Cancer Research Cancer Epigenetics  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 68, 7938, October 1, 2008. doi: 10.1158/0008-5472.CAN-08-0932
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Clark, E. L.
Right arrow Articles by Robson, C. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Clark, E. L.
Right arrow Articles by Robson, C. N.

Experimental Therapeutics, Molecular Targets, and Chemical Biology

The RNA Helicase p68 Is a Novel Androgen Receptor Coactivator Involved in Splicing and Is Overexpressed in Prostate Cancer

Emma L. Clark1, Anne Coulson1, Caroline Dalgliesh2, Prabhakar Rajan1,2, Samantha M. Nicol3, Stewart Fleming3, Rakesh Heer1, Luke Gaughan1, Hing Y. Leung4, David J. Elliott2, Frances V. Fuller-Pace3 and Craig N. Robson1

1 Northern Institute for Cancer Research and 2 Institute of Human Genetics, Newcastle University, Newcastle-upon-Tyne, United Kingdom; 3 Molecular and Cellular Pathology, Ninewells Hospital and Medical School, University of Dundee, Dundee, United Kingdom; and 4 The Beatson Institute for Cancer Research, Glasgow, United Kingdom

Requests for reprints: Craig N. Robson, Northern Institute for Cancer Research, Paul O'Gorman Building, Newcastle University, Newcastle-upon-Tyne, NE2 4HH, United Kingdom. Phone: 44-191-246-4426; Fax: 44-191-246-4301; E-mail: C.N.Robson{at}ncl.ac.uk.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
The androgen receptor (AR) is a member of the nuclear steroid hormone receptor family and is thought to play an important role in the development of both androgen-dependent and androgen-independent prostatic malignancy. Elucidating roles by which cofactors regulate AR transcriptional activity may provide therapeutic advancement for prostate cancer (PCa). The DEAD box RNA helicase p68 (Ddx5) was identified as a novel AR-interacting protein by yeast two-hybrid screening, and we sought to examine the involvement of p68 in AR signaling and PCa. The p68-AR interaction was verified by colocalization of overexpressed protein by immunofluorescence and confirmed in vivo by coimmunoprecipitation in the PCa LNCaP cell line. Chromatin immunoprecipitation in the same cell line showed AR and p68 recruitment to the promoter region of the androgen-responsive prostate-specific antigen (PSA) gene. Luciferase reporter, minigene splicing assays, and RNA interference (RNAi) were used to examine a functional role of p68 in AR-regulated gene expression, whereby p68 targeted RNAi reduced AR-regulated PSA expression, and p68 enhanced AR-regulated repression of CD44 splicing (P = 0.008). Tyrosine phosphorylation of p68 was found to enhance coactivation of ligand-dependent transcription of AR-regulated luciferase reporters independent of ATP-binding. Finally, we observe increased frequency and expression of p68 in PCa compared with benign tissue using a comprehensive prostate tissue microarray (P = 0.003; P = 0.008). These findings implicate p68 as a novel AR transcriptional coactivator that is significantly overexpressed in PCa with a possible role in progression to hormone-refractory disease. [Cancer Res 2008;68(19):7938–46]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Prostate cancer (PCa) is the second leading cause of male cancer deaths with >670,000 men diagnosed worldwide each year. PCa incident rates for the United States, European Union, and the United Kingdom are currently 125, 106.2, and 107.3 cases per 100,000 men, respectively (1, 2). The onset and progression of PCa is driven by the transcriptional function of the androgen receptor (AR), a member of the nuclear hormone receptor family of transcriptional factors. Ablation of androgens, the major AR ligand, is a therapeutic modality in the early stages of the disease. However, PCa can progress to a hormone-refractory phenotype (HRPCa) due to mechanisms that are largely undefined. The majority of HRPCa still express AR and AR-regulated genes, indicating that an active AR-signaling cascade is maintained despite castrate levels of androgens (3). A suggested mechanism for maintenance of a functionally active AR is aberrant expression of AR cofactors leading to increased AR sensitivity or promiscuous activation of AR by other steroid hormones (4, 5). There are currently no curative therapeutic agents for HRPCa (6).

The p68 DEAD box RNA helicase (Ddx5) is a growth and developmentally regulated prototypic member of the DEAD box family of enzymes, and an established RNA helicase. p68 has been found to play a role in a wide range of cellular functions, including pre-mRNA, rRNA, and microRNA processing (7, 8), ribosome biogenesis, and cell proliferation (9), transcription (reviewed in refs. 10, 11) and transcriptional deactivation by promotion of mRNA transcript release in Drosophila (12). A role for p68 in transcription is underscored through its interaction with components of the transcription machinery and other transcription-related factors [RNA polymerase II (RNAPII), CBP, p300, HDAC1, and Smad3; ref. 10]. There is now considerable evidence indicating that p68 is a potent transcriptional coactivator of estrogen receptor {alpha} (1315); tumor suppressor p53 (16); MyoD (17), and β-catenin (18).

p68 has been shown to be overexpressed and polyubiquitylated in colorectal tumors (19), suggesting that posttranslational changes or modification of p68 expression may play a role in tumor development. In addition, modification of p68 by the small ubiquitin-like modifier SUMO-2 was found to modulate the activity of p68 as a transcriptional regulator, favoring an action as a repressor (20, 21). Furthermore, tyrosine phosphorylation on Y593 of p68 by c-Abl was shown to be associated with cellular transformation and epithelial-mesenchymal transition in colon cancer (2224)—although controversy exists as to whether this is through p68 nuclear translocation of β-catenin (25)—and tyrosine phosphorylation of p68 at this residue has also been shown to be important in platelet-derived growth factor (PDGF) induced cell proliferation through the up-regulation of cyclin D1 and c-Myc expression (24). Together, these findings indicate that the DEAD box RNA helicase p68 plays an important role in transcriptional regulation, and posttranslational modifications of the helicase may be important in tumor development. In this study, we identify p68 as a novel AR coactivator and explore the relationship between p68 with AR signaling in PCa and suggest a role for p68 in cancer progression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Yeast two-hybrid assay. p68 was identified from a prostate library (Clontech) in a yeast two-hybrid screen using the AR bait clones pGBKT7-ARDS (containing the AR-DNA and steroid binding domains, but lacking the NH2 terminal domain) and pGBT9-AGA (with a substituted AR-DNA binding domain for a GAL4 binding domain), as previously described (26).

