Cancer Research Cancer Research Funding Available  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 68, 7066, September 1, 2008. doi: 10.1158/0008-5472.CAN-08-0922
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Squarize, C. H.
Right arrow Articles by Gutkind, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Squarize, C. H.
Right arrow Articles by Gutkind, J. S.
Related Collections
Right arrow Oncogenesis
Right arrow Oncogenesis: Animal Models
Right arrow Preclinical Intervention: In Vivo (Animals): Drugs, Nutritional Interventions, Mechanisms

Experimental Therapeutics, Molecular Targets, and Chemical Biology

Chemoprevention and Treatment of Experimental Cowden's Disease by mTOR Inhibition with Rapamycin

Cristiane H. Squarize, Rogerio M. Castilho and J. Silvio Gutkind

Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, NIH, Bethesda, Maryland

Requests for reprints: J. Silvio Gutkind, Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, NIH, 30 Convent Drive, Room 211 Bethesda, MD 20892. Phone: 301-496-3695; Fax: 301-402-0823; E-mail: gutkind{at}dir.nidcr.nih.gov.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Cowden's disease is an autosomal dominant disorder characterized by the development of multiple mucocutaneous lesions and benign tumors, and enhanced cancer predisposition. Most Cowden's disease patients harbor inactivating mutations in the PTEN tumor suppressor gene which encodes a lipid phosphatase, PTEN, which restrains the phosphatidylinositol 3-kinase–Akt signaling pathway. We observed that the epithelial-specific deletion of Pten in mice causes multiple hyperproliferative and tumor lesions that strikingly resemble Cowden's disease. This animal model system provided an opportunity to explore novel therapeutic approaches in Cowden's disease. Indeed, we show here that rapamycin administration, which inhibits a key downstream target of Akt, mammalian target of rapamycin (mTOR), promotes the rapid regression of advanced mucocutaneous lesions. Furthermore, when administered before disease manifestation, rapamycin can halt the development of Cowden's disease–like lesions, thereby prolonging animal survival. These findings suggest that mTOR inhibition with rapamycin may represent a suitable therapeutic option for the chemoprevention and treatment of Cowden disease patients and others tumor syndromes that involve defective PTEN function. [Cancer Res 2008;68(17):7066–72]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Cowden's disease is an autosomal dominant disorder characterized by the development of multiple mucocutaneous lesions and benign tumors, and by the predisposition to a variety of malignancies, particularly breast and thyroid cancers (14). The Cowden's disease gene locus has been mapped to the chromosome 10q22-23 in which the PTEN gene is located (58). PTEN encodes a lipid phosphatase, PTEN, which is a negative regulator of the phosphatidylinositol 3-kinase (PI3K) pathway by converting phosphatidylinositol 3,4,5-triphosphate (PIP3) into phosphatidylinositol 4,5-biphosphate (PIP2; refs. 911). Underscoring the importance of PTEN as a tumor suppressor gene, germline mutations of PTEN have been linked to several autosomal dominant hamartoma syndromes including Cowden's disease (Omim:308350), Bannayan-Riley-Ruvalcaba syndrome (OMIM:153480), and Lhermitte-Duclos syndrome (OMIM:158350), which are all characterized by the presence of benign tumors, known as hamartomas, in multiple organs and an increased susceptibility to developing a variety of malignancies (reviewed in ref. 12).

In the case of Cowden's disease, PTEN germline mutations are found in 80% of the patients, either in the PTEN coding sequence, in the PTEN promoter, or in its 5' and 3' untranslated region resulting in inhibition of translation or a catalytically inactive, immature, or unstable PTEN protein, which may undergo rapid degradation (10, 12). Pten heterozygosity and tissue-specific deletion in mice leads to hyperplastic and dysplasic changes in the prostate, colon, and skin, and to spontaneous tumor development, supporting the notion that PTEN plays a causal role in hamartoma syndromes (1319). Cells exhibiting decreased PTEN activity are not able to restrain the growth promoting properties of PI3K and its lipid product, PIP3 (10, 11, 20). One of the best studied downstream targets of PI3K is the serine-threonine kinase Akt, which, upon activation by PIP3, promotes cell proliferation and survival by phosphorylating multiple protein targets, thereby controlling cell growth, protein translation, cell metabolism, and program cell death (21, 22).

