a gene encoding a lymphoid-specific protein with an HMG domain, regulates T-cell receptor {alpha} enhancer function [corrected]. Genes Dev 1991;5:880–94.[Abstract/Free Full Text]
  21. van de Wetering M, Oosterwegel M, Dooijes D, Clevers H. Identification and cloning of TCF-1, a T lymphocyte-specific transcription factor containing a sequence-specific HMG box. EMBO J 1991;10:123–32.[Medline]
  22. Schilham MW, Wilson A, Moerer P, et al. Critical involvement of Tcf-1 in expansion of thymocytes. J Immunol 1998;161:3984–91.[Abstract/Free Full Text]
  23. Gounari F, Aifantis I, Khazaie K, et al. Somatic activation of β-catenin bypasses pre-TCR signaling and TCR selection in thymocyte development. Nat Immunol 2001;2:863–9.[CrossRef][Medline]
  24. Ioannidis V, Beermann F, Clevers H, Held W. The β-catenin-TCF-1 pathway ensures CD4(+)CD8(+) thymocyte survival. Nat Immunol 2001;2:691–7.[CrossRef][Medline]
  25. Kirstetter P, Anderson K, Porse BT, Jacobsen SE, Nerlov C. Activation of the canonical Wnt pathway leads to loss of hematopoietic stem cell repopulation and multilineage differentiation block. Nat Immunol 2006;7:1048–56.[CrossRef][Medline]
  26. Scheller M, Huelsken J, Rosenbauer F, et al. Hematopoietic stem cell and multilineage defects generated by constitutive β-catenin activation. Nat Immunol 2006;7:1037–47.[CrossRef][Medline]
  27. Guo Z, Dose M, Kovalovsky D, et al. β-catenin stabilization stalls the transition from double-positive to single-positive stage and predisposes thymocytes to malignant transformation. Blood 2007;109:5463–72.[Abstract/Free Full Text]
  28. Derksen PWB, Tjin E, Meijer HP, et al. Illegitimate WNT signaling promotes proliferation of multiple myeloma cells. Proc Natl Acad Sci U S A 2004;101:6122–7.[Abstract/Free Full Text]
  29. Batlle E, Henderson JT, Beghtel H, et al. β-catenin and TCF mediate cell positioning in the intestinal epithelium by controlling the expression of EphB/ephrinB. Cell 2002;111:251–63.[CrossRef][Medline]
  30. Weng AP, Ferrando AA, Lee W, et al. Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 2004;306:269–71.[Abstract/Free Full Text]
  31. Blitzer JT, Nusse R. A critical role for endocytosis in Wnt signaling. BMC Cell Biol 2006;7:28.[CrossRef][Medline]
  32. McWhirter JR, Neuteboom ST, Wancewicz EV, et al. Oncogenic homeodomain transcription factor E2A-Pbx1 activates a novel WNT gene in pre-B acute lymphoblastoid leukemia. Proc Natl Acad Sci U S A 1999;96:11464–9.[Abstract/Free Full Text]
  33. Mazieres J, You L, He B, et al. Inhibition of Wnt16 in human acute lymphoblastoid leukemia cells containing the t(1;19) translocation induces apoptosis. Oncogene 2005;24:5396–400.[CrossRef][Medline]
  34. Staal FJ, Clevers HC. Wnt signaling in the thymus. Curr Opin Immunol 2003;15:204–8.[CrossRef][Medline]
  35. Weerkamp F, van Dongen JJ, Staal FJ. Notch and Wnt signaling in T-lymphocyte development and acute lymphoblastic leukemia. Leukemia 2006;20:1197–205.[CrossRef][Medline]
  36. Mansour MR, Linch DC, Foroni L, Goldstone AH, Gale RE. High incidence of Notch-1 mutations in adult patients with T-cell acute lymphoblastic leukemia. Leukemia 2006;20:537–9.[CrossRef][Medline]
  37. Willert K, Brown JD, Danenberg E, et al. Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature 2003;423:448–52.[CrossRef][Medline]
  38. Meijer L, Skaltsounis AL, Magiatis P, et al. GSK-3-selective inhibitors derived from Tyrian purple indirubins. Chem Biol 2003;10:1255–66.[CrossRef][Medline]
  39. Hoshida Y, Hongyo T, Jia X, et al. Analysis of p53, K-ras, c-kit, and β-catenin gene mutations in sinonasal NK/T cell lymphoma in northeast district of China. Cancer Sci 2003;94:297–301.[CrossRef][Medline]
  40. Takahara M, Kishibe K, Bandoh N, Nonaka S, Harabuchi Y. P53, N- and K-Ras, and β-catenin gene mutations and prognostic factors in nasal NK/T-cell lymphoma from Hokkaido, Japan. Hum Pathol 2004;35:86–95.[CrossRef][Medline]
  41. Fujimuro M, Hayward SD. The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus manipulates the activity of glycogen synthase kinase-3β. J Virol 2003;77:8019–30.[Abstract/Free Full Text]
  42. Morrison JA, Klingelhutz AJ, Raab-Traub N. Epstein-Barr virus latent membrane protein 2A activates β-catenin signaling in epithelial cells. J Virol 2003;77:12276–84.[Abstract/Free Full Text]
  43. Deloose ST, Smit LA, Pals FT, et al. High incidence of Kaposi sarcoma-associated herpesvirus infection in HIV-related solid immunoblastic/plasmablastic diffuse large B-cell lymphoma. Leukemia 2005;19:851–5.[CrossRef][Medline]
  44. Lu D, Zhao Y, Tawatao R, et al. Activation of the Wnt signaling pathway in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 2004;101:3118–23.[Abstract/Free Full Text]
  45. Khan NI, Bradstock KF, Bendall LJ. Activation of Wnt/β-catenin pathway mediates growth and survival in B-cell progenitor acute lymphoblastic leukaemia. Br J Haematol 2007;138:338–48.[CrossRef][Medline]
  46. Roman-Gomez J, Cordeu L, Agirre X, et al. Epigenetic regulation of Wnt-signaling pathway in acute lymphoblastic leukemia. Blood 2007;109:3462–9.[Abstract/Free Full Text]
  47. Weerkamp F, Baert MR, Naber BA, et al. Wnt signaling in the thymus is regulated by differential expression of intracellular signaling molecules. Proc Natl Acad Sci U S A 2006;103:3322–6.[Abstract/Free Full Text]
  48. Pongracz J, Hare K, Harman B, Anderson G, Jenkinson EJ. Thymic epithelial cells provide WNT signals to developing thymocytes. Eur J Immunol 2003;33:1949–56.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Am Soc Clin Oncol Ed BookHome page
L. Miele, N. Takebe, and S. P. Ivy
The Cancer Stem Cell Hypothesis, Embryonic Signaling Pathways, and Therapeutics: Targeting an Elusive Concept
ASCO Educational Book, January 1, 2009; 2009(1): 145 - 156.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Groen, R. W.J.
Right arrow Articles by Pals, S. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Groen, R. W.J.
Right arrow Articles by Pals, S. T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online