Cell culture. All cells were grown at 37°C in 5% CO2. LNCaP cells were cultured in RPMI 1640, COS-7, and HEK 293 cells in DMEM plus 1% L-glutamine (Invitrogen) supplemented with 10% FCS (Invitrogen) or 10% Dextran Charcoal Stripped FCS (Hyclone) to produce steroid-depleted media, as detailed in figure legends. Where indicated, cells were treated with 10 nmol/L R1881 (methyltrienolone).

Tissue microarray and immunohistochemistry. Immunohistochemistry was performed using a tissue microarray (TMA) of benign and malignant prostate biopsies derived from transrectal biopsy, transurethral resection, and radical prostatectomy as previously described (27). All materials were used in accordance with approval granted by the Northumberland, Tyne and Wear NHS Strategic Health Authority Research Ethics Committee (reference 2003/11; The Freeman Hospital). The average core loss was 28%, and the final study included 147 cancer biopsies and 44 benign biopsies. Antigen retrieval was achieved by immersion in 10 mmol/L citric acid buffer (pH 6.0), followed by microwaving for 15 min (at 1,000 W) in a pressure cooker. Sections were immunostained with PAb204 (mouse monoclonal antibody against p68, Upstate) on a DAKO autostainer using Vectastain ABC kits (Vector Labs), according to the manufacturer's protocol. Sections known to stain positively were included in each batch, and negative controls were prepared by replacing the primary antibody with TBS buffer. p68 expression was scored blindly by intensity of staining in each biopsy core as being absent (0), weak (+), moderate (++), or strong (+++). Sections were viewed on a Nikon Eclipse 600 microscope, and images were captured using a Nikon OXM1200 camera with Eclipse net software.

Plasmids, antibodies, and drugs. The plasmids p(ARE)3 Luc, pCMV-β-gal, pcDNA3-ARWT (26), GFP-ARWT (28), pcDNA3-p68WT, pcDNA3-p72WT (16, 29), pCMV-c-Abl (30), pGFP3-Sam68 (31), pcDNA3-p68GLT, and pSG5-p68Y593F, described previously, were generated by site-directed mutagenesis of p68WT and ligated into appropriate vectors. The YFP-p68 construct, CDM and CD44v5 minigenes, were kind gifts from Angus Lamond (University of Dundee), Bert O'Malley (Baylor College of Medicine), and Stefan Stamm (University of Kentucky), respectively.

The antibodies p68 goat polyclonal, AR rabbit polyclonal C-19, and prostate-specific antigen (PSA) goat polyclonal (Santa Cruz); p68 mouse monoclonal (Upstate); AR mouse monoclonal (BD Pharmingen); TATA binding protein mouse monoclonal (TBP-Abcam); {alpha}-tubulin mouse monoclonal (Sigma); c-Abl mouse monoclonal (Chemicon); and P-Tyr-100 and myc mouse monoclonal (Cell Signaling) were used as stated in figure legends.

The tyrosine kinase inhibitor imatinib was obtained from the Pharmacy Department of the Royal Victoria Infirmary Hospital.

Immunocytochemistry. Immunocytochemistry was performed on HEK 293 cells transfected with 1 µg of GFP-AR and/or YFP-p68 construct using Superfect (Qiagen), as described previously (28). Transfected cells were placed in steroid depleted media for 24 h and then treated with 10 nmol/L R1881 for a further 16 h before fixing them in methanol. Slides were visualized using laser scanning confocal microscopy (Leica).

Luciferase reporter and minigene splicing assays. Luciferase reporter assays were performed on COS-7 cells cotransfected in triplicate with 0.1 µg of p(ARE)3Luc, 0.1 g of pcDNA3-ARWT, 0.1 µg of pCMV-β-gal, and p68WT/Y593F, p72, and c-Abl pcDNA fusion constructs using Superfect (Qiagen), as described previously (30). The range of plasmid levels indicated in figures (+, ++, +++, and ++++), corresponds to 25, 50, 75 and 100 ng, respectively. Luciferase activity was corrected for the corresponding β-gal activity to give a relative activity.

Minigene splicing assays were performed in HEK 293 cells in six-well plates, as previously described (31, 32). Transfected cells were placed in steroid depleted media for 24 h and treated with 10 nmol/L R1881, as detailed in figure legends. RNA was extracted using Trizol (Invitrogen) and reverse transcription–PCR (RT-PCR) performed using the One-Step RT-PCR kit (Qiagen). Densitometric band quantification was performed as previously described (33). The identities and sizes of bands were verified by sequencing.

All reporter and minigene assays shown are the mean of at least three independent experiments ± SE.

Cell lysate extraction and coimmunoprecipitation. LNCaP cells were cultured in steroid depleted media for 48 h before 10 nmol/L R1881 treatment for 8 h. Cells were nuclear extracted using CelLytic NuCLEAR extraction kit with an extraction buffer salt concentration of 330 mmol/L in the presence of PhosStop phosphatase inhibitors (Roche) and RNase A (100 µg/mL; Sigma). AR and p68 coimmunoprecipitation experiments were performed as described previously (34).