As Cowden's disease is characterized by the high incidence epithelial derived tumors, we selectively inactivated a floxed Pten allele in mice by the expression of Cre recombinase under the control of the keratin 14 (K14) promoter, which is expressed in hair follicles, glandular ducts, epidermis, and other epithelial cells (23, 24). Although mice developed normally, and newborn mice did not exhibit any obvious phenotype, Pten deletion in epithelial cells led to the development of multiple dermal lesions and breast and thyroid tumors as age progressed, strikingly resembling Cowden's disease. This animal model provided an opportunity to explore the efficacy of interfering with the PI3K/Akt pathway as a therapeutic approach in this hamartoma syndrome. Indeed, we show here that the pharmacologic inhibition of one particular downstream target of Akt, mammalian target of rapamycin (mTOR), by the prolonged treatment with rapamycin promoted the rapid regression of advanced Cowden's disease–like lesions. Furthermore, we found that by initiating the chronic administration of rapamycin before the appearance of disease manifestation in mice, in which Pten has been conditionally deleted, was sufficient to prevent the development of Cowden's disease–like lesions, thereby prolonging remarkably animal survival. Thus, these findings suggest that the blockade of mTOR with rapamycin and its analogues may represent a suitable therapeutic option for the chemoprevention and treatment of Cowden disease's patients.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Experimental mice. All animal studies were carried out according to NIH approved protocols, in compliance with the Guide for the Care and Use of Laboratory Animals. PtenF/F mice (The Jackson Laboratory; ref. 25) were crossed with K14Cre mice (24) to generate K14Cre PtenF/+ heterozygous mice, which were further crossed with PtenF/F mice to generate K14Cre PtenF/F (homozygous), K14Cre PtenF/+, PtenF/F, and PtenF/+ mice, all in the same litter. The mice had free access to water and pellet stock diet, with the addition of high-fat supplement, when needed. Genotyping was performed on tail biopsies using a PCR assay with primers P1 (5' actcaaggcagggatgagc 3') and P2 (5' gccccgatgcaataaatatg 3') for PtenloxP/loxP, and primers P3 (5' cacgatacacctgactagctgggtg 3') and P4 (5' catcacccacaggctagcgccaact 3') for K14-Cre.

Rapamycin administration. Rapamycin (LC Laboratories) was reconstituted in absolute ethanol at 10 mg mL–1 and stored at –20°C. Rapamycin was diluted in 5.2% Tween 80 (Sigma) and 5.2% polyethyleneglycol (PEG-400; Hampton Research; ref. 26), and injected i.p., 1 mg/kg every other day.

Culture of primary keratinocytes and Western blotting. Murine keratinocytes were isolated as described (23), grown in KBM-2 medium (Cambrex). After lyses, protein concentrations were determined and 30 g of proteins were separated on 10% SDS-PAGE, transferred to nitrocellulose membranes, blocked with 5% milk protein, and incubated with primary antibodies Akt, phospho-specific Akt (pAktSer473 and pAktThr308), and S6 (pS6; Cell Signaling Technology), PTEN (Cascade Bioscience), and tubulin (Santa Cruz Biotechnology), as previously described (27). Western blot signals were quantitated by using the NIH Image J software.1

Histology and immunohistochemistry of tissue sections. H&E staining was performed on formalin-fixed and paraffin-embedded 4-m serial sections according to standard procedures. Immunohistochemistry was performed on these paraffin-embedded and frozen tissue sections using antibodies pAktSer473, pAktThr308, pS6 (Cell Signaling Technology), and proliferating cell nuclear antigen (PCNA; Zymed Laboratories) as described previously (26, 28). Quantitative analysis of the staining intensity was performed by using the NIH Image J software. Procedure periodic acid-Schiff (PAS) staining (Sigma-Aldrich) was performed as described by the manufacturer.

Statistical analysis. Comparison of the Kaplan-Meier survival analysis was performed with the logrank test. Statistical analysis of the staining for PCNA, pAktSer473, pAktThr308, pS6, and the body weight was performed by ANOVA One-way, followed by the Bonferroni's multiple comparison tests using GraphPad Prism 4.03 (GraphPad Software).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Excision of Pten recapitulates features of Cowden's disease. We generated epithelial-specific Pten conditional knockout mice by crossing mice harboring a floxed Pten allele containing two loxP sites (PtenF/F) with mice expressing the Cre recombinase under the control of the K14 promoter (K14Cre). K14Cre PtenF/+ heterozygous mice were backcrossed with PtenF/F mice, and littermates that inherited some but not all of the above alleles served as controls. K14Cre PtenF/F mice were undistinguishable from the littermates at birth. However, at ages 6 days, the skin was wrinkled and flaky when compared with heterozygous K14Cre PtenF/+ and control mice, and by ages 11 days, the hair shafts had a disheveled appearance (data not shown). The animals progressively developed multiple hyperproliferative lesions, ranging from mucocutaneous lesions (95%; 41 of 44 mice) to tumor formation (Fig. 1A ; Table 1 ). In particular, multiple papules rapidly developed around the facial orifices such as nose, mouth, and eyes (Fig. 1A, top). Punctuate palmoplantar keratoses, acral keratosis, especially in the limbs and periauricular, and oral papules were also frequently observed (Fig. 1A, bottom). Histologically, most facial and periauricular lesions had a follicular component with hyperproliferation of the outer root sheath, also evident in the vibrissae (Supplementary Fig. S1A; ear and vibrissae). Papillomatous lesions of the skin presented hyperkeratosis and acanthosis throughout the face and body skin (Supplementary Fig. S1A; skin and head). Acral extremities areas displayed verrucous and hyperkeratotic lesions also seen in the punctuate palmoplantar keratosis of the paws (Supplementary Fig. S1A; paw).