RNA interference and quantitative real-time PCR. LNCaP cells seeded in six-well plates were transfected with p68 or nonsilencing (NS) small interfering RNA (siRNA) using RNAifect (Qiagen), according to manufacturer's instructions. The p68 and NS siRNA oligonucleotides have been described previously (16, 35). Transfected cells and nontreated controls (C) were grown in steroid-depleted media for 24 h and then treated with 10 nmol/L R1881 for a further 16 h. Cells were harvested in either SDS sample buffer (protein) or TRIzol reagent (Invitrogen, followed by RT-PCR) to study mRNA expression by quantitative real-time PCR (QPCR) relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression as previously described (35). Oligonucleotides were used to determine p68 (CACATCAATCATCAGCCATTCCT and CAAACAAATAGGCCCATCGC) and AR (GGACTTGTGCATGCGGTACTCA and CCTGGCTTCGGCAACTTACAC) mRNA expression. The PSA and GAPDH oligonucleotides have been described previously (34).

Chromatin-immunoprecipitation assays. Chromatin immunoprecipitation (ChIP) assays were performed in LNCaP cells, as described previously (35), in the presence of RNase A (100 µg/mL). p68 and AR bound chromatin was immunoprecipitated using 2 µg of p68 goat or AR rabbit polyclonal C19 antibody, respectively. QPCR was performed on inputs and recovered material to assess the co-occupancy of AR and p68 to the proximal ARE I within the PSA promoter and distal ARE III within the PSA enhancer, as described previously (34). The results of all ChIP assays shown are the mean of at least three independent experiments ± SE.

Statistical analysis. The independent sample t test was used to compare differences in the ratio of exon skipping/inclusion products between groups in the minigene assays. For immunohistochemistry, differences in the frequency and expression of p68 between groups were examined using Fisher's exact test and Mann-Whitney U test, respectively. Correlations with Gleason grade (GG) were undertaken using the Kruskal-Wallis test. Patient survival was analyzed using the Kaplan-Meier method with log-rank testing, and multivariate analysis was performed using the Cox regression model. All tests were undertaken using SPSS version 11.0 computer software (SPSS, Inc.). All tests were two-sided and a P value of <0.05 was taken to indicate statistical significance.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
p68 is a novel nuclear AR-interacting protein in PCa cells. The conserved helicase core (amino acids 203–353) of the p68 DEAD box RNA helicase was identified as a positive clone during a yeast two-hybrid screen for novel AR-interacting partners. Subsequent immunoblot analysis showed nuclear localization of p68 in three different cell lines (Fig. 1A ), that was unaffected by androgen treatment in the PCa LNCaP cell line (Supplementary Fig. S1). Accordingly, nuclear colocalization of cotransfected p68WT-YFP and ARWT-GFP tagged constructs in HEK 293 cells grown in the presence of androgen was observed by confocal microscopy (Fig. 1B). Coimmunoprecipitation experiments with nuclear extracts of LNCaP cells further showed that the endogenous p68 and AR interaction was enhanced in the presence of androgens (Fig. 1C). However, it is notable that the AR gene is itself androgen responsive and so the enhanced interaction is most likely due to an increase in AR levels and not due to a higher interaction affinity in the presence of androgens. No difference in the intensity of the AR protein band was seen between ±RNase-treated samples (in the presence of androgens), suggesting that the AR-p68 interaction was not RNA-dependent. Together, these data provide evidence that p68 interacts with the AR in the nucleus of prostate cells and could thus function as a potential AR coregulator.


Figure 1
View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. p68 is a nuclear protein and interacts with AR. A, cropped immunoblot images of p68 in nuclear (N) and cytosolic (C) cell lysates obtained from LNCaP, COS-7, and HEK 293 cells probed sequentially with p68, TATA binding protein (TBP), and {alpha}-tubulin antibody. B, immunofluorescence images of HEK 293 cells transfected with ARWT-GFP or p68WT-YFP constructs in the presence of 10 nmol/L R1881. Cells were nuclei stained with 4',6-diamidino-2-phenylindole before confocal microscope imaging. C, cropped immunoblot images of LNCaP nuclear lysates coimmunoprecipitated (IP) with either AR rabbit or p68 goat polyclonal antibody (±R1881 10 nmol/L) probed sequentially with p68 and AR mouse monoclonal antibodies. p68 coimmunoprecipitated AR ±RNase treatment (100 µg/mL) was in the presence of R1881 10 nmol/L. Control (Con) lanes contain LNCaP nuclear lysate and protein G Sepharose only.

 
Role of p68 as an AR coactivator. The LXXLL motif is observed in cofactors that interact with ligand-activated nuclear hormone receptors (36). We found that p68 contained an LXXLL motif at amino acid 146, which was a strong indicator that p68 would act as a transcriptional coregulator of the AR. To further explore this, we undertook ChIP assays to confirm p68 and AR cooccupancy at androgen-responsive elements (ARE) within the promoter and enhancer regions of the androgen-responsive PSA gene. Both p68 and AR were dynamically recruited to the ARE I and ARE III regions of the PSA promoter and enhancer, respectively (Fig. 2A and B ), with maximal observed recruitment to both regions at 80 min after androgen stimulation. These results clearly show the presence of p68 at the active promoter of an AR-regulated gene, suggesting a putative role for p68 in AR-dependent transcriptional initiation.


Figure 2
View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. p68 co-occupies the active PSA promoter at ARE regions and enhances AR transcriptional activity. QPCR analysis (n = 3) of ChIP assays (n = 3) normalized to GAPDH levels (±SE) shows p68 (columns) and AR (line) recruitment to ARE I promoter (A) and ARE III enhancer (B) regions of the PSA gene over a time course of 100 min after 10 nmol/L R1881 treatment. COS-7 cells were cotransiently transfected in triplicate with 0.1 µg of p(ARE)3 luciferase reporter, 0.1 µg pcDNA3-AR, 0.1 µg of pCMV-β-gal, and increasing concentrations of pcDNA3-p68WT (C) and pcDNA3-p68GLT (D) constructs (±10nmol/L R1881). Luciferase activity was corrected for the corresponding β-gal activity to give a relative activity. The range of plasmid levels (+, ++, +++, and ++++) corresponds to 25, 50, 75, and 100 ng, respectively. Data show relative activity from at least three separate luciferase assay experiments (±SE).