Figure 1
View larger version (47K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Widespread mucocutaneous lesions and early lethality caused by the conditional deletion of Pten in epithelial cells. A, representative examples of Pten conditional knockout mice, K14Cre PtenF/F, and littermate controls as indicated. Multiple facial papules extensively involving the eyes and nose (top). Punctuate palmoplantar keratoses of the paws (middle). Facial papules around the mouth, acral keratosis in the limbs, and oral papilloma of the buccal mucosa (bottom). B, survival curves for K14Cre PtenF/F (n = 71), K14Cre PtenF/+ (n = 22), and controls (n = 56; Kaplan-Meier survival analysis, P < 0.0001).

 

View this table:
[in this window]
[in a new window]

 
Table 1. Manifestations of Cowden's syndrome

 
Deletion of Pten compromises animal survival. Initially, the offspring from mating K14Cre PtenF/+ mice with PtenF/F mice followed the expected Mendelian distribution (Supplementary Fig. S2A). Although rapid death was initially observed in K14Cre PtenF/F mice in the first few days of life (Fig. 1B; Supplementary Fig. S2A), their survival was much greater than observed when using Cre driven by the K5 promoter (14). Although K14- and K5-driven gene expression are expected to have somehow overlapping tissue specificity (29), K14Cre PtenF/F mice did not develop esophageal hyperplasia, which could compromise the survival of K5Cre mice. In addition, we were able to achieve an increase in animal survival of K14Cre PtenF/F mice by removing littermate competition and extending the weaning period (Supplementary Fig. S2A). Under these optimized breeding conditions, most animals survived until weaning, and 40% of the mice survived beyond ages 3 months, although the life span of K14Cre PtenF/F mice did not exceed 250 days (Fig. 1B; Supplementary Fig. S2A). Decreased survival was also present in heterozygous K14Cre PtenF/+ mice, which died or had to be sacrificed because of morbidity (Fig. 1B). Nonetheless, the ability to extend the survival of K14Cre PtenF/F mice for up to ages 9 months enabled us to explore in detail the nature of the pathologic conditions caused by Pten deletion in the epithelial compartment of mice.

Hyperproliferative and tumoral lesions in K14Cre PtenF/F mice. As described above, several cutaneous lesions could be readily observed during examination of K14Cre PtenF/F mice. They include the unique presence of trichilemmomas, a pathognomonic sign of Cowden's Disease (2) that resembles blown-up hair follicles, which often exhibit cylindrical or lobular proliferation and PAS-positive proliferating glycogen-rich clear cells (Fig. 2A, top ). Besides numerous skin alterations, Cowden's disease is characterized by thyroid multinodular goiter, adenomas, and increased risk for thyroid cancer (4, 8). Indeed, homozygous deletion of Pten resulted in alterations in the thyroid gland of K14Cre PtenF/F mice (n = 16), including multinodular goiters (56%; 9 of 16 mice analyzed) and thyroid tumors (12%; 2 of 16 mice analyzed) with a follicular aspect (Fig. 2A, bottom; Table 1). Patients harboring PTEN deletions and mutations also often develop fibroadenomas, fibrocystic disease, virginal hypertrophy of the breast, and malformations of nipples and areolae (3, 4, 30). This was reflected in K14Cre PtenF/F mice, 80% (29 of 36 mice analyzed) of which displayed morphologic alterations in the nipples. Multiple mammary gland tumors were also observed in the thoracic and abdominal/inguinal mammary glands of K14Cre PtenF/F mice (11%; 4 of 36 mice analyzed; Fig. 2B; Table 1). This was even more remarkable in K14Cre PtenF/+ mice (36%; 8 of 22 mice analyzed), as their extended survival enabled the development of larger tumoral lesions. In both cases, lesions were characterized by the presence of prominent intraluminal and ductal proliferation (Fig. 2B, b). Histologic features of breast tumors ranged from fibroadenomas (Fig. 2B, c) to adenocarcinomas and ductal carcinomas with dense hyaline collagen or dense fibrosis replacing the intralobular stroma (Fig. 2B, e and f).


Figure 2
View larger version (115K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Epithelial excision of Pten leads to tumor formation. Examples of H&E histologic sections from control and conditional epithelial Pten deletion as indicated. A, typical hair follicle (a) and hair follicle tumor formation displaying trichilemmomas of cylindrical type (b and c, black arrow) resembling typical blown-up hair and exhibiting the presence of glycogen-rich clear cells positive for PAS (c, white arrow). Normal thyroid (d) and goiter displaying widespread follicular enlargement homogenously filled with colloid (e) and tumor formation with focal hyperplasia, hypercellularity with solid or microfollicular pattern, and little or no colloid among follicles (f). B, normal breast tissue from adult mice showing dispersed mammary ducts among adipose tissue (a, d). Note the intraluminal proliferation in the mammary duct of K14Cre PtenF/F mice (b) and the proliferation of epithelial cells forming cystic dilated duct-like spaces surrounded by a well-demarked capsule (c). Mammary tumors in Pten-deleted mice also displayed a thickened basal lamina surrounding the compressed and distorted ducts among the densely hyaline collagen (e). In other cases, dense fibrosis diffusely replaces the interlobular stroma (f).