 
To further examine whether p68 coregulates AR activity, luciferase reporter assays driven by androgen-responsive fragments of the PSA promoter were used to monitor AR transcriptional activity. AR-mediated reporter activity was robustly stimulated by the addition of androgens, and in the presence of p68; we observed a dose-dependent coactivation of AR-mediated activity above AR-alone levels (Fig. 2C). p68 did not directly affect luciferase reporter activity in the absence of AR (Supplementary Fig. S2), illustrating that p68 was not acting via AR-independent pathways.

ATP-dependent helicase enzymes, such as p68, use the binding of ATP to increase the affinity and specificity of binding to RNA. Using ATPase mutants, we sought to investigate whether the ATP binding/hydrolysis activity of p68 had a functional role in AR coactivation. An ATPase A (p68GLT) mutant maintained AR coactivation above levels of AR alone (Fig. 2D), similar to findings with a mutant directed to the ATPase B (p68NEAD) domain of p68 (data not shown), confirming that neither a conformational change upon p68 ATP binding nor helicase activity was required for p68 coactivation of the AR. This supports previous findings with other p68 interacting partners that showed ATPase/RNA helicase activity was not required for transcriptional function (13, 16, 17).

To determine whether post-translational modifications were necessary for AR coactivation, we used a p68Y593F mutant that was not tyrosine-phosphorylated at Y593 in luciferase reporter assays. We found that the p68Y593F mutant was unable to increase the activation of AR over AR-alone levels compared with p68WT, indicating that the phosphorylation of p68 at Y593 was important for coactivation of the AR (Fig. 3A ). In addition, coimmunoprecipitation experiments showed that p68 was tyrosine phosphorylated and associated with c-Abl in the PCa LNCaP cell line (Fig. 3B), although LNCaP cells transiently transfected with the p68Y593F mutant also showed an interaction with c-Abl, indicating that sites other than Y593 may be phosphorylated by c-Abl. Further luciferase reporter assays showed that increasing amounts of c-Abl in the presence of a low concentration of p68WT enhanced coactivation of AR over p68WT alone (Fig. 3C). c-Abl had no enhanced effect on luciferase reporter activity in the presence of the p68Y593F mutant or in the absence of AR and/or p68WT, indicating that c-Abl was neither enhancing the effect of AR directly nor acting via AR-independent pathways. Furthermore, luciferase reporter assays showed a decrease in coactivation of the AR by p68WT in the presence of the tyrosine kinase inhibitor imatinib (10 µmol/L) compared with untreated cells (Fig. 3D). Collectively, these data show that p68 is a coactivator of the AR, independent of the helicase function of p68, and c-Abl activity enhances coactivation through the tyrosine phosphorylation of p68 at Y593.


Figure 3
View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Coactivation of AR is enhanced by c-Abl–mediated tyrosine phosphorylation of p68 at Y593. A, COS-7 cells were cotransiently transfected in triplicate with 0.1 µg of p(ARE)3 luciferase reporter, 0.1 µg pcDNA3-AR, 0.1 µg of pCMV-β-gal, and increasing concentrations of pcDNA3-p68WT (columns) and pcDNA3-p68Y593F (line) constructs (+ 10 nmol/L R1881). B, cropped immunoblot images of LNCaP nuclear lysates (±10 nmol/L R1881) coimmunoprecipitated (IP) with p68 goat polyclonal antibody probed sequentially with P-Tyr-100, c-Abl, and p68 mouse monoclonal antibodies. Nuclear lysates of LNCaP cells transfected with p68Y593F mutant (full media + 10 nmol/L R1881) immunoprecipitated with c-Abl mouse monoclonal antibody and sequentially probed with myc (p68Y593F) or c-Abl mouse monoclonal antibody. C, (ARE)3 luciferase reporter plus 0.1 µg pcDNA3-AR and increasing concentrations of pcDNA3-p68WT, pcDNA3-p68Y593F, and/or pcDNA3-c-AblWT (+ 10 nmol/L R1881). D, (ARE)3 luciferase reporter plus 0.1 µg pcDNA3-AR and increasing concentrations of pcDNA3-p68WT ±10 µmol/L imatinib (+ 10 nmol/L R1881). Luciferase activity was corrected for the corresponding β-gal activity to give a relative activity. The range of plasmid levels (+, ++, +++, and ++++) corresponds to 25, 50, 75, and 100 ng, respectively. Data is shown relative to AR activity alone from at least three separate luciferase assay experiments (±SE).

 
The highly homologous p72 DEAD box RNA helicase (Ddx17) has been shown to interact with p68 and coactivate both estrogen receptor {alpha} and MyoD (14, 17). Therefore, we examined the effect of p72 on AR-mediated luciferase reporter activity. p72 did not enhance AR-regulated transcriptional activity above levels seen with AR alone (Supplementary Fig. S3). Moreover, increasing amounts of p72 had no effect on p68-mediated coactivation of AR transcriptional activity (at a low p68 concentration), and increasing p68 and p72 amounts (at the same concentration) did not enhance AR-mediated transcriptional activity over levels observed with p68 alone. These data show that p72 does not function as an AR transcriptional coregulator either alone or in conjunction with p68.

p68 knockdown by RNA interference reduces AR and PSA protein and mRNA expression. To determine a physiological role for p68 in AR transcriptional activity, we examined the effects of RNA interference (siRNA)–mediated silencing of endogenous p68 gene expression on the expression of AR and the AR-regulated androgen-responsive PSA gene in vivo in the LNCaP cell line. In the presence of androgens, p68 targeted siRNA (but not NS siRNA) reduced the expression of p68 mRNA (>60%; Fig. 4B ) and protein (Fig. 4A) compared with control (non–siRNA transfected) LNCaP cells. Furthermore, a reduction in the expression of PSA and AR mRNA (~40% and ~60%, respectively; Fig. 4C and D) and protein (Fig. 4A) was also seen with p68 targeted siRNA compared with NS controls. The AR is an androgen-responsive gene itself, and these findings clearly show that p68 targeted RNAi in PCa cells in the presence of androgens reduces protein expression of both the AR and the AR-regulated PSA gene. These data are strong evidence that p68 is an important coactivator of AR-mediated genes.


Figure 4
View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Silencing p68 protein expression by RNAi reduces AR and PSA mRNA and protein levels in LNCaP cells. A, cropped immunoblot images of LNCaP lysates transfected with p68 and NS targeted RNAi compared with control (C, nontransfected) cells (+10 nmol/L R1881) probed sequentially with p68, AR, PSA, and {alpha}-tubulin antibodies. NS and control protein levels are similar demonstrating no off-target RNAi affects protein expression. QPCR analysis of p68 (B), PSA (C), and AR mRNA (D) expression in p68 targeted RNAi cells compared with NS controls. QPCR data were normalized to GAPDH levels and fold change calculated to NS mRNA levels (set as 1). Figure shows the results from three independent RNAi experiments and at least three separate QPCR experiments (±SE).

 
p68 enhances AR-dependent repression of splicing of a hormone-responsive CD44 variable exon minigene. Although p68 plays key roles in alternative splicing in some contexts, e.g., in splice site stability, spliceosome assembly, and H-ras splicing (reviewed in ref. 10), it is unable to directly affect CD44 variable exon inclusion (ref. 37; Supplementary Fig. S4). However, transcriptional coregulators of nuclear hormone receptors have been shown to affect splicing events (32, 38, 39). The AR has recently been shown to repress splicing of a CD44 variable exon minigene downstream of a hormone-responsive promoter (31, 39). Because p68 is recruited to the PSA promoter and coactivates AR-dependent transcription, we considered the possibility that p68 may also modulate AR-dependent splicing. We used a CD44 variable exon v4 and v5 minigene under the transcriptional control of the hormone-responsive mouse mammary tumor virus (MMTV) promoter (CDM) transfected into HEK 293 cells with expression constructs encoding AR and/or p68 (Fig. 5A ). RT-PCR and band densitometry (Fig. 5B and C), to study alternatively spliced transcripts, showed that p68 enhanced AR-mediated exon skipping in the presence of androgens (compare the ratio of exon skipping/inclusion product in lanes 1 and 2 with lanes 5 and 6; P = 0.008).


Figure 5
View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. p68 enhances AR-dependent repression of a CD44 variable exon minigene. A, minigene CDM contains variable exons v4 and v5 cloned downstream of steroid-responsive MMTV promoter. Arrows show location of primers used for RT-PCR. B, HEK 293 cells cultured in steroid-depleted media before transfection with the CDM minigene, pcDNA3-AR and pcDNA3-p68WT (±10 nmol/L R1881). Arrows indicate RT-PCR two exon inclusion (393bp), one exon inclusion (278bp), and exon skipped (163bp) products. Image is representative of at least three independent experiments. Marker (M), 1 kb plus DNA ladder (Invitrogen). C, densitometric assessment from gel images to obtain mean relative ratios of exon skipped/inclusion product (±SE).

 
p68 protein expression in clinical prostate biopsies. Because other AR transcriptional coregulators have been shown to be overexpressed in PCa (40), we decided to examine p68 protein expression by immunostaining of a prostate TMA containing 147 cancer and 44 benign biopsies. The incidence of p68 expressing biopsies was significantly greater in the PCa cohort (66 of 147; 45%) compared with benign prostatic hyperplasia (BPH; 11 of 44, 25%, P = 0.003, two-sided Fisher's exact test; Fig. 6A ). In addition, an increasing frequency of p68 expression was observed with increasing GG tumors [GG3 = 14 of 38 (37%), GG4 = 23 of 51 (45%), GG5 = 26 of 55 (47%)], although the trend did not reach statistical significance (P = 0.3, Kruskal-Wallis test; Fig. 6B and C). Up-regulation in the level of p68 expression by nearly 3-fold was seen in PCa biopsies compared with BPH (P = 0.008, Mann-Whitney test; Fig. 6D). No statistical correlation with local stage, PSA, metastases, time treatment failure, or survival was seen with p68 expression in either multivariate or univariate analyses.


Figure 6
View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. p68 protein expression levels in clinical prostate biopsies. A, frequency of p68 immunostaining expression in PCa (66 of 147; 45%, GG3, GG4, and GG5) compared with BPH (11 of 44, 25%) biopsies. Fisher's exact test was used for statistical significance. B, representative images of p68 immunostaining in BPH, GG3, GG4, and GG5 PCa biopsy cores. Magnification, 5x. C, increasing p68 immunostaining expression with increasing GG of PCa. Kruskal-Wallis test was used for statistical significance. D, average p68 immunostaining expression in PCa compared with BPH. Mann-Whitney test was used for statistical significance.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
A number of AR transcriptional coregulators have been identified by our group and others that play a role in PCa (40). In this study, we reveal a novel role for the DEAD box RNA helicase p68 as an AR coactivator in PCa. Our results show that p68 is an AR-interacting protein and is associated with the AR at the promoter region of an androgen-responsive gene (PSA). By overexpression of p68 in luciferase reporter assays, we show a functional role for p68 as an AR transcriptional coactivator, dependent on Y593 phosphorylation, but independent of ATP-binding. Furthermore, p68 coactivator function was verified in vivo in PCa cells by p68 targeted RNAi demonstrating reduced expression of androgen-responsive endogenous protein (AR and PSA).