 
Reversion of Cowden's disease–like lesions by mTOR inhibition. Activation of Akt involves its recruitment to the membrane by binding PIP3 and the initial phosphorylation of threonine 308 (Thr308) in its activation loop by PDK1 (22, 31). Subsequently, Akt is phosphorylated in serine 473 (Ser473) by one of its downstream targets, the atypical kinase mTOR, thereby increasing its activity (31). mTOR in turn regulates protein translation by phosphorylating 4EBP, an inhibitor of the translational initiation protein eIF4E, and p70S6K, which phosphorylates the S6 ribosomal protein (32, 33). Recent studies have indicated that the activation of the PI3K-Akt-mTOR signaling axis represents a key proliferative pathway shared by multiple solid tumors (21, 22, 34, 35). Thus, we took advantage of the ability to block mTOR function in vivo by the use of its specific inhibitor, rapamycin (36), to explore the contribution of mTOR activity to the development of Cowden's disease–like lesions in K14Cre PtenF/F mice. As shown in Fig. 3A , the treatment of symptomatic K14Cre PtenF/F adult mice (n = 4) for only 9 days with a clinical relevant dose of rapamycin (1 mg/kg; every other day; ref. 37) caused the regression of well-established mucocutaneous lesions, which was readily visible in the face and paws.


Figure 3
View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Rapamycin treatment reverses Cowden's disease–like lesions and modulates mTOR pathway in K14Cre PtenF/F–derived tumors. A, representative examples of rapamycin-treated mice (n = 4) within 9 d of treatment. Rapamycin profoundly decreases well-established mucocutaneous lesions in the face (top) and paws (bottom) of the same K14Cre PtenF/F mouse. B, representative example of immunohistochemical staining for pAktThr308, pAktSer473, pS6, and PCNA in the epithelium from control and K14Cre PtenF/F mice treated with vehicle or rapamycin. Note the elevated phosphorylation of pS6 and Akt in Ser473, and PCNA in K14Cre PtenF/F mice. Upon treatment, pS6, pAktSer473 levels, and PCNA nuclear staining were notably reduced. pAktThr308, which is present in the nucleus of epithelial cells in K14Cre PtenF/F mice, shifted to the membrane in rapamycin-treated mice. C, representative Western blot analysis of primary culture from mice for molecules whose activity is regulated by PTEN and tubulin, as a loading control, in lysates from primary cultures of keratinocytes isolated from control (c), K14Cre PtenF/+ (f/+), and K14Cre PtenF/F (f/f) mice (n = 3 independent experiment per genotype). Cells were treated with vehicle or rapamycin, as indicated. PTEN levels were reduced in K14Cre PtenF/+ and almost absent in K14Cre PtenF/F, which presents increased levels of both pAktThr308 and pAktSer473. Rapamycin effectively ablates S6 phosphorylation, normalizes pAktS473, and increases pAktThr308 in homozygous K14Cre PtenF/F mice when compared with heterozygous and control mice. C, quantitative analysis of pAktSer473, pAktThr308, and pS6, represented as the average ± SE (n = 3) normalized by the total amount of protein and displayed as fold increase of the control mice (C, bottom, white bar).

 
Rapamycin treatment clearly diminished the activity of mTOR in vivo, as judged by the dramatically reduced immunohistochemical detection of the phosphorylated form of S6, which was elevated in K14Cre PtenF/F mice when compared with littermate controls (Fig. 3B; Supplementary Fig. S2B). The reduced pS6 levels reflected the inhibition of mTOR as part of its complex 1 (mTORC1), the direct target of rapamycin (38), thus representing a suitable marker for monitoring the activity of rapamycin on its target molecule (see refs. 3941, and references therein). Concomitantly, rapamycin reduced the proliferation of epithelial cells within the skin lesions, as assessed by PCNA staining (Fig. 3B; Supplementary Fig. S2B), which was quite elevated in Pten-deficient mice when compared with controls (P < 0.001). Aligned with the elevated levels of PI3K lipid products in these Pten-deficient mice, there was an extensive accumulation of Akt phosphorylated in its Ser473 site (pAktSer473) in the skin of the vehicle-treated K14Cre PtenF/F animals (Fig. 3B, top; Supplementary Fig. S2B). Prolonged treatment with rapamycin resulted in a decreased phosphorylation of pAktSer473 (Fig. 3B; Supplementary Fig. S2B). This is likely due to the indirect inhibition of the mTOR 2 complex (mTORC2), which phosphorylates Akt on its Ser 473 site, which represents a secondary effect of rapamycin previously described to occur in vivo (38). However, there appeared to be an increased level of pAktThr380 after rapamycin treatment, which also shifted from the nucleus in the K14Cre PtenF/F animals to the membrane. These observations suggest that upon mTOR blockade, the activity of Akt may be enhanced, likely due to the absence of a negative feedback mechanism restraining growth factor activation of Akt (38), similar to that reported during recent clinical trials with rapamycin in PTEN-deficient glioblastoma patients (41). Of interest, however, this active Akt may not be able to be released from the membrane in cells that accumulate PIP3 due to the absence of Pten phosphatase activity, as judged by its membrane accumulation (Fig. 3B, middle).

Elevated levels of pS6 and the effect of rapamycin on pAktThr308 were also observed in primary cultures of keratinocytes isolated from K14Cre PtenF/F mice. As expected, Pten levels were reduced in cells isolated from heterozygous K14Cre PtenF/+ mice, and almost absent in keratinocytes from K14Cre PtenF/F homozygous mice. We observed increased levels of both pAktSer473 and pS6 in K14Cre PtenF/F homozygous mice. Rapamycin treatment lead to a complete ablation of S6 phosphorylation, although it had only a limited effect on pAktSer473 levels, aligned again with the direct effect of rapamycin on the mTORC1 complex after short time treatment. However, rapamycin provoked an increase in pAktThr308 in primary cultures from Pten-deficient mice when compared with those derived from heterozygous and control mice (Fig. 3C). Thus, the effects of rapamycin on signaling events in the epithelial compartment of the skin of K14Cre PtenF/F mice likely represent a primary effect on the targeted cells, rather than resulting from alterations caused by mTOR inhibition in the stroma.

Rapamycin as a chemoprevention agent for experimental Cowden's disease. Over 90% of individuals affected with Cowden's disease are believed to manifest clinical signs of the disease by the ages 20 years; 99% of the affected individuals develop mucocutaneous lesions by the end of the third decade, although other clinical manifestations may be present; and tumor formation is usually detected at the beginning of the fourth decade (Fig. 4 ; refs. 14). Of interest, as mice age, K14Cre PtenF/F animals acquired a phenotype that closely resembles the progression of Cowden's disease (Fig. 4; Table 1). Thus, we asked whether rapamycin administration before the appearance of disease manifestation could prevent the development of Cowden's disease–like lesions in mice already harboring Pten deletions. For these experiments, we administered a clinically relevant low dose of rapamycin (37) starting at ages 5 days, and compared disease progression in the treated animals to their littermate controls (n = 13 per group). There were no statistically significant differences in the body weight when comparing control mice treated with the rapamycin inhibitor and vehicle (Fig. 4C). The K14Cre PtenF/F mice treated with vehicle (20.9 ± 2.8 g) were slightly smaller then their control littermates (28.1 ± 2.9 g) but gained weight similar to control mice upon rapamycin treatment (24.1 ± 2.5 g; Fig. 4C). Furthermore, rapamycin treatment prevented the development of dermatologic lesions, including facial papules, oral papules, acral, and palmoplantar keratoses, and increased the life span of K14Cre PtenF/F mice (Fig. 4A and B). This reduction in the mortality of K14Cre PtenF/F mice was quite remarkable (vehicle control: median survival, 94 days; rapamycin: median survival, >320 days; P > 0.0001; Fig. 4B), suggesting that mTOR inhibition may represent a suitable chemopreventive strategy to halt Cowden's disease progression (Fig. 4D).


Figure 4
View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Prolonged treatment with rapamycin prevents the formation of mucocutaneous lesions and prolongs the survival of mice deficient in Pten. Rapamycin or vehicle was administered i.p. starting at ages 5 d to control, K14Cre PtenF/+, and K14Cre PtenF/F (n = 13 for each genotype). A, whereas K14Cre Pten F/F mice formed lesions, K14Cre PtenF/F from the same litter that were treated with rapamycin did not develop dermatologic lesions. Representative mice are depicted. B, survival curve (Kaplan-Meier survival analysis) of animals treated with vehicle and rapamycin. Rapamycin extended the survival of K14Cre PtenF/+ and K14Cre PtenF/F mice (logrank test between K14Cre PtenF/F treated with vehicle and rapamycin, P < 0.0001). C, growth curves of animals treated with vehicle and rapamycin (n = 13 mice per genotype). Points, mean; bars, SE. There were no statistically significant differences in the body weight among any of the indicated groups (P > 0.05). D, cartoon depicting the chronological development of Cowden's disease clinical manifestations during the lifetime in humans harboring inactivating PTEN mutations and deletions, and epithelial Pten-deleted mice. Arrows, initiation of rapamycin treatment for the chemoprevention (red) or therapy (orange) of experimental Cowden's disease in mice.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Cowden's disease was named after the first described patient, Rachael Cowden, in 1963 (1). The discovery of PTEN germline somatic mutations in the majority of Cowden's disease patients have provided an opportunity for the early diagnosis to individuals that are susceptible to the development of this debilitating and cancer-prone syndrome (58). Aligned with the key role of PTEN in Cowden's disease syndrome, we were able to recapitulate most of the pathognomonic lesions characterizing Cowden's disease, including trichilemmoma, acral keratoses, papillomatous, and mucosal lesions, and even breast and thyroid alterations and tumors by deleting Pten in stratified and ductal epithelial cells using K14Cre mice, which was combined with the optimization of the housing conditions to extend the life span of the affected mice. The availability of this animal model provided a unique opportunity to explore the ability to interfere with PTEN downstream molecules as potential targets for therapeutic intervention in Cowden's disease.