The requirement of ATP dependency in p68-mediated transcription is conflicting. A recent study suggested that ATP binding was required for the transcriptional activation of cyclin D1 by tyrosine phosphorylated p68 (24). However, helicase inactive ATPase mutants have been shown to coregulate transcription as efficiently as wild type for several other transcription factors (13, 14, 16, 17, 29), suggesting that the function of p68 as a transcriptional coregulator is independent of its RNA helicase activity. In agreement with these findings, we also show p68 ATPase mutants maintain coactivator function in ARE luciferase reporter assays demonstrating that neither ATPase activity nor a conformational change upon p68 ATP binding is required for AR coactivation. At present, it is unclear why the ATP-dependent activity of tyrosine phosphorylated p68 is specifically required for the transcription of the cyclin D1 promoter (24), but it may reflect differences in the way p68 functions as a direct transcriptional activator and as a coregulator.

The COOH terminal domain of p68 can bind single-stranded RNA and has been shown to be a target for protein kinase C (41). Phosphorylation of the COOH terminal domain of p68 consequently abolished RNA binding, and it was hypothesized that phosphorylated p68 may act as a molecular switch between transcriptional functions and splicing (42). In this study, we show that tyrosine phosphorylation of p68 on Y593 by c-Abl increased transcriptional coactivation of the AR. The Y593 phosphorylation of p68 has been implicated in promoting epithelial-mesenchymal transition via PDGF- and c-Abl–dependent pathways (23). Paracrine signaling and the role of stromal-epithelial interactions leading to loss of cell-cell adhesion in PCa has been well documented (43). Hence, a model where p68 may directly coactivate AR transcriptional activity and promote epithelial-mesenchymal transition-driven PCa progression would be of notable interest.

Recent evidence suggests that p68 may function as an "adaptor" or "coupling" protein that coordinates the tightly integrated processes of transcription and mRNA processing (10, 44, 45). p68 has key roles in U1snRNP-5' splice site complex stability, spliceosome assembly, pre-mRNA splicing (10), and mRNA transcript clearance (12). In this study, we show that p68 potentiates AR-regulated repression of splicing of a CD44 variable exon minigene. In contrast, the homologous DEAD box RNA helicase p72 promotes CD44 exon inclusion downstream of a hormone-responsive promoter (32). These results suggest that the effect of p68 on AR-dependent splicing may be via transcriptional coregulatory mechanisms, possibly regulated by the post-translational status of p68. Alternatively, recruitment of p68 to endogenous AR-responsive genes may facilitate spliceosome assembly and increase the rate of RNAPII elongation, affecting splice site recognition and promotion of exon skipping in nascent transcripts (46). AR is thought to enhance RNAPII elongation by interacting with transcription factor IIH (TFIIH) and positive transcription elongation factor b (47), which phosphorylate the COOH terminal domain of RNAPII switching from a nonprocessive to a processive form (4850). In this study, we show p68 is involved in both AR transcriptional coactivation and AR-mediated repression of splicing of an androgen-responsive gene. Therefore, p68 may serve as a common link between transcription and splicing machinery. RNA processing activities are thought to be strongly connected to efficient transcriptional coregulation, and this study provides evidence for p68 as part of a "molecular link" that involves the coupling of transcriptional initiation to mRNA processing.

Finally, we show that p68 is overexpressed in PCa biopsies compared with benign prostatic hyperplasia controls. There is an increase in the incidence of p68 expression by 2-fold and the level of expression increases by 3-fold (P = 0.008), highlighting the clinical significance of p68 in PCa. Not all PCa samples express p68, and this may represent a specific mechanism of disease progression in a discrete cohort. Although, there was limited correlation with other clinicopathologic variables (grade, stage, PSA, and prognosis), a putative role of p68 in PCa progression is shown by the functional data and the increased levels of expression in clinical samples.

Identifying cofactors that influence the development of hormone escape of PCa will be important in the development of effective therapies and prevention of hormone refractory PCa. This study provides strong evidence of the up-regulation of a novel AR coactivator in PCa, which may play a significant role in progression to androgen independence, as well as a role in epithelial-mesenchymal transition; activation of c-Abl pathways may enhance p68 function as a coactivator of AR-dependent gene expression in PCa. Hence, tyrosine kinase inhibitors, such as imatinib, may be of therapeutic benefit if posttranslational modifications are shown to be important in modulating p68 function and affect disease phenotypes.


    Disclosure of Potential Conflicts of Interest
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
No potential conflicts of interest were disclosed.