Reduced PTEN function, and thus elevated PIP3 accumulation, can result in altered activity of a PI3K-depedent signaling network, which ultimately promotes disease progression (21, 22). Although inhibiting PI3K activity would be a good candidate to limit PIP3, and as a result compensate for PTEN reduced activity, currently, PI3K inhibitors may have undesirable side effects that limit their clinical use (42). Among the many biochemical routes regulated by PI3K, the Akt-mTOR pathway has recently emerged as a key component of proliferative pathways activated downstream from PI3K and PTEN (34, 35, 43). In this regard, loss of mTOR is epistatic to Pten loss in drosophila megalogaster (44, 45). Furthermore, the oncogenic activity of Akt seems to be dependent on mTOR, and many sporadic tumors involving PTEN deletions and inactivating mutations are highly sensitive to rapamycin treatment that blocks mTOR (43, 46, 47). Indeed, we observed elevated activity of Akt and mTOR in hyperproliferative lesions resulting from Pten deletion. Thus, considering that prophylactic mastectomy is often recommended (48) and there is no approved therapy available for Cowden's disease, we explored the consequences of mTOR inhibition with rapamycin in this genetically defined animal model. We observed that rapamycin treatment can rapidly revert the mucocutaneous papillomatous lesions in the face and limbs, acral keratosis, and deformities of nipples, among others, concomitant with a marked decreased of the elevated levels of pS6, which served as a suitable biomarker of drug efficacy in the target tissues. Furthermore, the early treatment with rapamycin prevented the development of Cowden's disease–like lesion in mice in which Pten was excised, thus dramatically increasing their life expectancy.

The use of rapamycin has been approved by the Food and Drug Administration (FDA) in 1999 to prevent renal transplantation rejection (49). Since then, many analogues of rapamycin have been developed, some of which have increased bioavailability and are well-tolerated with reduced side effects, including lack of immunesuppressive activity at doses that are effective in blocking mTOR (35, 49). Rapamycin (41) and many of its analogues (rapalogs), including CCI-779 (temsirolimus), RAD001 (everolimus), and AP23573, are in clinical trials for a variety of tumor types, and CCI-779 has been recently approved by FDA for the treatment of renal carcinoma patients (50). Collectively, the extensive experience with the use of rapalogs in the clinic and the key role of mTOR in Cowden's disease progression may provide the rationale for the early clinical evaluation of rapamycin and its analogues as a molecular-targeted chemopreventive strategy for Cowden's disease and others tumor syndromes that involve defective PTEN function.


    Disclosure of Potential Conflicts of Interest
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
The authors declare that they have no competing financial interests.


    Acknowledgments
 
Grant support: Intramural Research Program of NIH, National Institute of Dental, and Craniofacial Research.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Alfredo Molinolo and Thomas Bugge for their critical comments.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

1 http://rsb.info.nih.gov/ij Back

Received 3/13/08. Revised 5/28/08. Accepted 7/ 1/08.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Lloyd KM II, Dennis M. Cowden's disease. A possible new symptom complex with multiple system involvement. Ann Intern Med 1963;58:136–42.[Abstract/Free Full Text]
  2. Starink TM, Meijer CJ, Brownstein MH. The cutaneous pathology of Cowden's disease: new findings. J Cutan Pathol 1985;12:83–93.[CrossRef][Medline]
  3. Schrager CA, Schneider D, Gruener AC, Tsou HC, Peacocke M. Clinical and pathological features of breast disease in Cowden's syndrome: an underrecognized syndrome with an increased risk of breast cancer. Hum Pathol 1998;29:47–53.[CrossRef][Medline]
  4. Gustafson S, Zbuk KM, Scacheri C, Eng C. Cowden syndrome. Semin Oncol 2007;34:428–34.[CrossRef][Medline]
  5. Nelen MR, Padberg GW, Peeters EA, et al. Localization of the gene for Cowden disease to chromosome 10q22–23. Nat Genet 1996;13:114–6.[CrossRef][Medline]
  6. Nelen MR, van Staveren WC, Peeters EA, et al. Germline mutations in the PTEN/MMAC1 gene in patients with Cowden disease. Hum Mol Genet 1997;6:1383–7.[Abstract/Free Full Text]
  7. Steck PA, Pershouse MA, Jasser SA, et al. Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 1997;15:356–62.[CrossRef][Medline]
  8. Liaw D, Marsh DJ, Li J, et al. Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat Genet 1997;16:64–7.[CrossRef][Medline]
  9. Maehama T, Dixon JE. The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 1998;273:13375–8.[Abstract/Free Full Text]
  10. Maehama T. PTEN: its deregulation and tumorigenesis. Biol Pharm Bull 2007;30:1624–7.[CrossRef][Medline]
  11. Stambolic V, Suzuki A, de la Pompa JL, et al. Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 1998;95:29–39.[CrossRef][Medline]
  12. Eng C. PTEN: one gene, many syndromes. Hum Mutat 2003;22:183–98.[CrossRef][Medline]
  13. Di Cristofano A, Pesce B, Cordon-Cardo C, Pandolfi PP. Pten is essential for embryonic development and tumour suppression. Nat Genet 1998;19:348–55.[CrossRef][Medline]
  14. Suzuki A, Itami S, Ohishi M, et al. Keratinocyte-specific Pten deficiency results in epidermal hyperplasia, accelerated hair follicle morphogenesis and tumor formation. Cancer Res 2003;63:674–81.[Abstract/Free Full Text]
  15. Backman SA, Ghazarian D, So K, et al. Early onset of neoplasia in the prostate and skin of mice with tissue-specific deletion of Pten. Proc Natl Acad Sci U S A 2004;101:1725–30.[Abstract/Free Full Text]
  16. Backman SA, Stambolic V, Suzuki A, et al. Deletion of Pten in mouse brain causes seizures, ataxia and defects in soma size resembling Lhermitte-Duclos disease. Nat Genet 2001;29:396–403.[CrossRef][Medline]
  17. Stambolic V, Tsao MS, Macpherson D, Suzuki A, Chapman WB, Mak TW. High incidence of breast and endometrial neoplasia resembling human Cowden syndrome in pten+/- mice. Cancer Res 2000;60:3605–11.[Abstract/Free Full Text]
  18. Kwon CH, Zhu X, Zhang J, et al. Pten regulates neuronal soma size: a mouse model of Lhermitte-Duclos disease. Nat Genet 2001;29:404–11.[CrossRef][Medline]
  19. Yeager N, Klein-Szanto A, Kimura S, Di Cristofano A. Pten loss in the mouse thyroid causes goiter and follicular adenomas: insights into thyroid function and Cowden disease pathogenesis. Cancer Res 2007;67:959–66.[Abstract/Free Full Text]
  20. Sulis ML, Parsons R. PTEN: from pathology to biology. Trends Cell Biol 2003;13:478–83.[CrossRef][Medline]
  21. Vivanco I, Sawyers CL. The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer 2002;2:489–501.[CrossRef][Medline]
  22. Shaw RJ, Cantley LC. Ras, PI(3)K and mTOR signalling controls tumour cell growth. Nature 2006;441:424–30.[CrossRef][Medline]
  23. Castilho RM, Squarize CH, Patel V, et al. Requirement of Rac1 distinguishes follicular from interfollicular epithelial stem cells. Oncogene 2007;26:5078–85.[CrossRef][Medline]
  24. Andl T, Ahn K, Kairo A, et al. Epithelial Bmpr1a regulates differentiation and proliferation in postnatal hair follicles and is essential for tooth development. Development 2004;131:2257–68.[Abstract/Free Full Text]
  25. Groszer M, Erickson R, Scripture-Adams DD, et al. Negative regulation of neural stem/progenitor cell proliferation by the Pten tumor suppressor gene in vivo. Science New York NY 2001;294:2186–9.
  26. Amornphimoltham P, Patel V, Sodhi A, et al. Mammalian target of rapamycin, a molecular target in squamous cell carcinomas of the head and neck. Cancer Res 2005;65:9953–61.[Abstract/Free Full Text]
  27. Squarize CH, Castilho RM, Sriuranpong V, Pinto DS, Jr., Gutkind JS. Molecular cross-talk between the NF{kappa}B and STAT3 signaling pathways in head and neck squamous cell carcinoma. Neoplasia 2006;8:733–46.[CrossRef][Medline]
  28. Squarize CH, Castilho RM, Santos Pinto D, Jr. Immunohistochemical evidence of PTEN in oral squamous cell carcinoma and its correlation with the histological malignancy grading system. J Oral Pathol Med 2002;31:379–84.[CrossRef][Medline]
  29. Klymkowsky MW. Intermediate filaments. Getting under the skin. Nature 1991;354:264.[CrossRef][Medline]
  30. Brownstein MH, Wolf M, Bikowski JB. Cowden's disease: a cutaneous marker of breast cancer. Cancer 1978;41:2393–8.[CrossRef][Medline]
  31. Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science New York NY 2005;307:1098–101.
  32. Fingar DC, Salama S, Tsou C, Harlow E, Blenis J. Mammalian cell size is controlled by mTOR and its downstream targets S6K1 and 4EBP1/eIF4E. Genes Dev 2002;16:1472–87.[Abstract/Free Full Text]
  33. Inoki K, Guan KL. Complexity of the TOR signaling network. Trends Cell Biol 2006;16:206–12.[CrossRef][Medline]
  34. Inoki K, Corradetti MN, Guan KL. Dysregulation of the TSC-mTOR pathway in human disease. Nat Genet 2005;37:19–24.[CrossRef][Medline]
  35. Sabatini DM. mTOR and cancer: insights into a complex relationship. Nat Rev Cancer 2006;6:729–34.[CrossRef][Medline]
  36. Sabers CJ, Martin MM, Brunn GJ, et al. Isolation of a protein target of the FKBP12-rapamycin complex in mammalian cells. J Biol Chem 1995;270:815–22.[Abstract/Free Full Text]
  37. Granville CA, Warfel N, Tsurutani J, et al. Identification of a highly effective rapamycin schedule that markedly reduces the size, multiplicity, and phenotypic progression of tobacco carcinogen-induced murine lung tumors. Clin Cancer Res 2007;13:2281–9.[Abstract/Free Full Text]
  38. Guertin DA, Sabatini DM. Defining the role of mTOR in cancer. Cancer Cell 2007;12:9–22.[CrossRef][Medline]
  39. Cho D, Signoretti S, Dabora S, et al. Potential histologic and molecular predictors of response to temsirolimus in patients with advanced renal cell carcinoma. Clin Genitour Cancer 2007;5:379–85.[CrossRef]
  40. Pantuck AJ, Seligson DB, Klatte T, et al. Prognostic relevance of the mTOR pathway in renal cell carcinoma: implications for molecular patient selection for targeted therapy. Cancer 2007;109:2257–67.[CrossRef][Medline]
  41. Cloughesy TF, Yoshimoto K, Nghiemphu P, et al. Antitumor activity of rapamycin in a phase I trial for patients with recurrent PTEN-deficient glioblastoma. PLoS medicine 2008;5:e8.[CrossRef]
  42. Stein RC, Waterfield MD. PI3-kinase inhibition: a target for drug development? Mol Med Today 2000;6:347–57.[CrossRef][Medline]
  43. Neshat MS, Mellinghoff IK, Tran C, et al. Enhanced sensitivity of PTEN-deficient tumors to inhibition of FRAP/mTOR. Proc Natl Acad Sci U S A 2001;98:10314–9.[Abstract/Free Full Text]
  44. Goberdhan DC, Paricio N, Goodman EC, Mlodzik M, Wilson C. Drosophila tumor suppressor PTEN controls cell size and number by antagonizing the Chico/PI3-kinase signaling pathway. Genes Dev 1999;13:3244–58.[Abstract/Free Full Text]
  45. Oldham S, Montagne J, Radimerski T, Thomas G, Hafen E. Genetic and biochemical characterization of dTOR, the Drosophila homolog of the target of rapamycin. Genes Dev 2000;14:2689–94.[Abstract/Free Full Text]
  46. Majumder PK, Febbo PG, Bikoff R, et al. mTOR inhibition reverses Akt-dependent prostate intraepithelial neoplasia through regulation of apoptotic and HIF-1-dependent pathways. Nat Med 2004;10:594–601.[CrossRef][Medline]
  47. Podsypanina K, Lee RT, Politis C, et al. An inhibitor of mTOR reduces neoplasia and normalizes p70/S6 kinase activity in Pten+/– mice. Proc Natl Acad Sci U S A 2001;98:10320–5.[Abstract/Free Full Text]
  48. Guillem JG, Wood WC, Moley JF, et al. ASCO/SSO review of current role of risk-reducing surgery in common hereditary cancer syndromes. J Clin Oncol 2006;24:4642–60.[Abstract/Free Full Text]
  49. Faivre S, Kroemer G, Raymond E. Current development of mTOR inhibitors as anticancer agents. Nat Rev Drug Discov 2006;5:671–88.[CrossRef][Medline]
  50. Rini B, Kar S, Kirkpatrick P. Temsirolimus. Nat Rev Drug Discov 2007;6:599–600.[CrossRef]