    Acknowledgments
 
Grant support: Medical Research Council/Cancer Research UK/Department of Health-Prostate Cancer Mechanisms of Progression and Treatment collaboration grant G0100100/64424 (C.N. Robson), Association for International Cancer Research grant 06-613 (F.V. Fuller-Pace), and Association for International Cancer Research grant 06-705 (D.J. Elliott and H.Y. Leung).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Susan Bray and the Tayside Tissue bank (University of Dundee) for the immunostaining of the prostate TMA, Professor Angus Lamond (University of Dundee) for the p68-YFP expression construct, and Professors Bert O'Malley (Baylor College of Medicine) and Stefan Stamm (University of Kentucky) for their kind gifts of minigene constructs. The funding bodies had no role in the design of the study, the collection, analysis, and interpretation of the data, the decision to submit the manuscript for publication, or the writing of the manuscript.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 3/13/08. Revised 6/16/08. Accepted 7/23/08.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Ferlay J, Autier P, Boniol M, Heanue M, Colombet M, Boyle P. Estimates of the cancer incidence and mortality in Europe in 2006. Ann Oncol 2007;18:581–92.[Abstract/Free Full Text]
  2. Gann PH. Interpreting recent trends in prostate cancer incidence and mortality. Epidemiology 1997;8:117–20.[Medline]
  3. Feldman BJ, Feldman D. The development of androgen-independent prostate cancer. Nat Rev Cancer 2001;1:34–45.[CrossRef][Medline]
  4. Chen CD, Welsbie DS, Tran C, et al. Molecular determinants of resistance to antiandrogen therapy. Nat Med 2004;10:33–9.[CrossRef][Medline]
  5. Chmelar R, Buchanan G, Need EF, Tilley W, Greenberg NM. Androgen receptor coregulators and their involvement in the development and progression of prostate cancer. Int J Cancer 2007;120:719–33.[CrossRef][Medline]
  6. Nieto M, Finn S, Loda M, Hahn WC. Prostate cancer: Re-focusing on androgen receptor signaling. Int J Biochem Cell Biol 2007;39:1562–8.[CrossRef][Medline]
  7. Fukuda T, Yamagata K, Fujiyama S, et al. DEAD-box RNA helicase subunits of the Drosha complex are required for processing of rRNA and a subset of microRNAs. Nat Cell Biol 2007;9:604–11.[CrossRef][Medline]
  8. Salzman DW, Shubert-Coleman J, Furneaux H. P68 RNA helicase unwinds the human let-7 microRNA precursor duplex and is required for let-7-directed silencing of gene expression. J Biol Chem 2007;282:32773–9.[Abstract/Free Full Text]
  9. Jalal C, Uhlmann-Schiffler H, Stahl H. Redundant role of DEAD box proteins p68 (Ddx5) and p72/p82 (Ddx17) in ribosome biogenesis and cell proliferation. Nucleic Acids Res 2007;35:3590–601.[Abstract/Free Full Text]
  10. Fuller-Pace FV. DExD/H box RNA helicases: multifunctional proteins with important roles in transcriptional regulation. Nucleic Acids Res 2006;34:4206–15.[Abstract/Free Full Text]
  11. Caretti G, Lei EP, Sartorelli V. The DEAD-box p68/p72 proteins and the noncoding RNA steroid receptor activator SRA: eclectic regulators of disparate biological functions. Cell Cycle 2007;6:1172–6.[Medline]
  12. Buszczak M, Spradling AC. The Drosophila P68 RNA helicase regulates transcriptional deactivation by promoting RNA release from chromatin. Genes Dev 2006;20:977–89.[Abstract/Free Full Text]
  13. Endoh H, Maruyama K, Masuhiro Y, et al. Purification and identification of p68 RNA helicase acting as a transcriptional coactivator specific for the activation function 1 of human estrogen receptor {alpha}. Mol Cell Biol 1999;19:5363–72.[Abstract/Free Full Text]
  14. Watanabe M, Yanagisawa J, Kitagawa H, et al. A subfamily of RNA-binding DEAD-box proteins acts as an estrogen receptor {alpha} coactivator through the N-terminal activation domain (AF-1) with an RNA coactivator, SRA. EMBO J 2001;20:1341–52.[CrossRef][Medline]
  15. Metivier R, Penot G, Hubner MR, et al. Estrogen receptor-{alpha} directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 2003;115:751–63.[CrossRef][Medline]
  16. Bates GJ, Nicol SM, Wilson BJ, et al. The DEAD box protein p68: a novel transcriptional coactivator of the p53 tumour suppressor. EMBO J 2005;24:543–53.[CrossRef][Medline]
  17. Caretti G, Schiltz RL, Dilworth FJ, et al. The RNA helicases p68/p72 and the noncoding RNA SRA are coregulators of MyoD and skeletal muscle differentiation. Dev Cell 2006;11:547–60.[CrossRef][Medline]
  18. Shin S, Rossow KL, Grande JP, Janknecht R. Involvement of RNA helicases p68 and p72 in colon cancer. Cancer Res 2007;67:7572–8.[Abstract/Free Full Text]
  19. Causevic M, Hislop RG, Kernohan NM, et al. Overexpression and poly-ubiquitylation of the DEAD-box RNA helicase p68 in colorectal tumours. Oncogene 2001;20:7734–43.[CrossRef][Medline]
  20. Jacobs AM, Nicol SM, Hislop RG, Jaffray EG, Hay RT, Fuller-Pace FV. SUMO modification of the DEAD box protein p68 modulates its transcriptional activity and promotes its interaction with HDAC1. Oncogene 2007;30:5866–76.
  21. Fuller-Pace FV, Jacobs AM, Nicol SM. Modulation of transcriptional activity of the DEAD-box family of RNA helicases, p68 (Ddx5) and DP103 (Ddx20), by SUMO modification. Biochem Soc Trans 2007;35:1427–9.[CrossRef][Medline]
  22. Yang L, Lin C, Liu ZR. Signaling to the DEAD box-regulation of DEAD-box p68 RNA helicase by protein phosphorylations. Cell Signal 2005;17:1495–504.[CrossRef][Medline]
  23. Yang L, Lin C, Liu ZR. P68 RNA helicase mediates PDGF-induced epithelial mesenchymal transition by displacing Axin from β-catenin. Cell 2006;127:139–55.[CrossRef][Medline]