This article has been cited by other articles:


Home page
BloodHome page
P. R. Hagner, K. Mazan-Mamczarz, B. Dai, S. Corl, X. F. Zhao, and R. B. Gartenhaus
Alcohol consumption and decreased risk of non-Hodgkin lymphoma: role of mTOR dysfunction
Blood, May 28, 2009; 113(22): 5526 - 5535.
[Abstract] [Full Text] [PDF]


Home page
Cancer Prevention ResearchHome page
P. A. Dennis
Rapamycin for Chemoprevention of Upper Aerodigestive Tract Cancers
Cancer Prevention Research, January 1, 2009; 2(1): 7 - 9.
[Full Text] [PDF]


Home page
Cancer Prevention ResearchHome page
K.-K. Wong
Oral-Specific Chemical Carcinogenesis in Mice: An Exciting Model for Cancer Prevention and Therapy
Cancer Prevention Research, January 1, 2009; 2(1): 10 - 13.
[Full Text] [PDF]


Home page
Cancer Prevention ResearchHome page
R. Czerninski, P. Amornphimoltham, V. Patel, A. A. Molinolo, and J. S. Gutkind
Targeting Mammalian Target of Rapamycin by Rapamycin Prevents Tumor Progression in an Oral-Specific Chemical Carcinogenesis Model
Cancer Prevention Research, January 1, 2009; 2(1): 27 - 36.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Squarize, C. H.
Right arrow Articles by Gutkind, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Squarize, C. H.
Right arrow Articles by Gutkind, J. S.
Related Collections
Right arrow Oncogenesis
Right arrow Oncogenesis: Animal Models
Right arrow Preclinical Intervention: In Vivo (Animals): Drugs, Nutritional Interventions, Mechanisms


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online