  24. Yang L, Lin C, Zhao S, Wang H, Liu ZR. Phosphorylation of p68 RNA helicase plays a role in platelet-derived growth factor-induced cell proliferation by up-regulating cyclin D1 and c-Myc expression. J Biol Chem 2007;282:16811–9.[Abstract/Free Full Text]
  25. Stucke VM, Gorses D, Hofmann F. DEAD-box RNA helicase p68 is not required for nuclear translocation of β-catenin in colon cancer cells. Cell Cycle 2008;7:830–2.[Medline]
  26. Brady ME, Ozanne DM, Gaughan L, et al. Tip60 is a nuclear hormone receptor coactivator. J Biol Chem 1999;274:17599–604.[Abstract/Free Full Text]
  27. Sahadevan K, Darby S, Leung HY, Mathers ME, Robson CN, Gnanapragasam VJ. Selective overexpression of fibroblast growth factor receptors 1 and 4 in clinical prostate cancer. J Pathol 2007;213:82–90.[CrossRef][Medline]
  28. Rigas AC, Ozanne DM, Neal DE, Robson CN. The scaffolding protein RACK1 interacts with androgen receptor and promotes cross-talk through a protein kinase C signaling pathway. J Biol Chem 2003;278:46087–93.[Abstract/Free Full Text]
  29. Wilson BJ, Bates GJ, Nicol SM, Gregory DJ, Perkins ND, Fuller-Pace FV. The p68 and p72 DEAD box RNA helicases interact with HDAC1 and repress transcription in a promoter-specific manner. BMC Mol Biol 2004;5:11.[CrossRef][Medline]
  30. Gaughan L, Logan IR, Neal DE, Robson CN. Regulation of androgen receptor and histone deacetylase 1 by Mdm2-mediated ubiquitylation. Nucleic Acids Res 2005;33:13–26.[Abstract/Free Full Text]
  31. Rajan P, Gaughan L, Dalgliesh C, et al. The RNA-binding and adaptor protein Sam68 modulates signal-dependent splicing and transcriptional activity of the androgen receptor. J Pathol 2008;215:67–77.[CrossRef][Medline]
  32. Auboeuf D, Honig A, Berget SM, O'Malley BW. Coordinate regulation of transcription and splicing by steroid receptor coregulators. Science 2002;298:416–9.[Abstract/Free Full Text]
  33. Venables JP, Bourgeois CF, Dalgliesh C, Kister L, Stevenin J, Elliott DJ. Up-regulation of the ubiquitous alternative splicing factor Tra2β causes inclusion of a germ cell-specific exon. Hum Mol Genet 2005;14:2289–303.[Abstract/Free Full Text]
  34. Gaughan L, Logan IR, Cook S, Neal DE, Robson CN. Tip60 and histone deacetylase 1 regulate androgen receptor activity through changes to the acetylation status of the receptor. J Biol Chem 2002;277:25904–13.[Abstract/Free Full Text]
  35. Logan IR, Gaughan L, McCracken SR, Sapountzi V, Leung HY, Robson CN. Human PIRH2 enhances androgen receptor signaling through inhibition of histone deacetylase 1 and is overexpressed in prostate cancer. Mol Cell Biol 2006;26:6502–10.[Abstract/Free Full Text]
  36. Plevin MJ, Mills MM, Ikura M. The LxxLL motif: a multifunctional binding sequence in transcriptional regulation. Trends Biochem Sci 2005;30:66–9.[CrossRef][Medline]
  37. Honig A, Auboeuf D, Parker MM, O'Malley BW, Berget SM. Regulation of alternative splicing by the ATP-dependent DEAD-box RNA helicase p72. Mol Cell Biol 2002;22:5698–707.[Abstract/Free Full Text]
  38. Auboeuf D, Batsche E, Dutertre M, Muchardt C, O'Malley BW. Coregulators: transducing signal from transcription to alternative splicing. Trends Endocrinol Metab 2007;18:122–9.[CrossRef][Medline]
  39. Sun J, Blair AL, Aiyar SE, Li R. Cofactor of BRCA1 modulates androgen-dependent transcription and alternative splicing. J Steroid Biochem Mol Biol 2007;107:131–9.[CrossRef][Medline]
  40. Heemers HV, Tindall DJ. Androgen receptor (AR) coregulators: a diversity of functions converging on and regulating the AR transcriptional complex. Endocr Rev 2007;28:778–808.[Abstract/Free Full Text]
  41. Buelt MK, Glidden BJ, Storm DR. Regulation of p68 RNA helicase by calmodulin and protein kinase C. J Biol Chem 1994;269:29367–70.[Abstract/Free Full Text]
  42. Yang L, Yang J, Huang Y, Liu ZR. Phosphorylation of p68 RNA helicase regulates RNA binding by the C-terminal domain of the protein. Biochem Biophys Res Commun 2004;314:622–30.[CrossRef][Medline]
  43. Chung LW, Baseman A, Assikis V, Zhau HE. Molecular insights into prostate cancer progression: the missing link of tumor microenvironment. J Urol 2005;173:10–20.[CrossRef][Medline]
  44. Auboeuf D, Dowhan DH, Dutertre M, Martin N, Berget SM, O'Malley BW. A subset of nuclear receptor coregulators act as coupling proteins during synthesis and maturation of RNA transcripts. Mol Cell Biol 2005;25:5307–16.[Free Full Text]
  45. Ares M, Jr., Proudfoot NJ. The spanish connection: transcription and mRNA processing get even closer. Cell 2005;120:163–6.[Medline]
  46. Clark EL, Fuller-Pace FV, Elliott DJ, Robson CN. Coupling transcription to RNA processing via the p68 DEAD box RNA helicase androgen receptor co-activator in prostate cancer. Biochem Soc Trans 2008;36:546–7.[CrossRef][Medline]
  47. Lee DK, Duan HO, Chang C. Androgen receptor interacts with the positive elongation factor P-TEFb and enhances the efficiency of transcriptional elongation. J Biol Chem 2001;276:9978–84.[Abstract/Free Full Text]
  48. Fong YW, Zhou Q. Stimulatory effect of splicing factors on transcriptional elongation. Nature 2001;414:929–33.[CrossRef][Medline]
  49. Ni Z, Schwartz BE, Werner J, Suarez JR, Lis JT. Coordination of transcription, RNA processing, and surveillance by P-TEFb kinase on heat shock genes. Mol Cell 2004;13:55–65.[CrossRef][Medline]
  50. Nogues G, Kadener S, Cramer P, Bentley D, Kornblihtt AR. Transcriptional activators differ in their abilities to control alternative splicing. J Biol Chem 2002;277:43110–4.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Clark, E. L.
Right arrow Articles by Robson, C. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Clark, E. L.
Right arrow Articles by Robson, C. N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online